59 results about "Specific fluorescence" patented technology

The invention provides a sample pretreatment automation method for flow cytometry, and belongs to the technical field of sample pretreatment for flow cytometry. A biological sample to be detected is collected and placed in a collection tube containing an EDTA-K2 anticoagulant for pretreatment; an automatic pipetting system is used for carrying out incubation reaction on an anticoagulant whole blood sample and an intelligent matching fluorescence labeling antibody mixed solution, and a double-layer game optimization verification system is used for verifying the rationality of an antibody adding proportion and reaction condition parameters; carrying out fluorescence characteristic readability index prediction on the incubated cell suspension by adopting an intelligent dilution parameter regulator model, dynamically adjusting hemolysis parameters and suspension conditions, and adding 1 * hemolysin working solution by using an automatic liquid adding device to carry out hemolysis treatment so as to finish pretreatment; the technical problems that in the pretreatment process of flow cytometry detection samples, parameters are often based on artificial experience, and the reproducibility and standardization degree of detection results are insufficient are solved.

The invention discloses a staphylococcus aureus biosensor based on a nucleic acid aptamer and a preparation method of the staphylococcus aureus biosensor. Three fluorine atoms (F) are introduced into the 5'end, the 3 'end and the middle position of an aptamer 2' F3-(5 '3'm DNA) sequence (SEQ ID NO: 1) for modification, so that the binding force of the aptamer and graphene is remarkably enhanced, the signal stability and the anti-interference capability of the biosensor are remarkably improved, non-specific fluorescence leakage can be effectively blocked, and reliable guarantee is provided for complex sample detection. According to the present invention, with the cooperation of the graphene oxide quenching substrate, the high-sensitivity detection of the staphylococcus aureus is achieved, the detection limit of the sensor within 5 min can achieve 5 cells / mL, the sensitivity is high, the specificity on the complex sample is more than 95.4%, and the sensor is suitable for the food safety rapid screening and the clinical diagnosis.

The invention discloses a confocal laser microscope detection method for micro-plastic surface biofilm components and biomass, and belongs to the field of micro-plastic pollution monitoring. The method comprises the following steps: carrying out stratified sampling and polymer component identification on micro-plastic in an environmental water body; the method comprises the following steps: marking algae, blue-green algae, bacteria and extracellular polymeric substances in a biological membrane through specific fluorescent staining, carrying out high-resolution three-dimensional imaging by utilizing a confocal laser microscope, and realizing batch quantitative analysis of each component of the biological membrane by adopting ImageJ software. The technical problems that an existing detection method is insufficient in parameter dimension, evaluation result deviation is caused only based on partial component quantification, and the influence of the overall structure of the biological membrane on the micro-plastic migration behavior cannot be truly reflected are solved. According to the method, the biomass and spatial distribution of each component of the biological membrane can be comprehensively and accurately quantified, the accuracy of analyzing the vertical migration mechanism of the micro-plastic is improved, and multi-dimensional data support is provided for ecological risk assessment.

The application discloses a kind of biological sensor of nucleic acid aptamer-based paratyphoid A salmonella and preparation method thereof, it is introduced 3 fluorine atoms (F) modification in the 5' end, 3' end and intermediate position of aptamer 2'F3-(5'3'mDNA) sequence (SEQ ID NO:1), significantly enhance the binding force of aptamer and graphene, significantly improve the signal stability and anti-interference ability of biosensor, and can effectively block non-specific fluorescence leakage, provide reliability guarantee for complex sample detection.The application is matched with graphene oxide quenching substrate, realizes the high sensitivity detection of paratyphoid A salmonella, the detection limit of the sensor reaches 10 cells / mL within 5 min, the specificity to complex sample is >93.4%, and it is suitable for food safety rapid screening and clinical diagnosis.

To provide a detection reagent hardly causing noise due to generation of nonspecific fluorescence, and capable of detecting sialidase with higher accuracy.SOLUTION: The present invention relates to a compound represented by formula (I) or a salt thereof, or a solvate thereof. In the formula (I), R1 represents a halogen atom, and R2 represents an alkyl group having 5 to 11 carbon atoms or a hydrocarbyl group having 5 to 11 carbon atoms and having one or more unsaturated bonds. ] SELECTED DRAWING: None

The invention relates to a labeling technique formed by using molecular organic crystals having non-reproducible random position, shape, color and orientation, as well as specific fluorescence emission and physicochemical properties.

