microRNA biomarker and application thereof

A biomarker, mir-25 technology, applied in the field of microRNA biomarkers and its application in the detection of liver cancer patients, can solve the lack of systematic analysis reports on serum RNA stability research, and the limited storage time of miRNA stability research , temperature and repeated freezing and thawing

Inactive Publication Date: 2011-04-06
ZHEJIANG SCI-TECH UNIV
View PDF4 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, studies on the stability of miRNA are limited to storage time, temperature and repeated freezing and thawing, etc. There is no systematic analysis report on the stability of serum RNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • microRNA biomarker and application thereof
  • microRNA biomarker and application thereof
  • microRNA biomarker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0108] Example 1 Biomarkers and Detection Primers and Probes

[0109] The present invention provides a set of miRNA biomarkers comprising miR-21, miR-25, miR-29c, miR-93, miR-198, miR-221 and miR-222. The specific sequence of this group of biomarkers is as follows:

[0110] miR-21: uagcuuaucagacugauguuga (SEQ ID NO: 1)

[0111] miR-25: cauugcacuugucucggucuga (SEQ ID NO: 2)

[0112] miR-29c: uagcaccauuugaaaucgguua (SEQ ID NO: 3)

[0113] miR-93: caaagugcuguucgugcagguag (SEQ ID NO: 4)

[0114] miR-198: gguccagaggggagauagguuc (SEQ ID NO: 5)

[0115] miR-221: agcuacauugucugcuggguuuc (SEQ ID NO: 6)

[0116] miR-222: agcuacaucuggcuacugggu (SEQ ID NO: 7)

[0117] Stem-loop primer method: Using the stem-loop primer method to detect the expression of miRNA requires specific stem-loop primers and PCR primers for the specific sequence of the miRNA. During the PCR amplification process, SYBR-green color development was used to quantitatively detect the amplification of the target m...

Embodiment 2

[0142] Embodiment 2 Experimental material and experimental reagent

[0143] In the present invention, the liver cancer cell line Huh-7, liver cancer tissues, 22 clinical normal serum samples (including 11 males and 11 females) and 10 clinical liver cancer serum samples were used. All of the above are isolated tissues.

[0144] The experimental reagents are commonly used molecular biology reagents, mainly including: Trizol reagent, chloroform, isopropanol, ethanol, DNA polyacrylamide gel electrophoresis reagent and other conventional biochemical reagents were purchased from Shanghai Sangong Company. M-MLV reverse transcriptase, RNase inhibitor, and dNTP mixture for reverse transcription (each 10 mM, RNase-free) were purchased from TaKaRa Company. Fluorescence quantitative PCR kit is a TOYOBO product.

Embodiment 3

[0145] Example 3 Detection of miRNA expression in liver cancer cell lines, tissues and serum by stem-loop primer method

[0146] 1. cDNA synthesis

[0147]Add 100ng of total RNA of liver cancer Huh-7 cell line, 100ng of total RNA of liver cancer tissue, 40ng of RNA extracted from serum, and 13μL of serum to four RNase-free 0.2mL PCR tubes. If the total volume of the above is less than 13μL, add DEPC water to supplement. to a total volume of 13 μL, then denatured at 70°C for 8 min, and then quickly placed on ice for 3 min, then sequentially added 0.5 μL RNase inhibitor (40 U / μL), 1 μL dNTP mixture (each 10 mM, RNase-free), 4 μL 5×M-MLV buffer solution, 1 μL of the stem-loop primer (2 μM) and 0.5 μL of M-MLV reverse transcriptase (200 U / μL) as described in Example 1, to make the total volume to 20 μL, mix well and centrifuge slightly, and carry out the first step of cDNA in a PCR machine. For one-strand synthesis, the reaction parameters were set at 16°C for 15 minutes, 42°C fo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a microRNA biomarker. The microRNA biomarker is one of miR-21, miR-25, miR-29c, miR-93, miR-198, miR-221 and miR-222 the sequences of which are correspondingly shown in SEQ ID NO:1-SEQ ID NO:7. The invention also discloses an application of the microRNA biomarker in preparing a kit capable of detecting liver cancer. The invention simultaneously discloses a kit capable of detecting liver cancer. The kit consists of a reverse transcription system, an amplification system and a primer system, wherein the primer system comprises the stem-loop primer and amplification primer of one of the miR-21, the miR-25, the miR-29c, the miR-93, the miR-198, the miR-221 and the miR-222. The invention can be used for screening and diagnosing the liver cancer.

Description

technical field [0001] The invention belongs to the fields of biotechnology and medicine, and relates to a method for analyzing the stability of microRNA in serum / plasma samples, discovering a group of microRNA biomarkers and its application in the detection of liver cancer patients. The biomarker, detection method and detection kit provided by the invention have the ability of early screening and diagnosis of liver cancer. Background technique [0002] microRNAs (miRNAs) are a class of non-coding small RNA molecules with a length of 17-25 nt. It is highly conserved, temporally and tissue-specific, and plays multiple roles in the regulation of cell growth and development. About 50% of the known human miRNA genes are located in tumor-related chromosomal regions, and the accumulated research results have fully confirmed that the abnormal expression of miRNA is closely related to the occurrence and development of tumors. [0003] Blood is the most commonly used sample source ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor丁先锋郭江峰李艳徐立坚姚虎吕佳岚朱恒怡
OwnerZHEJIANG SCI-TECH UNIV