60 results about "Cellular Autophagy" patented technology

The invention belongs to the technical field of natural medicines, and particularly relates to application of spermidine alkaloid in preparation of anti-tumor medicines and / or reversion of drug resistance. The invention provides an application of macrocyclic spermidine alkaloid in preparation of anti-tumor drugs and / or reverse drug resistance. The macrocyclic spermidine alkaloid comprises one or more than two of 13-oxo-furan celastrus orbiculatus, furan celastrus orbiculatus, benzene-substituted celastrus orbiculatus and celastrus orbiculatus cinnamamide alkali. The macrocyclic spermidine alkaloid disclosed by the invention has the characteristics of broad-spectrum anti-tumor effect, good anti-tumor effect, relatively low toxic and side effects, capability of reversing 5-fluorouracil drug resistance, relatively high water solubility, relatively easy source, simple structure, only one chiral carbon in the structure, relatively easy artificial synthesis, intervention in cell autophagy mechanism and the like, so that the overall treatment cost is relatively low; the method has a potential important clinical application prospect.

The invention belongs to the technical field of cosmetics, and discloses a whitening composition for activating an autophagy pathway, which comprises the following components by weight: 15-25 parts of 4-butylresorcinol; 25 to 40 parts of a diglucosyl gallic acid solution; 2.5 to 4 parts of trehalose; 1 to 2 parts of sodium mannose phosphate; according to the whitening composition, the 4-butylresorcinol and the diglucosyl gallic acid are used as main whitening components, and the trehalose and the sodium mannose phosphate are used as cell autophagy active components, so that the whitening effect of the whitening components can be ensured, and the purpose of remarkably improving the whitening effect is achieved. Meanwhile, the invention further provides application and cosmetics of the composition.

The invention discloses a pathological autophagy detection method based on a myocardial cell sensing system. The pathological autophagy detection method comprises the following steps: constructing a pathological autophagy detection platform based on the myocardial cell sensing system, performing surface modification on a microelectrode array chip, culturing a cell autophagy sensitive element and performing in-vitro pathological autophagy detection. Through primary myocardial cell culture, rapamycin action and electrophysiological signal acquisition, time domain and frequency domain characteristics of myocardial cell extracellular local field potential signals are recorded and analyzed in real time, and the autophagy degree induced by rapamycin is judged. According to the method, the signal-to-noise ratio is improved through platinum black nanoparticle modification, it is ensured that the myocardial cell growth activity meets the detection requirement, the half inhibitory concentration of rapamycin is obtained through nonlinear regression analysis, and an effective means is provided for pathological autophagy research. The autophagy state can be obtained in real time without damaging the cell structure; any antigen or fluorescent molecular marker is not needed, so that cytotoxicity is avoided, and long-time monitoring is realized.

This invention provides a highly water-soluble composition for promoting autophagy and its application. The composition comprises 5-hydroxyflavone, acetylhydroxyproline, and a suitable solvent. This composition is a unique vesicular composition that enables efficient delivery and synergistic effects of the two active ingredients. It promotes autophagy, has improved solubility, stability, and antioxidant properties, and can prevent and repair skin photodamage at its source. This invention also discloses a method for preparing this composition and its applications.

The invention discloses a liver cancer cell line with LAPTM5 gene stable overexpression as well as a construction method and application of the liver cancer cell line. According to the invention, a human liver cancer cell line Huh7-LAPTM5 overexpression cell line is successfully constructed through a lentivirus transfection technology. Protein expression is detected through Western blot, and it is proved that overexpression cells are successfully constructed. Meanwhile, experiments prove that under the normal culture condition, LAPTM5 overexpression has no obvious influence on the processes of cell proliferation, apoptosis and the like. The Huh7-LAPTM5 overexpression cell line constructed by the invention plays a biological role by promoting a cell autophagy process, and the cell line is suitable for basic clinical cross correlation researches based on autophagy, drug resistance and the like.

