115 results about "Tau protein" patented technology

Disclosed are protein-like polymers and uses thereof. The protein-like polymers generally comprise a polymer of formula (FX1). The polymer of formula (FX1) in some aspects comprises a peptide that (i) inhibits aggregation of, (ii) accelerates aggregation of, (iii) binds to, and / or (iv) mimics: (a) at least a portion of Tau protein, and / or (b) at least a portion of microtubulin protein.

The invention belongs to the technical field of biological medicine, and particularly relates to an extracellular vesicle drug delivery system, a preparation method thereof and application of the extracellular vesicle drug delivery system in treatment of Alzheimer's disease. According to the invention, one or more of stilbene glucoside, emodin, kaempferol, resveratrol and quercetin are used for regulating and controlling the expression of miRNA (micro Ribonucleic Acid) related to the disease progress in the extracellular vesicles, and the result shows that one or more of miR-let-7c-5p, miR-486-5p, miR-132-3p, miR-160b and miR-129-5p is remarkably up-regulated, and one or more of miR-342-3p, miR-16-5p and miR-125b-5p is remarkably down-regulated. The regulated extracellular vesicles can be used for treating Alzheimer's disease, relieving Tau protein abnormal phosphorylation, reducing amyloid protein beta deposition, inhibiting microglial cell activation, protecting neuronal cells and relieving memory deficits.

The invention discloses application of ginsenoside Rg5 in preparation of a medicine for treating Alzheimer's disease and an evaluation method, and relates to application of ginsenoside Rg5 in preparation of a medicine for treating Alzheimer's disease. The medicine improves A beta deposition, tau protein phosphorylation and neuron damage by adjusting the intestinal flora structure and metabolite level, and is used for relieving the pathological process of the Alzheimer's disease. The invention has the characteristics of multi-target effect, nerve protection, inflammation resistance and oxidation resistance.

This invention belongs to the field of biosensing and detection technology, specifically disclosing a Tau protein electrochemiluminescent aptamer sensor, its preparation method, and its application. The sensor uses a CsPbBr₃@PVP / Au composite material as the electrochemiluminescent substrate. A Tau protein-specific aptamer is immobilized on the substrate surface via Au-S bonds, and non-specific adsorption sites are blocked with 6-mercapto-1-hexanol. The CsPbBr₃@PVP / Au composite material is prepared by encapsulating CsPbBr₃ with PVP and then combining it with Au NPs. This invention utilizes the coordination passivation effect of PVP and CsPbBr₃ to significantly improve the aqueous stability and electrochemiluminescence efficiency of perovskite nanocrystals. Combined with the anchoring effect of AuNPs and the specific recognition effect of aptamers, it achieves ultrasensitive detection of Tau protein with a detection limit as low as 0.80 fg / mL. Furthermore, it exhibits excellent selectivity, stability, and detection accuracy in complex biological samples such as cerebrospinal fluid, providing a novel and efficient detection platform for the early diagnosis of Alzheimer's disease and showing promising clinical application prospects.

The present invention provides a compound having O-GlcNAcase inhibitory activity and capable of reducing tau protein phosphorylation in vivo, and a pharmaceutical composition comprising the compound for treating or preventing diseases caused by tau protein hyperphosphorylation.

This method for producing a brain organoid including aggregated tau protein comprises: a step (a) for culturing pluripotent stem cells in the presence of SMAD inhibitor to form embryoid bodies; a step (b) for embedding the embryoid bodies in an extracellular matrix and three-dimensionally culturing the embryoid bodies in the presence of SMAD inhibitor and GSK3β inhibitor to form an organoid that includes neural precursor cells; a step (c) for removing the organoid from the extracellular matrix and suspension-culturing the organoid in the presence of LIF to form a brain organoid; a step (d) for forcing the brain organoid to express a modified MAPT gene; and a step (e) for further suspension-culturing the brain organoid after step (d) to obtain a brain organoid having an aggregated tau protein.

This invention discloses a polypeptide that inhibits the desimilarization activity of tau protein and its applications, belonging to the field of biomedical technology. The polypeptide of this invention is tau. 438 The peptide is obtained through endogenous tau protein synthesis. The peptide provided by this invention can inhibit tau protein desimulation and increase tau mimicry, exhibiting high specificity and safely and effectively improving cognitive and memory function in AD model mice.