The invention discloses a preparation method and application of aerogel for detecting and adsorbing aluminum ions, and belongs to the technical field of sewage treatment. According to the method, a halloysite nanotube is taken as a matrix, and the HNT-KC probe with specific fluorescence response to aluminum ions is synthesized through silanization, acylating chlorination and gradual reaction with a coumarin derivative and furohydrazide; meanwhile, preparing aldehyde-terminated polyethylene glycol as a cross-linking agent; finally, the probe, a chitosan solution and an aldehyde-terminated polyethylene glycol solution are subjected to co-gelation through a Schiff base reaction, and the composite aerogel is prepared through dehydration aging and freeze drying. The aerogel integrates fluorescence detection and adsorption removal functions, has the advantages of high specific surface area, porous structure, high sensitivity, strong selectivity and good stability, can realize rapid detection and efficient removal of aluminum ions in a water body, is green in raw materials and simple in process, and has a wide application prospect in the field of water treatment.

The invention discloses a recombinant plasmid, a recombinant strain, recombinant phycocyanin and application of the recombinant plasmid, the recombinant strain and the recombinant phycocyanin in mercury ion detection. The invention further discloses a dual-mode mercury ion biosensor based on the thermal-stability recombinant phycocyanin and a preparation method and application of the dual-mode mercury ion biosensor. The biosensor based on the recombinant phycocyanin has specific fluorescence response to trace mercury ions. The recombinant phycocyanin pigment binding rate is higher than that of all reported recombinant phycocyanin, great Stokes shift (288 nm) is shown, the mercury ion selectivity is high, the thermal stability is good, the prepared biosensor shows the characteristics of dual-mode output and ultra-sensitive sensing, the detection limit under a fluorescence-based mode is 2.94 nM, and the biosensor has good application prospects. And the detection limit is 1.87 nM in a colorimetric mode based on fluorescence. The protein-based sensor is obtained from escherichia coli, is simple and convenient, supports in-situ monitoring of a smart phone, and is low in cost, excellent in performance and free of any toxicity.

This invention discloses a Staphylococcus aureus biosensor based on a nucleic acid aptamer and its preparation method. By introducing three fluorine atoms (F) at the 5', 3', and middle positions of the aptamer's 2'F3- (5'3' mDNA) sequence (SEQ ID NO:1), the binding force between the aptamer and graphene is significantly enhanced, significantly improving the signal stability and anti-interference ability of the biosensor. Furthermore, it effectively blocks non-specific fluorescence leakage, providing reliable assurance for the detection of complex samples. This invention, combined with a graphene oxide-quenched substrate, achieves highly sensitive detection of Staphylococcus aureus. The sensor achieves a detection limit of 5 cells / mL within 5 minutes, exhibiting high sensitivity and a specificity >95.4% for complex samples, making it suitable for rapid food safety screening and clinical diagnosis.

The application belongs to the field of microbial molecule detection, and discloses a multiple qPCR kit and method for simultaneously detecting multiple listeria based on new molecular targets. The application designs corresponding primers and probes based on specific gene fragments of each listeria obtained by genomics mining, establishes a multiple qPCR method, and assembles the method into a portable kit. The multiple qPCR primer probe set of the application has high specificity, and only the six target bacteria of Listeria monocytogenes, Listeria innocua, Listeria ivanovii, Listeria welshimeri, Listeria seeligeri and Listeria grayi appear fluorescence signals in the specific fluorescence signal channel, so that the detection result is more accurate. The multiple qPCR kit of the application can complete sample detection within 14 hours, wherein the whole qPCR process only needs about 1 hour, the detection efficiency is high, the detection cost is low, and the kit is particularly suitable for large-scale sample investigation and actual detection, and the detection sensitivity can be as low as 1.0-11.1 CFU / Test.