The invention relates to constitutively active mutants of the transcription factor TFEB, which can mutate the lysine of one or both sites of positions 219 and 347; and / or also mutate the glutamic acid of one or both sites of positions 221 and 349, in order to eliminate the SUMOylation of the protein. By replacing these residues either from positions 219 and / or 221 and / or 347 and / or 349 by any other amino acid (such as arginine or alanine), it gives rise to a mutated TFEB, which more actively induces the expression of genes and protein synthesis of the lysosomal and autophagic pathway. Such as lysosomal storage disorders, neurodegenerative diseases, liver diseases, muscle diseases and metabolic diseases, and / or disorders or processes in the aging of the skin.

The present application provides an anti-CD38 CAR molecule for shRNA targeted inhibition of CD38, including an anti-CD38 CAR molecule for shRNA targeted inhibition of CD38, characterized by comprising U6 promoter, shRNA targeted inhibition of CD38, EF1 alpha promoter, upstream signal peptide and myc tag for detection in series; CD38 CAR antigen binding region CD38 scfv; CD8 hinge-transmembrane domain; CD28 costimulatory domain and CD3 zeta intracellular signaling domain, CD38 ScFv, CD8 hinge region and transmembrane region, CD28 intracellular region and CD3 zeta intracellular region are connected in series, the shRNA sequence targeted to inhibit CD38 is SEQ ID NO. 1: CCGGCTGAGGATTCATCTTGCACATCTCGAGATGTGCAAGATGAATCCTCAGTTTTTG. The present application successfully constructs an anti-CD38 CAR-T cell for shRNA targeted inhibition of CD38 through the popular shRNA technology of gene research, provides a new method for anti-CD38 CAR-T cell to get out of the "CAR-T cell-autophagy and self-stimulation" cycle, and helps to further enhance the expansion, persistence and function of anti-CD38 CAR-T cell in subsequent research.

The invention relates to an application of a dasatinib and quercetin pharmaceutical composition in preparation of a medicine for improving the outcome of elderly adverse pregnancy, belongs to the technical field of biological medicines, and particularly discloses an application of the dasatinib and quercetin pharmaceutical composition. The technical problem of placenta dysfunction caused by elderly pregnancy is solved. The dasatinib and the quercetin form the pharmaceutical composition, so that the autophagy activity of trophoblasts is promoted, DNA (deoxyribonucleic acid) damaged cells are eliminated, the adverse pregnancy outcome caused by the elderly is remarkably improved, the embryo absorption rate is reduced by about 10%, and the weight of a fetus is increased by about 20mg. The invention provides a new targeted intervention strategy for the outcome of elderly adverse pregnancy.

The application discloses a kind of cell autophagy immunofluorescence image analysis system and method based on deep learning, including cell segmentation module, GFP-LC3 positive bright spot segmentation module, quantitative analysis module.Cell segmentation module carries out segmentation to the cell region in cell autophagy immunofluorescence image;GFP-LC3 positive bright spot segmentation module carries out segmentation to GFP-LC3 positive bright spot in cell autophagy immunofluorescence image;Quantitative analysis module carries out the statistics and calculation of quantity, area and fluorescence intensity to cell region and GFP-LC3 positive bright spot region in cell autophagy immunofluorescence image respectively, and judges whether cell occurs autophagy.The application is simple to operate, and has accurate deep learning algorithm and quantitative analysis function.

The present application is used in the field of food and discloses a method for evaluating the degree of influence of trace components in wine on the level of cellular autophagy, comprising the following steps: Step 1, preparing a single cell suspension of human hepatocytes (LO2) stably expressing GFP-RFP-LC3 protein; Step 2, adding 1.5×10 4 The LO2 cells with a cell / mL were inoculated into a 6-well plate and covered with a glass for 24 hours until they adhered to the wall; Step three, 2 mL of wine containing 80 μL of pure alcohol or wine samples containing different trace components of wine were added to the cells and cultured at 37°C and 5% CO2 for 24 hours. Step four, fix in 4% paraformaldehyde for 15 minutes. Step five, wash the slides with PBS and dry them, then add an anti-fading agent containing DAPI, and place the side covered with cells on the anti-fading agent. Step six, observe the red and green fluorescence using a laser confocal microscope, and judge the effect of the trace components of the wine on the level of cellular autophagy based on the different fluorescence. The present application can quickly evaluate the degree of influence of the trace components in the wine on the level of cellular autophagy by observing the different fluorescence as mentioned above.

