A cow mammary gland epithelial cell line knocked out of cd44 gene and its construction method

A technology of mammary epithelial cells and cows, applied in the field of genetic engineering, can solve problems such as unstable inheritance and siRNA interference

Active Publication Date: 2021-10-26
GUANGDONG OCEAN UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a CD44 gene knockout model established by using dairy cow mammary gland epithelial cell lines, which effectively overcomes the technical defect that siRNA interference cannot be stably inherited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A cow mammary gland epithelial cell line knocked out of cd44 gene and its construction method
  • A cow mammary gland epithelial cell line knocked out of cd44 gene and its construction method
  • A cow mammary gland epithelial cell line knocked out of cd44 gene and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 The setting of CD44 gene knockout target site and the design of sgRNA

[0042] First, determine the position of the conserved domain of the CD44 (ENSBTAT00000015381.4) gene protein to better ensure the knockout effect. Design the target sequence to be knocked out in the corresponding coding region, that is, the first exon of the CD44 gene, design sgRNA, and design a pair of recognition sequences (sgRNA), as follows,

[0043] CD44 gRNA: CCGACGCCATGGACACGTTT TGG (SEQ ID NO: 1).

[0044] Design DNA oligos to synthesize double-stranded gRNA, and the specific primer sequences are as follows:

[0045]CD44 gRNA F: CACCGCCGACGCCATGGACACGTTT (SEQ ID NO: 2);

[0046] CD44 gRNA R: AAACAAACGTGTCCATGGCGTCGGC (SEQ ID NO: 3).

[0047] CD44 detection primer F: 5'-CTCCCCTCTTAGGTCACTCTCTCAA-3' (SEQ ID NO: 4);

[0048] CD44 detection primer R: 5'-ACAAAACGGTGCTTCCCAC-3' (SEQ ID NO: 5).

Embodiment 2

[0049] Example 2 Construction of gRNA expression vector

[0050] 1. Experimental method

[0051] Anneal the forward and reverse single-stranded oligonucleotide sequences to obtain a double-stranded oligonucleotide fragment, and connect it with the PX458 vector that was digested by BBSI and linearized to obtain a recombinant plasmid, which is designated as PX458-CD44 -gRNA

[0052] The specific operation is as follows:

[0053] (1) After gRNA synthesis, use ddH 2 The primer (SEQ ID NO: 2-3) was dissolved in O water to 100 μM, and the single-stranded oligonucleotide was annealed to obtain a double-stranded oligonucleotide.

[0054] Annealing reaction system: add 1 μL each of the upstream and downstream primers, ddH 2 O 43 μL, NEB buffer (10×) 5 μL.

[0055] Annealing reaction conditions: React at 95°C for 10 minutes on a PCR instrument, then gradually lower the temperature at a rate of 5°C / min until the temperature drops to 25°C. The annealed primers were diluted 50 times ...

Embodiment 3

[0065] Construction of Example 3 Knockout Cell Lines

[0066] The recombinant plasmid was transiently transfected into cow mammary gland epithelial cells, a single positive cell expressing green fluorescent protein was screened by flow cytometry, and the positive cell line of CD44 gene knockout was obtained by expanding culture.

[0067] 1. Experimental method

[0068] (1) Transfection of cell lines

[0069] The dairy cow mammary gland epithelial cell line established by the research group was used as the research object. The cells were cultured in a 6-well plate, replaced with fresh DMEM / F12 medium containing 10% FBS, and transfected when the cell confluence reached 80%. .

[0070] Dilute 2.5 μg of recombinant plasmid and 6 μL of Fugene HD transfection reagent into 200 μL of DMEM / F12 medium, mix gently, and after standing for 20 minutes, gently add it dropwise to the cells that have been replaced with fresh medium in advance, and place at 37 Cultivate in a cell incubator a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cow mammary gland epithelial cell line knocked out of the CD44 gene and a construction method thereof. The method utilizes a recognition sequence of a gRNA knocking out the CD44 gene, the nucleotide sequence of which is shown in SEQ ID NO:1. The present invention utilizes the gRNA designed by the inventor to accurately and efficiently knock out the CD44 gene, and effectively constructs a dairy cow mammary epithelial cell with the CD44 gene knocked out. The present invention solves the defect of low interference efficiency in RNAi technology and provides a A simple and efficient method for constructing gene knockout cell lines. CD44 gene is an important marker gene related to lipid metabolism and fatty acid metabolism. The establishment of its knockout cell line also provides effective genetic materials and genetic tools for further research on the functions of genes related to lipid metabolism and fatty acid metabolism pathways.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, more specifically, to a cow mammary gland epithelial cell line knocked out of the CD44 gene and a construction method thereof. Background technique [0002] Gene editing technology refers to the artificial modification of genomic DNA sequences through a series of methods, including the knockout, insertion and replacement of specific DNA fragments, etc., to complete the precise editing of specified DNA fragments at the genome level, thereby affecting The expression levels and related functions of target genes and regulatory elements. CRISPR-Cas9 gene editing technology is the third-generation gene editing technology developed rapidly after ZFN and TALEN technology. The CRISPR-Cas genome editing technology mainly uses a piece of RNA to identify the target site, and the Cas 9 endonuclease cuts the nucleic acid near the target site to realize the fixed-point editing of the gene, and real...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/11C12N5/10C12N15/90C12Q1/686C12R1/91
CPCC07K14/70585C12N5/0631C12N15/113C12N15/907C12N2510/00C12Q1/686C12N2310/20C12Q2537/165
Inventor姜平赵志辉靳子康潘子意高振刘娟
OwnerGUANGDONG OCEAN UNIVERSITY