The invention discloses a method for obtaining a single B cell and screening an antibody, and relates to the technical field of monoclonal antibody development. According to the invention, B cells are enriched through a magnetic bead anion selection method, and target B cells are screened by identifying a specific fluorescence signal mode. The method provided by the invention is helpful for improving the enrichment efficiency of the target B cells, reducing the enrichment cost, increasing the proportion of the positive cells after enrichment, also helpful for screening high-affinity antibodies, and improving the efficiency of antibody discovery.

The present application relates to a kind of zinc-based coordination polymer and film preparation method and application fluorescent detection of sparteine.Polymer is three-dimensional zinc metal organic framework material, the frame is connected by binuclear zinc and organic ligand to have one-dimensional pore, chemical formula is {NH2(CH3)2·[Zn (TDA)]·DMF·3C2H5OH} n};With fluorescence emission peak at 400nm.It is prepared by hydrothermal reaction by zinc iodide and 4,4'‑(1H‑1,2,4‑triazole‑3,5‑diyl) dibenzoic acid in DMF and ethanol mixed solvent, add acetic acid as regulator.The zinc-based coordination polymer and film prepared by the present application have specific fluorescence recognition function, can quickly and conveniently detect sparteine in water and other solutions, the detection limit is as low as 5.26×10 ‑6 M, high sensitivity and can be recycled.And preparation process is simple, application portable, not dependent on expensive equipment.

The invention discloses special paper based on a multi-layer anti-counterfeiting function and a preparation method thereof, and belongs to the technical field of paper anti-counterfeiting. The special paper sequentially comprises a base paper layer, a fluorescent color fiber coating layer, a dielectric film sizing layer and a three-dimensional anti-counterfeiting transparent dielectric layer from bottom to top. Wherein the fluorescent colored fibers are prepared by mixing colored fibers with various colors and uniformly spraying transparent fluorescent ink paint, and have two anti-counterfeiting characteristics of color matching and fluorescence. The three anti-counterfeiting technologies of refraction, fiber color matching and fluorescent color development are organically combined in the same paper area in a layering mode, the structure is unique, the anti-counterfeiting layers are rich, the counterfeiting difficulty is extremely high, meanwhile, consumers can conveniently carry out authenticity identification in multiple modes of view angle changing, fiber observing, ultraviolet lamp irradiation and the like, and the anti-counterfeiting effect is good. And the system has extremely high safety, interactivity and popularization value.

A system and method to extend a dynamic range of fluorescence measurements. The system includes a neutral density filter stack apparatus including a plurality of neutral density filters. The neutral density filter stack modulates the intensity of light from a source. This modulation improves the ability to detect emissions from a wider-range of fluorophore concentrations, specifically addressing inner-filter effects at higher concentrations that would normally require sample dilution. It can be used in a system in which absorbance and fluorescence measurements are carried out, wherein the intensity of the light source is modulated with the apparatus for the fluorescence measurements. In this hybrid system, the stack modulates the intensity of the excitation light source for fluorescence measurements to be made at very low concentrations of analyte. The hybrid system also includes optics for absorbance measurements to be made at concentrations of analyte that are higher than those detected by fluorescence.

The invention discloses a benzothiadiazole fluorescent probe as well as preparation and application thereof. According to the present invention, through the two-step Suzuki coupling reaction, the 4-pyridyl group and the N-methyl piperazine group are sequentially introduced, such that the benzothiadiazole fluorescent probe for lysosome polarity detection is simply, conveniently and efficiently synthesized; the probe disclosed by the invention has a remarkable positive solvent color effect, and the fluorescence intensity of the probe is reduced along with the increase of the polarity of a medium, so that specific fluorescence enhancement can be realized in a low-polarity lysosome microenvironment. The probe has excellent light stability and is suitable for long-time dynamic fluorescence imaging monitoring.