The invention relates to the new technical field of crop breeding, in particular to a method for creating wheat drought-resistant germplasm by means of cell autophagy, the inventor creates the wheat drought-resistant germplasm by means of the cell autophagy detection technology for wheat tissue cells, meanwhile, a traditional wheat breeding method is innovated, a greenhouse generation adding technology is applied to an F0 generation and an F2 generation, and the wheat drought-resistant germplasm is created. Wheat can be harvested three times a year; the F1 generation adopts an anther culture technology, and a homozygous material can be obtained in one year; the breeding period is shortened by 3-5 years through the technology, and compared with a traditional breeding method, the method has the advantages of being rapid and accurate.

The invention belongs to the technical field of biology, discloses a composition for promoting cell autophagy and application, particularly relates to application of a composition comprising ergothioneine and an M6P composite solution to preparation of a cell autophagy composition, and provides a composition capable of synergistically promoting cell autophagy. According to the composition, cell autophagy is synergistically promoted by inhibiting expression of p62 protein and promoting expression of LC3II protein in a specific proportion, so that cells are accelerated to remove metabolic disorder substances and deposited pigments in a manner of forming autophagosomes.

This application relates to the technical field of biological products, and provides an application, extraction method and composition of TGL-ELNs in the treatment of glioma. The TGL-ELNs are applied in any one or more of the following aspects: a) Preparation of products for promoting apoptosis of glioma cells; b) Preparation of products for inhibiting proliferation of glioma cells; c) Preparation of products for inhibiting autophagy of glioma cells; d) Preparation of products for treating glioma. Verified through cell and animal experiments, the TGL-ELNs in this application can effectively induce apoptosis of glioma cells and inhibit autophagy of glioma cells to induce glioma cell death, and act on glioma cells through the AKT / mTOR signaling pathway and by inhibiting the production of autophagosomes in glioma cells.

The present invention provides a low-molecular-weight human epidermal cell autophagy regulatory peptide DKX-9 and its applications. According to the general cell autophagy regulation mechanism and its theory, a small-molecule synthetic peptide is newly designed and synthesized, which can regulate the autophagy activity and effect improvement of human epidermal cells. The low-molecular-weight human epidermal cell autophagy regulatory peptide DKX-9 of the present invention adopts a peptide sequence composed of 9 amino acids of five types of amino acids (threonine, proline, tyrosine, asparagine, and arginine), and its amino acid composition and sequence are SEQ ID No.1: TPYNRRRRY-NH2. After applying it to human immortalized epidermal cells (HaCat), it is confirmed that it can up-regulate the expression levels of positive autophagy-related proteins Beclin-1, LC3-II, LAMP1, and TFEB, and can down-regulate the expression level of the negative autophagy-related protein p62. The autophagy regulatory peptide DKX-9 of the present invention has positive significance and medical value for future intervention in skin aging and prevention and treatment of certain skin diseases, and plays an important role in promoting the research and application of synthetic peptides in related disciplines such as cell autophagy in the future.

The invention discloses application of MYSM1 regulation and control of ITPR1 mediated cell autophagy in inhibition of cervical cancer, and belongs to the technical field of biomedicine.The MYSM1 gene and / or expression or activity of encoded protein of the MYSM1 gene are / is up-regulated, and an MYSM1-ITPR1-autophagy signal channel is activated, so that proliferation, migration, invasion or epithelial-mesenchymal transition of cervical cancer cells is inhibited, and cervical cancer is inhibited. And / or promoting apoptosis of cervical cancer cells; wherein the MYSM1 activates the expression of ITPR1 through the activity of a deubiquitination enzyme which is subjected to single ubiquitination modification on the 119th lysine of histone H2A of the MYSM1, and the ITPR1 serves as an endoplasmic reticulum calcium ion channel to mediate calcium ion release so as to trigger cell autophagy. Based on the mechanism, the invention provides a new application of MYSM1 / ITPR1 in preparation of anti-cervical cancer drugs, a drug composition targeting the pathway, a candidate drug screening method and a kit for diagnosis and prognosis. The invention aims to solve the problem that a technical scheme for effectively inhibiting the malignant progression of cervical cancer by targeting an MYSM1-ITPR1 pathway is lacked in the prior art.

