Gene editing method for knocking out rice MIRNA393b stem-loop sequences with application of CRISPR(clustered regulatory interspersed short palindromic repeat)-Cas9 system

A stem-loop sequence and system knockout technology is applied in the field of rice transgenic material construction, which can solve the problems of missing rice mutants that have not been reported, inability to distinguish MIR393a and MIR393b genes, and inability to completely eliminate the role of MIR393 genes.

Inactive Publication Date: 2016-06-08
ZHEJIANG UNIV
View PDF1 Cites 62 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the MIM393 strain that simulates the competing target gene cannot completely eliminate the function of the MIR393 gene, and cannot distinguish the functions of the MIR393a and MIR393b genes. Therefore, it is necessary to construct its MIR393a and MIR393b specific gene knockout strains in order to elucidate the family members The real biological function of MIR393a / b gene
However, no rice mutants lacking the MIR393a or MIR393b genes have been reported so far.
However, there is no report on the use of this technology to knock out the stem-loop sequence of the rice MIRNA gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene editing method for knocking out rice MIRNA393b stem-loop sequences with application of CRISPR(clustered regulatory interspersed short palindromic repeat)-Cas9 system
  • Gene editing method for knocking out rice MIRNA393b stem-loop sequences with application of CRISPR(clustered regulatory interspersed short palindromic repeat)-Cas9 system
  • Gene editing method for knocking out rice MIRNA393b stem-loop sequences with application of CRISPR(clustered regulatory interspersed short palindromic repeat)-Cas9 system

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1 Obtainment and Identification of Rice MIRNA393b Stem-loop Sequence Knockout Line

[0049] The rice variety transferred in the present invention is Nipponbare (Oryza. Sativa L. spp. japonica, var Nipponbare).

[0050] 1. Selection of gRNA target sites

[0051] Since the MIR393b gene is located on the fourth chromosome of the rice genome, according to the principle of designing the target site of the CRISPR-Cas9 technology, the present invention designs the first target site on the precursor stem-loop sequence of the MIR393b gene, and the second The target site is 3' downstream of the stem-loop sequence. See figure 1 .

[0052] 2. Cloning of gRNA fragments and vector construction

[0053] 2.1 Using the plasmid pGTR as a template, use the PCR method to clone the partially overlapping fragments of the three fragments L1, L2, and L3. The primer sequences are as follows:

[0054] L1F: cgggtctcaggcaggatgggcagtctgggcaacaaagcaccagtgg (shown in SEQ ID NO: 1)

[0055...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to construction of rice transgenic materials and aims to provide a gene editing method for knocking out rice MIRNA393b stem-loop sequences with application of a CRISPR(clustered regulatory interspersed short palindromic repeat)-Cas9 system. The gene editing method comprises steps as follows: gRNA target sites are selected for cloning and GG linking, enzyme digestion is performed after amplification, and a product is linked with a pGREB 32 vector; escherichia coli competent cells are transformed; plasmids with a correct sequencing result are used for transforming agrobacteria, transgenic plants are obtained through mediated transformation of rice calli, and transgenic positive lines are obtained; the T0-generation mutant plant seeds are collected for seeding, and the T1-generation plants are subjected to homozygote screening; homozygous lines which are discovered to be negative through MIRNA393b expression are rice mutants completely losing the MIRNA393b stem-loop sequences and MIRNA393b stem-loop sequence expression. According to the gene editing method, MIRNA stem-loop sequences can be effectively knocked out, and loss-of-function mutants of different members in the same MIRNA family can be prepared; the mutant plant propagates to obtain a large number of seeds and is an ideal material for acquiring rice MIRNA393b gene functions successfully.

Description

technical field [0001] The invention relates to the construction of rice transgenic materials, in particular to a gene editing method for knocking out the MIR393b stem-loop sequence by using the CRISPR-Cas9 system. Background technique [0002] Rice is an important food crop in the world and a model organism for the study of monocots. miRNA393 is a conserved microRNA family in plants, which regulates the auxin signaling pathway by negatively regulating the auxin receptor TIR1 / AFBs family proteins at the post-transcriptional level. At present, its functional research mainly includes three aspects: plant immune response, growth and development and stress response. However, the function of miR393 in rice is still poorly understood, mainly due to mutant material lacking this gene. [0003] In the past few years, the functional studies of rice miRNAs were mainly carried out by transgenic methods that simulate competing target genes. However, the MIM393 strain that simulates th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/82A01H5/00
CPCC12N15/8205C12N15/113C12N15/8216C12N2310/141C12N2800/80C12N2810/10
Inventor边红武韩凝郭芾房克杨亦农朱睦元
OwnerZHEJIANG UNIV