The invention discloses a fluorescent product for a PCB (Printed Circuit Board) and a preparation method of the fluorescent product, and relates to the technical field of PCB functional materials, and the fluorescent product is prepared from the following components in parts by weight: 5-20 parts of a carbon nano fluorescent material, 1-10 parts of a fluorescence enhancer, 70-90 parts of a conductive ink carrier and 0.1-1 part of a cross-linking agent. The preparation method comprises the following steps: synthesizing a carbon nano fluorescent material; preparing a compound of a fluorescence enhancer and a carbon nano fluorescent material; and mixing the compound with a conductive ink carrier to obtain the fluorescent product for the PCB. Compared with an organic fluorescent dye, the fluorescent stability is improved, the quenching problem is avoided, and the fluorescent dye is suitable for a high-temperature PCB environment; and compared with inorganic fluorescent powder, the fluorescent powder is small in particle size and uniform in dispersion, the conductivity is improved, the coating falling risk is reduced, and the flexible compatibility of the PCB is improved.

The application belongs to the technical field of new small-molecule drugs, and particularly relates to a zwitterionic fluorescent probe containing a dimeric targeting ligand as well as a preparation method and application thereof.The chemical structural formula of the zwitterionic fluorescent probe containing the dimeric targeting ligand is shown as formula (1): The fluorescent probe can be used for near-infrared fluorescence imaging of tumor targeting, and the two identical tumor targeting ligands contained in the structure have better targeting function compared to a single targeting ligand.The introduction of basic amino acids in the fluorescent probe makes the charge on the surface of the probe zero, and the zwitterionic design makes the probe have a lower tissue background signal.The probe structure is completely symmetrical, the synthesis method is simpler, the water solubility is good, the non-specific fluorescence signal is low, and the probe is suitable for industrialized production and clinical application.

The application discloses a kind of multi-modal probes with tracer positioning and target protein enrichment capture bifunction, and preparation method and application thereof, and relates to the field of biochemistry.The structure formula of the multi-modal probe is:the application is based on the principle of chemistry biology, and develops a kind of multi-modal probe with diketopyrrolo structure and azide substitution group simultaneously.The multi-modal probe can react with oxygen-rich olefin-substituted drug molecules to produce specific fluorescence under LED lamp irradiation.Based on azide substitution group, click reaction can occur with alkyne capture group, so the multi-modal probe simultaneously has the functions of in vivo tracer positioning and target protein enrichment capture, and can realize fluorescence labeling and drug target monitoring on protein level, living cells, tissues and in vivo small animals.

This invention relates to an aptamer of *Cronobacter sakazakii* and a method for preparing a fluorescence-quenched biosensor thereof, belonging to the field of biosensor technology. The DNA sequence of the *Cronobacter sakazakii* aptamer is shown in SEQ ID No:1. Experiments show that the cross-reactivity of this aptamer with common foodborne pathogens such as *Staphylococcus aureus* and *Listeria monocytogenes* is less than 25%. The construction process of the fluorescence-quenched biosensor based on the *Cronobacter sakazakii* aptamer includes the mixing of activating agents, the preparation of fluorescent probes and quenching probes, and the mixing of fluorescent probes and quenching probes in a volume ratio to obtain a sensitive and specific fluorescence-quenched biosensor. The fluorescence-quenched biosensor of this invention exhibits high linearity and low detection limits; simultaneously, the screening method is simple and convenient, requiring only the use of an existing Autodoc server for rapid screening.

The invention belongs to the field of chemical detection, and discloses a fluorescent probe P1, a preparation method thereof and application of the fluorescent probe P1 in spermidine and viscosity dual-function detection. The structural formula of the fluorescent probe P1 is shown in the specification. The recognition performance of the probe P1 in various common analytes in a DMF-HEPES buffer system is researched through a fluorescence spectrophotometer. Results show that the probe P1 has specific fluorescence recognition performance on spermidine, can overcome interference of other common analytes, and has a wide pH value application range. The probe has relatively good sensitivity on the recognition of spermidine, and the lowest detection limit is 0.213 mu M. In addition, the probe P1 has a good response effect on the viscosity of the solution, is not interfered by the polarity of the solution, and can realize quantitative detection of the viscosity. The results show that the probe P1 has wide application prospects in the fields of food safety, environmental detection and biology.

Provided are a fluorescent probe, a preparation method therefor and a use thereof. The fluorescent probe sensitively and specifically responds to viscosity, and can be used for the specific fluorescence labeling of proteins as well as in the quantification, detection or kinetic study of proteins and the imaging of cells, tissues and living bodies.