The invention relates to the technical field of medicine application, in particular to application of ginsenoside Rg1 in preparation of a medicine for improving cisplatin-induced renal injury. The invention discloses application of ginsenoside Rg1 in preparation of a medicine for improving cisplatin-induced renal injury. It is proved for the first time that ginsenoside Rg1 has prevention and protection effects on cisplatin-induced acute kidney injury; it is proved that the ginsenoside Rg1 is related to cell autophagy in relieving the cisplatin-induced acute kidney injury; the JAK2-STAT3 pathway is proposed to be possibly an action pathway of the ginsenoside Rg1 for relieving the acute kidney injury induced by the cis-platinum; the LCP1 is proposed to be possibly an action target of the ginsenoside Rg1 for relieving the cisplatin-induced acute kidney injury.

The invention discloses a novel application of Etravirine in the prevention or treatment of infection of Listeria monocytogenes (Listeria monocytogenes), and particularly discloses a novel application of Etravirine in the prevention or treatment of infection of Listeria monocytogenes (Listeria monocytogenes). Through allosteric inhibition of PlcA protein activity and enhancement of cell autophagy flux and bacterial ubiquitination labeling by etravirine, the bacterial clearance rate in an infection model is significantly improved, no direct inhibition effect on bacterial growth exists, and the risk of drug resistance generation is reduced. It is further proved that etravirine has a good treatment effect on listeria infection by establishing a mouse acute infection model. Therefore, as a virulence factor PlcA inhibitor, etravirine can obviously reduce the pathogenicity of Listeria monocytogenes, and has important significance for developing a novel administration scheme for resisting Listeria monocytogenes infection.

The invention relates to application of autophagy in preparation of drugs or health food for improving fluorine-induced neurotoxicity from grape seed procyanidine. Rat and SH-SY5Y cell experiments are carried out, and the rat experiments prove that after intervention of different doses of GSPE, the SOD activity and the GSH content are improved, the MDA level is reduced, the antioxidant capacity of rats is recovered, autophagy is promoted, the filial generation learning and memory retention capacity is remarkably recovered, the autonomous activity capacity is recovered, anxiety behaviors are reduced, the occurrence and development processes of dental fluorosis are slowed down, and the occurrence and development of dental fluorosis are promoted. The change trends of different doses of GSPE present dose dependence, and the protection effect of a high-dose combined intervention group is most significant; in an SH-SY5Y cell experiment, the activity of the cells is improved through GSPE pretreatment, the expression quantity of cleave-caspase3 and cleaved-PARP is remarkably reduced, the autophagy process of the SH-SY5Y cells is promoted, and then the neurotoxicity caused by NaF is relieved. NaF is used as a representative, the prevention and treatment effects of GSPE on the fluorine-induced neurotoxicity are researched, and it is proved that GSPE can inhibit the NaF-induced neurotoxicity, so that the application of autophagy in preparation of drugs or health food for improving the fluorine-induced neurotoxicity from grape seed procyanidine is provided.

The application provides a membrane protein targeting degradation agent based on cell autophagy, the degradation agent has a first structure combined with a membrane protein, and also has a second structure inducing cell autophagy characteristics, and the first structure and the second structure are connected. The membrane protein targeting degradation agent based on cell autophagy first utilizes the cell autophagy mechanism to degrade the membrane protein, and due to the fact that the autophagy is an inherent mechanism in various cells, the autophagy can be induced in various cells, and is not dependent on factors such as lysosome transport proteins and E3 ligases on the cell membrane, so that the application has the characteristics of stronger spectrum and universality; and the design route that the first structure and the second structure are directly connected is simple and easy to realize.

The invention provides a micromolecular bifunctional chimera compound specifically binding to tau protein aggregate, the compound has a structure as shown in formula (I): A-linker-B (I), A is a depolymerization group specifically binding to pathological tau protein aggregate and promoting depolymerization of the tau protein aggregate, and B is a difunctional chimera group specifically binding to the tau protein aggregate and promoting depolymerization of the tau protein aggregate. B is a clearing group which is used for recruiting p62, LC3B or ubiquitin linker assemblies MDM2, cIAP, VHL and CRBN required by formation of cell autophagosome so as to promote tau protein aggregate to be cleared through cell autophagy or through a ubiquitin-proteasome pathway, and the linker is a linking group for connecting the group A and the group B. The compound can inhibit formation of tau protein aggregates and promote removal of pathological tau protein aggregates at the same time, and can be applied to prevention and treatment of AD, FTD and other diseases with abnormal aggregation of tau proteins.