Compounds comprising an amide-linked coumarin scaffold, compositions comprising same, and method of using such compounds and compositions to inhibit tubulin-associated unit (tau) protein aggregation or alpha-synuclein ( α-syn) protein aggregation in a subject having, or at risk for, tau protein aggregation or α-syn protein aggregation, respectively.

The invention relates to methods and materials for use in treating neurodegenerative diseases associated with pathological protein aggregates and provides fusion proteins comprising: (i) a first portion comprising a sequence of a protein which aggregates pathologically in neurodegenerative disease, such as tau protein, and (ii) a second portion comprising a RING-type E3 ubiquitin ligase, a component of a RING-type E3 ubiquitin ligase complex, or a domain of either. These fusion proteins have utility in selectively or preferentially targeting pathogenic protein aggregates for degradation.

Methods of differentiating and quantifying modifications in the tau protein in bio-fluids to detect, classify, and treat a plurality of tauopathies are disclosed. The disclosed methods include liquid chromatographic mass spectrometric analyses on isolated tau protein fragments to identify and quantify deamidated or isomerized asparagines or aspartic acids indicative of a neuropathology associated with a tauopathy.

This invention belongs to the field of biochemistry technology, and relates to a near-infrared chemiluminescent probe responsive to tau protein, its preparation method, and its application. The preparation method of the near-infrared chemiluminescent probe includes the following steps: adding compound (I), compound (II), a catalyst, and an alkaline additive to a first solvent for reaction to obtain compound (III); adding compound (III), compound (IV), and piperidine to a second solvent for reaction to obtain compound (V); adding compound (V) and trifluoroacetic acid to a third solvent for reaction to obtain compound (VI); and adding compound (VI), compound (VII), and an acid compound to a fourth solvent for reaction to obtain the near-infrared chemiluminescent probe. The chemiluminescent probe of this invention exhibits high selectivity and efficient chemiluminescence capability, providing a promising tool for the diagnosis of Alzheimer's disease (AD). Its structural formula is: [Insert structural formula here].

The invention belongs to the technical field of biochemistry, and relates to a near-infrared chemiluminescence probe responding to tau protein as well as a preparation method and application of the near-infrared chemiluminescence probe. The preparation method of the near-infrared chemiluminescence probe comprises the following steps: adding a compound (I), a compound (II), a catalyst and an alkaline additive into a first solvent for reaction to obtain a compound (III); adding the compound (III), the compound (IV) and piperidine into a second solvent for reaction to obtain a compound (V); adding the compound (V) and trifluoroacetic acid into a third solvent for reaction to obtain a compound (VI); and adding the compound (VI), the compound (VII) and an acid compound into a fourth solvent for reaction to obtain the near-infrared chemiluminescence probe. The chemiluminescence probe provided by the invention has high selectivity and efficient chemiluminescence capability, and provides a potential tool for diagnosis of AD diseases. The structural formula is shown in the specification.

Disclosed are compositions and methods for treating Alzheimer's disease or for use in treating Alzheimer's disease. Also disclosed are compositions and methods for treating or for use in treating a neurodegenerative disorder characterized by the presence of tau protein aggregates. Furthermore, disclosed are compositions and methods for reducing tau protein aggregates or for use in reducing tau protein aggregates.

The present application relates to the field of biological medical technology, in particular to a traditional Chinese medicine composition as GSK-3beta inhibitor and preparation and application thereof. The traditional Chinese medicine composition as GSK-3beta inhibitor comprises gastrodin and ganoderma triterpene, and the mass ratio of gastrodin and ganoderma triterpene is (1-4):1. The traditional Chinese medicine composition provided by the present application can inhibit the overexpression of GSK-3beta in AD model, thereby inhibiting the overphosphorylation of Tau protein and playing a protective role on Alzheimer's disease. In addition, the traditional Chinese medicine composition provided by the present application contains gastrodin and ganoderma triterpene, which are homoeopathic traditional Chinese medicine efficacy components, greatly improving the safety of the drug, and providing a train of thought for the application of the traditional Chinese medicine composition as a functional food.

An optical imaging system according to an embodiment disclosed in the present document may include: a laser module configured to radiate an ultrashort pulse laser beam; a microscope module configured to transmit the radiated ultrashort pulse laser beam to an eye of a subject and detect reflected light from the eye or (auto)fluorescence in the eye using an image sensor; a control module configured to generate a tau-related image in which a modification of tau proteins is detectable from the reflected light detected through the image sensor; and an output device configured to display the tau-related image.