The invention discloses a preparation method and application of a coal-based carbon fluorescent composite material, and the preparation method is characterized by comprising the following specific steps: a mild, green and low-cost top-down strategy is invented, and coal-based carbon dots (CDs) are prepared from coal through chemical oxidation and etching, so that the post-treatment process can be accelerated, and the release of high-toxicity gas can be avoided. The reduced coal-based fluorescent carbon dots can be used as an efficient unmarked fluorescent sensing material for detecting Cu (II) ions, and the detection limit is as low as 2.0 nM, which shows that the coal-based fluorescent carbon dots have huge potential as sensors in a complex real water environment. The invention provides a way for preparing a carbon material by directional utilization of coal, and promotes the development of a low-cost sensor taking coal as a precursor. The technical scheme has the advantages of simplicity in operation, low cost, stability, good repeatability, wide application range and the like. The coal-based reduced fluorescent carbon dots have a specific fluorescence quenching effect on Cu < 2 + > for the first time, and trace detection is realized.

The invention belongs to the technical field of gas chemical sensing and fluorescence / colorimetric analysis, and particularly discloses a preparation method and application of carbon dots for detecting carbon monoxide. The preparation method of the carbon dots for detecting carbon monoxide comprises the following steps: dissolving amino acid and copper salt in water to obtain a mixed solution; placing the mixed solution in a high-pressure reactor for heating reaction to obtain a carbon dot crude product; and purifying the carbon dot crude product to obtain the carbon dot for detecting carbon monoxide. The carbon dots prepared by the method have the advantages of simplicity in preparation, abundant surface functional groups, uniform particle size distribution, good water solubility and stability and the like, and rapid fluorescence detection of CO is realized under mild conditions; and the characteristic has a specific fluorescence and colorimetric bimodal response effect on CO, and qualitative and semi-quantitative detection of CO can be realized.

Provided are a fluorescent probe, a preparation method therefor and a use thereof. The fluorescent probe responds to viscosity sensitively and specifically, can be used for the specific fluorescence labeling of proteins and can also be used in the quantification, detection or kinetic study of proteins and the imaging of cells, tissues and living bodies.

The invention discloses a preparation method and application of a fluorescent probe for detecting quintozene, and relates to the field of quality monitoring of Chinese herbal medicines, in particular to a preparation method of a triphenylamine fluorescent probe T and detection of quintozene. The defects that an existing quintozene detection method is time-consuming and high in equipment cost, needs professional operators and cannot be popularized can be overcome. The preparation method of the probe T comprises the following step: carrying out coupling reaction on 4-(diphenylamino) phenylboronic acid and 9-(2-biphenyl)-10-bromoanthracene to prepare the fluorescent probe T. The fluorescent probe T prepared by the invention can realize specific fluorescence'on-off 'detection of quintozene in a neutral environment, and the detection process is good in selectivity and high in sensitivity, and can resist interference of various factors. The fluorescent probe T can be used for detecting quintozene in Chinese herbal medicine American ginseng.

The invention provides a method for removing background fluorescence of a tissue sample, which comprises the following steps: mixing the tissue sample with a metal hydride reducing agent, and illuminating the tissue sample under white light and a light source with the wavelength of 475-485 nm. According to the method, the background fluorescence of the tissue sample can be obviously removed, the background is cleaner after the treated tissue is subjected to antibody dyeing, the strength and expression quantity of an antibody labeling signal are not influenced, the signal-to-noise ratio of a specific fluorescence labeling signal is high, the removal effect is thorough, and the background fluorescence cannot be recovered. Meanwhile, the method disclosed by the invention is low in cost and simple and convenient to operate, and has a wide application prospect in technologies such as immunofluorescence analysis and the like.

