Gene editing method for knocking out rice MIRNA393b stem-loop sequences with application of CRISPR(clustered regulatory interspersed short palindromic repeat)-Cas9 system

A stem-loop sequence and system knockout technology is applied in the field of rice transgenic material construction, which can solve the problems of missing rice mutants that have not been reported, inability to distinguish MIR393a and MIR393b genes, and inability to completely eliminate the role of MIR393 genes.

CN105647962AInactive Publication Date: 2016-06-08ZHEJIANG UNIV
1 Cites 62 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Publication Date
2016-06-08
Estimated Expiration
Not applicable · inactive patent

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention relates to construction of rice transgenic materials and aims to provide a gene editing method for knocking out rice MIRNA393b stem-loop sequences with application of a CRISPR(clustered regulatory interspersed short palindromic repeat)-Cas9 system. The gene editing method comprises steps as follows: gRNA target sites are selected for cloning and GG linking, enzyme digestion is performed after amplification, and a product is linked with a pGREB 32 vector; escherichia coli competent cells are transformed; plasmids with a correct sequencing result are used for transforming agrobacteria, transgenic plants are obtained through mediated transformation of rice calli, and transgenic positive lines are obtained; the T0-generation mutant plant seeds are collected for seeding, and the T1-generation plants are subjected to homozygote screening; homozygous lines which are discovered to be negative through MIRNA393b expression are rice mutants completely losing the MIRNA393b stem-loop sequences and MIRNA393b stem-loop sequence expression. According to the gene editing method, MIRNA stem-loop sequences can be effectively knocked out, and loss-of-function mutants of different members in the same MIRNA family can be prepared; the mutant plant propagates to obtain a large number of seeds and is an ideal material for acquiring rice MIRNA393b gene functions successfully.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention relates to the construction of rice transgenic materials, in particular to a gene editing method for knocking out the MIR393b stem-loop sequence by using the CRISPR-Cas9 system. Background technique

[0002] Rice is an important food crop in the world and a model organism for the study of monocots. miRNA393 is a conserved microRNA family in plants, which regulates the auxin signaling pathway by negatively regulating the auxin receptor TIR1 / AFBs family proteins at the post-transcriptional level. At present, its functional research mainly includes three aspects: plant immune response, growth and development and stress response. However, the function of miR393 in rice is still poorly understood, mainly due to mutant material lacking this gene.

[0003] In the past few years, the functional studies of rice miRNAs were mainly carried out by transgenic methods that simulate competing target genes. However, the MIM393 strain that simulates th...

Examples

Embodiment 1

[0048] Example 1 Obtainment and Identification of Rice MIRNA393b Stem-loop Sequence Knockout Line

[0049] The rice variety transferred in the present invention is Nipponbare (Oryza. Sativa L. spp. japonica, var Nipponbare).

[0050] 1. Selection of gRNA target sites

[0051] Since the MIR393b gene is located on the fourth chromosome of the rice genome, according to the principle of designing the target site of the CRISPR-Cas9 technology, the present invention designs the first target site on the precursor stem-loop sequence of the MIR393b gene, and the second The target site is 3' downstream of the stem-loop sequence. See figure 1 .

[0052] 2. Cloning of gRNA fragments and vector construction

[0053] 2.1 Using the plasmid pGTR as a template, use the PCR method to clone the partially overlapping fragments of the three fragments L1, L2, and L3. The primer sequences are as follows:

[0054] L1F: cgggtctcaggcaggatgggcagtctgggcaacaaagcaccagtgg (shown in SEQ ID NO: 1)

[0055...