The invention is directed to peptide fragments of FKBP52 that inhibit Tau protein aggregation and ameliorate tauopathies like Alzheimer's Disease (AD). It also involves modifications to these peptides to improve their pharmacokinetic and pharmacodynamic properties.

The present invention provides a use of lactoferrin in combination with ergothioneine in the preparation of a drug for preventing and / or treating Alzheimer's disease. Compared with the use of lactoferrin or ergothioneine alone, in the present invention, the combined use of lactoferrin and ergothioneine at a specific ratio as an active pharmaceutical ingredient can reduce cell damage caused by Aβ25-35, reduce the expression of a p-Tau protein, lower the oxidative stress level and regulate apoptosis, alleviate memory impairment and cognitive dysfunction, and can reduce Aβ deposition in mouse plasma.

The present invention relates to the biomedical and biopharmaceutical sectors. Specifically, it relates to a chimeric antigen comprising the combination of the amino- and carboxy-terminal regions of the amyloid-beta peptide (Aβ), the amino- and carboxy-terminal regions of the tau protein, and a T-cell epitope. The pharmaceutical composition comprising this chimeric antigen and at least one pharmaceutically acceptable vaccine adjuvant increases the efficacy of immunotherapy for the prevention and treatment of Alzheimer's disease (AD). The chimeric antigen exerts its action by stimulating a multi-target humoral response with high titers of anti-Aβ and anti-tau antibodies simultaneously. This promotes the combined elimination of toxic Aβ and tau species from the brain, thereby preventing or significantly improving the clinical symptoms and neuropathology of AD.

The present invention provides small molecule drugs and pharmaceutical compositions for the treatment and prevention of diseases related to the formation of certain types of oligomers in a subject. More specifically, the drugs and compositions reduce or prevent the formation of oligomers formed from tau protein, TDP-43, Huntingtin's protein and / or alpha-synuclein. It further provides a method of reducing formation of or disrupting TDP-43, alpha-synuclein, Huntingtin's protein and / or tau protein oligomers in a subject, the method comprising the step of administering to the subject in need thereof a therapeutically effective amount of a pharmaceutical composition.

The invention discloses application of DDC silencing in an encephalatrophy model, and relates to the field of traumatic brain injury. According to the application, by inhibiting DDC gene expression or protein activity, GSK-3beta kinase mediated Tau protein phosphorylation is regulated and controlled, so that encephalatrophy is relieved or prevented; wherein the encephalatrophy model is an immature brain traumatic brain injury (TBI) after-encephalatrophy model, and DDC silencing is achieved through siRNA, shRNA or antisense oligonucleotide. A gene expression profile after immature brain TBI is analyzed through transcriptome sequencing, DDC is found to be remarkably up-regulated and enriched in a 5-hydroxytryptamine synaptic pathway, an in-vivo experiment proves that DDC expression and Tau phosphorylation level are synchronously increased, an in-vitro experiment shows that DDC silently inhibits GSK-3beta-mediated Tau phosphorylation, and a basis is provided for a DDC-targeted treatment strategy.

The invention relates to the field of instant detection of disease diagnosis, and discloses an Alzheimer's disease marker detection method based on enzymatic fluorescent silicon nanodots, which comprises the following steps: enriching a target marker by using a magnetic capture probe and forming an enzyme-labeled immune sandwich compound; adding a substrate, and performing in-situ induction by using ascorbic acid generated by enzymatic reaction to generate fluorescent silicon nanodots or inhibit chromogenic reaction; the method comprises the following steps: acquiring a time sequence image of a reaction system, eliminating interference pixels by utilizing HSV color space conversion and a chromaticity characteristic mask algorithm, calculating a reaction kinetics rate, and combining a standard curve to realize quantitative analysis. By introducing an alkaline phosphatase-induced cascade reaction system and utilizing an enzymolysis product ascorbic acid to generate fluorescent silicon nanodots in situ or regulate and control the oxidation-reduction state of TMB (Tetramethylbenzidine), high-sensitivity detection of Tau protein and Abeta-42 protein is realized, so that the detection sensitivity of low-concentration Alzheimer's disease markers is improved.

The invention is directed to peptide fragments of FKBP52 that inhibit Tau protein aggregation and ameliorate tauopathies like Alzheimer's Disease (AD). It also involves modifications to these peptides to improve their pharmacokinetic and pharmacodynamic properties.