The invention relates to the technical field of fluorescence imaging, in particular to a lipid droplet specific fluorescence imaging monitoring system for myocardial targeted ferroptosis. According to the method, a lipid droplet fluorescence characteristic coefficient and a lipid droplet fluorescence key period at each moment are obtained according to fluorescence intensity changes of pixel points in pixel point class clusters at different moments where each position pixel point is located and relative distances between the different pixel point class clusters; according to the fluorescence intensity change characteristics of each wave band relative to other wave bands at different moments in the target time period, screening out a high-change-intensity time period; obtaining a lipid droplet fluorescence characteristic coefficient of each wave band according to the fluorescence intensity distribution at different moments under different wave bands in the high change intensity time period; and obtaining the fluorescent lipid droplet intensity of each position pixel point at each moment. By accurately analyzing the fluorescence characteristics of the lipid droplets of the wave band, the fluorescence data is unmixed, and the accuracy of the monitoring result is improved.

The invention discloses a CRISPR-Cas12a (clustered regularly interspaced short palindromic repeats-associated 12a)-based rapid detection method for an OsHV-1 (OsHV-1) virus The method comprises the following steps: (1) RPA amplification: amplifying a target gene segment by using the primer in claim 1 and taking DNA of oyster tissues as a template; (2) obtaining ORF38-crRNA (Ribose Nucleic Acid), wherein the ORF38-crRNA is UCCUUGCCUCCAAGGUUCUUAUUACUUAUUAGUGAGUCGUUUUA, and the ORF38-crRNA is obtained by the following steps of: (1) obtaining the ORF38-crRNA; (2) obtaining the ORF38-crRNA, and (3) detecting whether a specific fluorescence signal is generated on the target gene segment by using a CRISPR-Cas12a detection system, if the specific fluorescence signal is generated on the target gene segment, indicating that the oyster tissue contains the OsHV-1 virus, and if the specific fluorescence signal is not generated on the target gene segment, indicating that the oyster tissue does not contain the OsHV-1 virus. According to the method, the trans-cleavage activity of RPA and CRISPR-Cas12a is combined, an FAM labeled ssDNA probe signal is adopted for detection, the sensitivity is high, the specificity is high, the detection limit can reach 1 copy / mu L, and the detection time does not exceed 40 minutes. The method can be widely applied to the fields of aquaculture disease monitoring, aquatic food safety detection, environment monitoring and the like.

This invention relates to the field of in vitro diagnostic technology and provides a highly specific Mycobacterium tuberculosis antigen detection kit and detection method. The kit includes: a thermosensitive antigen aggregate composed of two or more of ESAT-6, CFP-10, and MPT-64 coupled with PNIPAM-b-PLL block copolymer, which spontaneously forms nanoscale antigen clusters at 37°C; dual-mechanism anti-fouling magnetic beads, which are Fe3O4@SiO2@PEG-polysulfobetaine three-layer core-shell structures, with a reference fluorescent dye embedded in the SiO₂ layer via covalent bonding, and the surface covalently coupled to the thermosensitive antigen aggregate via carboxyl groups; an AIE fluorescent probe, composed of AIE fluorescent microspheres coupled with an anti-tuberculosis antigen detection antibody; and a sample diluent. This invention achieves local enrichment of antigen through temperature-controlled aggregation, minimizes background through dual-mechanism anti-fouling magnetic beads (PEG steric hindrance + zwitterionic super hydration), and amplifies the signal and performs internal reference calibration through AIE ratio fluorescence. The three components work synergistically to achieve high sensitivity, low background, strong anti-interference ability, and easy operation for tuberculosis antigen detection.

The invention provides a bimodal microscopic imaging system and method, and relates to the technical field of microscopic imaging, and the system comprises a first imaging module which is configured to obtain a three-dimensional refractive index distribution image of a sample based on an optical diffraction tomography principle; the second imaging module is configured to acquire a fluorescence image of the sample based on a confocal microscopic imaging principle; the control module comprises a time sequence control unit and an image fusion unit; the time sequence control unit is configured to control the data acquisition time sequence of the first imaging module and the second imaging module; the image fusion unit is configured to process the three-dimensional refractive index distribution image and the fluorescence image to generate a fused image. According to the invention, unmarked three-dimensional form imaging and specific fluorescence imaging of living cells are realized, distribution of organelles in the three-dimensional form of the cells can be accurately positioned through bimodal data fusion, and linkage analysis of cell functions and forms is carried out.