The invention belongs to the technical field of biological medicines, and particularly relates to application of aescin in preparation of a product for inducing autophagy of skin cells. According to the application disclosed by the invention, research finds that aescin can induce autophagy of skin keratinocytes for the first time, and the expression level of autophagy-related proteins LC3-I and LC3-II in the skin keratinocytes can be remarkably improved; in addition, aescin and ursolic acid have a synergistic effect in the aspect of inducing skin keratinocyte autophagy, and are safe and non-irritant to skin. Therefore, the aescin and the composition of the aescin and the ursolic acid can be used for preparing products for inducing autophagy of skin cells so as to resist aging, remove freckles, whiten skin, control oil and strengthen a skin cuticle barrier, and products for slowing down a scleroderma process / relieving a scleroderma symptom, slowing down an atopic dermatitis process / relieving an atopic dermatitis symptom and relieving acne. The traditional Chinese medicine composition has the advantages of remarkable curative effect and high safety.

The invention discloses a zebrafish cell autophagy rapid detection kit. The kit comprises a rapid RNA extraction column, and a matched lysis solution, a washing solution, an eluent, DNase I, a reverse transcription premix solution, a qPCR premix solution, and a dry powder or premix solution of a specific primer. The invention also discloses an application of the kit. The invention also discloses a method for screening compounds or substances for regulating and controlling zebrafish cell autophagy by using the kit. According to the invention, brand new high-specificity and high-efficiency primers are adopted, so that false positive and background noise are remarkably reduced, and detection data of expression quantities of LC3B and p62 genes are more real and reliable; the optimized integration process greatly shortens the detection time; the premixed reagents and the standardized operation process ensure good reproducibility of experimental results of different batches and different operators.

The invention discloses application of an inhibitor acting on NOS1 related ceRNA in relieving sheep endometritis caused by LPS and promoting embryo implantation, and relates to the field of bioengineering. The inhibitor is si-NOS1 (SEQ ID No.1) and / or si-TCONS00000014 (SEQ ID No.2), and by regulating and controlling a NOS1 / bta-miR-370 / TCONS00000014 signal axis, the endometrial oxidative stress excessive activation induced by LPS (lipopolysaccharide) is improved, the autophagy and apoptosis of cells are relieved, and the expression of a key implantation gene is recovered. Experiments prove that the inhibitor can significantly improve the sheep embryo implantation rate and reduce the embryo loss probability, provides a new target and strategy for preventing and treating LPS-induced sheep endometritis and embryo implantation disorder, and has important significance for improving the sheep breeding efficiency.

The invention relates to the technical field of medicinal and edible compositions, in particular to a composition for relieving ovarian function decline based on cell autophagy and DNA methylation level. The composition for relieving ovarian function decline comprises 10-50 parts of collagen tripeptide, 1-5 parts of gamma-aminobutyric acid, 1-6 parts of a red grape yeast compound, 0.5-2 parts of a yeast extract, 1-6 parts of a sophora flower extract, 0.5-2 parts of golden camellia, 0.5-6 parts of a turmeric extract, 0.1-2.7 parts of blueberry anthocyanin, 1-8 parts of ginseng, 1-6 parts of an angelica sinensis extract, 1-6 parts of a poria cocos extract and 0.1-0.3 part of sodium hyaluronate. According to the composition disclosed by the invention, medicinal and edible substances are taken as main raw materials, and the raw material components are regulated and controlled, so that the composition can improve ovarian granular cell excessive autophagy, lower the methylation level and reduce ovarian granular cell damage on the basis of activating a PI3K / Akt / mTOR pathway, thereby relieving ovarian function decline.

