A cow mammary gland epithelial cell line knocked out of acadsb gene and its construction method

A breast epithelial cell and gene technology, applied in the field of genetic engineering, can solve problems such as unstable inheritance and siRNA interference

Active Publication Date: 2020-07-03
GUANGDONG OCEAN UNIVERSITY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to overcome the deficiencies in the prior art, provide a kind of ACADSB gene knockout model that utilizes dairy cow mammary gland epithelial cell line to establish, effectively overcome the technical defect that siRNA interference cannot be stably inherited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A cow mammary gland epithelial cell line knocked out of acadsb gene and its construction method
  • A cow mammary gland epithelial cell line knocked out of acadsb gene and its construction method
  • A cow mammary gland epithelial cell line knocked out of acadsb gene and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 ACADSB gene knockout target site setting, sgRNA design

[0040] First, determine the position of the conserved domain of the ACADSB (ENSBTAT00000024017.2) gene protein to better ensure the knockout effect. The target sequence to be knocked out is designed in the corresponding coding region, that is, the fifth exon of the ACADSB gene, and sgRNA is designed, and two pairs of recognition sequences (sgRNA) are designed, as follows,

[0041] ACADSB gRNA1:GAGATTATTACATCATCAAT GGG (SEQ ID NO: 1);

[0042] ACADSB gRNA2: GGAGATTATTACATCATCAATGG (SEQ ID NO: 2).

[0043] Design DNA oligos to synthesize double-stranded gRNA, and its specific primer sequences are as follows:

[0044]ACADSB gRNA1F: CACCGAGATTATTACATCATCAAT (SEQ ID NO: 3);

[0045] ACADSB gRNA1R: AAACATTGATGATGTAATAATCTC (SEQ ID NO: 4);

[0046] ACADSB gRNA2F: CACCGGAGATTATTACATCATCAA (SEQ ID NO: 5);

[0047] ACADSB gRNA2R: AAACTTGATGATGTAATAATCTCC (SEQ ID NO: 6).

[0048] ACADSB detection primer F: 5'...

Embodiment 2

[0050] Example 2 Construction of gRNA expression vector

[0051] 1. Experimental method

[0052] Anneal the forward and reverse single-stranded oligonucleotide sequences to obtain a double-stranded oligonucleotide fragment, and connect it with the PX458 vector that was digested by BBSI and linearized to obtain a recombinant plasmid, denoted as PX458-ACADSB gRNA1 and PX458-ACADSB gRNA2.

[0053] The specific operation is as follows:

[0054] (1) After gRNA synthesis, use ddH 2 The primers (SEQ ID NO: 3-6) were dissolved in O water to 100 μM, and the single-stranded oligonucleotides were annealed to obtain double-stranded oligonucleotides.

[0055] Annealing reaction system: add 1 μL each of the upstream and downstream primers, ddH 2 O 43 μL, NEB buffer (10x) 5 μL.

[0056] Annealing reaction conditions: React at 95°C for 10 minutes on a PCR instrument, then gradually lower the temperature at a rate of 5°C / min until the temperature drops to 25°C. The annealed primers were ...

Embodiment 3

[0066] Construction of Example 3 Knockout Cell Lines

[0067] The recombinant plasmid was transiently transfected into cow mammary gland epithelial cells, a single positive cell expressing green fluorescent protein was screened by flow cytometry, and the positive cell line of ACADSB gene knockout was obtained by expanding culture.

[0068] 1. Experimental method

[0069] (1) Transfection of cell lines

[0070] The dairy cow mammary gland epithelial cell line constructed earlier by the research group was used as the research object, and the cells were cultured in a 6-well plate, and replaced with fresh DMEM / F12 medium (without resistance) containing 10% FBS, until the confluence of the cells reached 70 Transfection started at -80%.

[0071] Dilute 3 μg of the recombinant plasmid and 6 μL of Fugene HD transfection reagent into 200 μL of opti-MEM, mix gently, and after standing for 20 minutes, gently add dropwise to the cells that have been changed to DMEM / F12 basal medium in a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a dairy cow mammary gland endothelial cell line under ACADSB gene knockout and a construction method of the cell line. According to the method, a recognition sequence of gRNA for knocking out the ACADSB gene is utilized, and the nucleotide sequence of the recognition sequence is shown in SEQ ID NO.1. The ACADSB gene is precisely and efficiently knocked out through the designed gRNA, and the dairy cow mammary gland endothelial cell line under ACADSB gene knockout is effectively constructed. According to the dairy cow mammary gland endothelial cell line and the construction method, the defect that an RNAi technology is low in interference efficiency is overcome, and the method for constructing the gene-knockout cell line is simple and efficient. The ACADSB gene is animportant marker gene relevant to lipid metabolism and fatty acid metabolism; through the construction of the knockout cell line of the gene, effective materials and gene tools are provided for further research on gene functions relevant to lipid metabolism and fatty acid metabolism pathways.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, and more specifically relates to a dairy cow mammary gland epithelial cell line knocked out of the ACADSB gene and a construction method thereof. Background technique [0002] CRISPR-Cas9 gene editing technology is the third generation of gene editing technology developed rapidly after ZFN and TALEN technology. And gradually developed. CRISPR-Cas genome editing technology mainly uses a piece of RNA to identify the target site, and uses Cas 9 endonuclease to cut the nucleic acid near the target site to achieve fixed-point editing of the gene, which greatly improves the efficiency of gene editing. The effect of genetic modification on various cell models and animal models has been realized. [0003] The mammary gland tissue of dairy cows has the physiological function of synthesizing and secreting milk, and can be used as a bioreactor for most biological researches. The mammary gland...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/85C12N15/90C12N15/11C12N5/10
Inventor姜平赵志辉靳子康高振刘娟潘子意
OwnerGUANGDONG OCEAN UNIVERSITY