Gene editing method for knocking out rice MIRNA393b stem-loop sequences with application of CRISPR(clustered regulatory interspersed short palindromic repeat)-Cas9 system
A stem-loop sequence and system knockout technology is applied in the field of rice transgenic material construction, which can solve the problems of missing rice mutants that have not been reported, inability to distinguish MIR393a and MIR393b genes, and inability to completely eliminate the role of MIR393 genes.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Publication Date
- 2016-06-08
- Estimated Expiration
- Not applicable · inactive patent
Smart Images
Figure 1 Figure 2 Figure 3
Abstract
Description
technical field
[0001] The invention relates to the construction of rice transgenic materials, in particular to a gene editing method for knocking out the MIR393b stem-loop sequence by using the CRISPR-Cas9 system. Background technique
[0002] Rice is an important food crop in the world and a model organism for the study of monocots. miRNA393 is a conserved microRNA family in plants, which regulates the auxin signaling pathway by negatively regulating the auxin receptor TIR1 / AFBs family proteins at the post-transcriptional level. At present, its functional research mainly includes three aspects: plant immune response, growth and development and stress response. However, the function of miR393 in rice is still poorly understood, mainly due to mutant material lacking this gene.
[0003] In the past few years, the functional studies of rice miRNAs were mainly carried out by transgenic methods that simulate competing target genes. However, the MIM393 strain that simulates th...
Examples
Embodiment 1
[0048] Example 1 Obtainment and Identification of Rice MIRNA393b Stem-loop Sequence Knockout Line
[0049] The rice variety transferred in the present invention is Nipponbare (Oryza. Sativa L. spp. japonica, var Nipponbare).
[0050] 1. Selection of gRNA target sites
[0051] Since the MIR393b gene is located on the fourth chromosome of the rice genome, according to the principle of designing the target site of the CRISPR-Cas9 technology, the present invention designs the first target site on the precursor stem-loop sequence of the MIR393b gene, and the second The target site is 3' downstream of the stem-loop sequence. See figure 1 .
[0052] 2. Cloning of gRNA fragments and vector construction
[0053] 2.1 Using the plasmid pGTR as a template, use the PCR method to clone the partially overlapping fragments of the three fragments L1, L2, and L3. The primer sequences are as follows:
[0054] L1F: cgggtctcaggcaggatgggcagtctgggcaacaaagcaccagtgg (shown in SEQ ID NO: 1)
[0055...