The invention belongs to the technical field of biology, and particularly relates to a method for identifying cold resistance of wheat in a seedling stage by utilizing autophagy protein ATG8. The method comprises the following steps: constructing a vector of EGFP (enhanced green fluorescent protein)-ATG8, carrying out transient expression on leaves of different wheat varieties, and observing subcellular localization change of the EGFP-ATG8 when the EGFP-ATG8 is subjected to cold stress, so as to identify the cold resistance of the wheat; compared with an existing scheme, subcellular localization of EGFP-ATG8 can be observed only under the low-temperature stress condition of 4 DEG C, the cold resistance of EGFP-ATG8 can be known, and the method has the advantages of being low in cost, easy to operate and high in precision.

The invention relates to a method for improving soybean alkali stress resistance based on an autophagy key gene and application of the method, and belongs to the technical field of plant genetic engineering and crop genetic breeding. An autophagy related gene GmATG8c is overexpressed in the soybean and is combined with specific mononucleotide mutation located on a 20th chromosome, so that the alkali resistance of the soybean is synergistically enhanced. Experiments prove that the germination rate, the plant survival rate and the biomass of a transgenic soybean strain (NK-Al) simultaneously carrying GmATG8c gene overexpression and mononucleotide mutation under an alkali stress condition are obviously superior to those of a wild type strain, a strain independently carrying GmATG8c overexpression and a strain independently carrying the mutation. The invention discloses a new mechanism for synergistically regulating and controlling the alkali resistance of the plant by a cell autophagy pathway and a specific transcription factor, and provides a new gene resource and a technical strategy for cultivating alkali-resistant soybeans and other new important crop varieties.

The invention belongs to the technical field of biological medicines, and particularly relates to application of leflunomide in preparation of a medicine for treating Tau protein related neurodegenerative diseases. The medicine can be used for improving the athletic ability of a patient suffering from Tau protein related neurodegenerative diseases, the service life of the patient and the degenerative physiological lesion of brain neurons of the patient, can be used for reducing the accumulation level of Tau protein, can be used for promoting the autophagy clearance pathway of Tau protein, and can be used for inhibiting the activity of key kinase S6K. According to the application disclosed by the invention, the motor ability, the service life and the neuronal degeneration condition of the leflunomide for improving a Tau (R406W) fruit fly model are evaluated, the reduction of the accumulation level of molecular-level Tau protein and the promotion of a cell autophagy process are further evaluated, the potential value of the leflunomide for relieving Tau protein related neurodegenerative diseases is found, and a new application of the leflunomide is provided.

The invention relates to the field of biosensing, in particular to a genetic coding fluorescent probe for detecting lactic acid change in autophagosome and application of the genetic coding fluorescent probe. The invention discloses a genetic coding fluorescent probe for detecting lactic acid change in an autophagy body, which comprises an FRET pair, a lactic acid sensing structural domain and an autophagy body targeting structural domain and is used for specifically detecting the lactic acid concentration change in the autophagy body in real time, when the lactic acid concentration in the autophagy body changes, the conformation of the probe changes, and the change of the lactic acid concentration in the autophagy body changes. As a result, the fluorescence resonance energy transfer efficiency changes, and dynamic, non-invasive and high-temporal-spatial-resolution detection of the concentration of the lactic acid in the autophagy body can be realized by monitoring the change of the FRET ratio.

The application discloses a kind of cotton callus autophagy activity visual detection technology, first using pretreatment buffer to incubate callus, then using PBS buffer transition, using MDC dyeing liquid is dyed, prepare cell suspension, observation.The application increases the level of cell autophagy by pretreatment induction, significantly improves the fluorescence staining intensity, improves the contrast of specific dyed autophagosome and background, so that autophagy in cell is more easily observed;Meanwhile, the pretreatment buffer has the effect of maintaining osmotic pressure, keeping liquid environment pH stable and providing basic nutrition, which can significantly improve the stability of staining.The application uses PBS buffer to wash, which can avoid over-staining and reduce the degree of background clutter.The staining step of the application is more simple, with clear staining levels and clear cell contrast, so that the autophagy phenomenon in plant somatic embryogenesis process is efficiently visualized.

The invention discloses an application of benzothiazide in preparation of a medicine for preventing or treating Alzheimer's disease. Specifically, the benzene thiazide can reduce the paralysis rate of an Alzheimer's disease caenorhabditis elegans model, reduce beta amyloid protein aggregation, improve immune response and promote cell autophagy. The invention provides a new treatment scheme for treating the Alzheimer's disease.