Novel materials and methods are provided for treating neurodegenerative diseases associated with protein aggregates by selectively targeting the aggregates. The present invention relates to methods and materials for use in treating neurodegenerative diseases associated with pathological protein aggregates, and provides fusion proteins comprising (i) a first portion comprising the sequence of a protein that pathologically aggregates in neurodegenerative diseases, such as tau protein, and (ii) a second portion comprising a RING-type E3 ubiquitin ligase, a component of a RING-type E3 ubiquitin ligase complex, or a domain of either. These fusion proteins are useful for selectively or preferentially targeting pathogenic protein aggregates for degradation.

The present invention relates to a novel heteroaryl-carbohydrazone acyldinitrile compound in which a saturated heterocyclic ring is substituted or a pharmaceutically acceptable salt thereof, a method for preparing the same, and a pharmaceutical composition for preventing or treating nervous system diseases comprising the same as an active ingredient. The heteroaryl-carbohydrazone acyldinitrile compound with a substituted saturated heterocyclic ring according to the present invention can effectively inhibit the aggregation or excessive phosphorylation of Tau protein and / or TDP-43, thereby being useful in the prevention or treatment of nervous system diseases including Tau disease and TDP-43 proteopathy.

A method for early diagnosis or stage classification of Alzheimer's disease includes obtaining a tau protein-derived phosphorylated peptide from an isolated biological sample and quantifying the tau protein-derived phosphorylated peptide. Through the quantification of tau protein-derived phosphorylated peptides, it is possible to effectively diagnose Alzheimer's disease at an early stage or classify its stages, and determine the accumulation of amyloid beta in the brain.

The invention provides application of zeaxanthine in preparation of a product for preventing and / or treating tauopathy, and relates to the field of biological medicine. It is found that zeaxanthine can inhibit expression and abnormal phosphorylation of tau protein and has the effects of prolonging the service life and improving the exercise ability, and a new way is provided for preventing and / or treating tauopathy.

Disclosed are a composition and method for inhibiting tau protein accumulation, aggregation, or tangle, the composition containing neurons or glia having Nurr1 and / or Foxa2 genes introduced thereinto, wherein the composition and method can be utilized in the prevention or treatment of a cerebral nervous disease caused by tau protein accumulation, aggregation, or tangle formation.

A double-stranded RNA disclosed herein has a first strand and a second strand complementary to the first strand. The first strand includes a portion of the base sequence encoding tau protein, and includes the following main sequences: GUGGCAGUGGUCCGUACUCCA (SEQ ID NO. 1); GGCAGUGGUCCGUACUCCA (SEQ ID NO. 2); CCCAUGCCAGACCUGAAGA (SEQ ID NO. 3); CCAUGCCAGACCUGAAGAA (SEQ ID NO. 4); CAUGCCAGACCUGAAGAAU (SEQ ID NO. 5); CCAGACCUGAAGAAUGUCA (SEQ ID NO. 6); CAGACCUGAAGAAUGUCAA (SEQ ID NO. 7); and GACCUGAAGAAUGUCAAGU (SEQ ID NO. 8).

The invention relates to a Tau protein lactylated antibody and application thereof.When the Tau protein lactylated antibody is prepared, modified lysine K385 site modified polypeptide is adopted, the specific sequence of the Tau protein lactylated antibody is RENAKAK (lac) TDHGAEC, and the application of the Tau protein lactylated antibody comprises the application in detecting the K385 lactylation level of Tau protein in brain tissue and plasma; the Tau protein lactylated antibody is used for detecting Alzheimer's disease (AD) model mouse and AD patient samples, it is found that the Tau-K385 site lactylation level in AD mouse, AD patient brain tissue and AD patient plasma is remarkably increased, the Tau-K385 site lactylation specific antibody can be used for detecting the Tau-K385 site lactylation level in AD patient brain and serum, and the Tau-K385 site lactylation specific antibody can be used for detecting the Tau-K385 site lactylation level in AD patient brain and serum. The method has a potential value in AD early prediction.

The present invention relates to compounds for imaging TAU protein aggregates, in particular to novel compounds of formula (II) which can be used for selective Tau detection in disorders and abnormalities associated with Tau aggregates such as Alzheimer's disease and other tauopathies by positron emission tomography (PET) imaging.