High-efficiency rapid bladder cancer urinalysis kit and urinary cell active preservative fluid
A technology for urine cells and preservation solution, applied in the field of biomedicine, can solve the problem of inability to accurately quantitatively detect substrates and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Embodiment 1. Preparation of urine cell activity preservation solution and application test
[0057] Step 1: Preparing the preservation solution, according to the ingredients listed in Table 1, the solvent is double distilled water, pH7.2-7.4.
[0058] The obtained preservation solution is named: Cellock solution.
[0059] Table 1
[0060] Element
Proportion
source of ingredients
0.08ng / mL
Commercially available, Sigma / E9644
BSA Albumin
0.5% (w / w)
commercially available
3% (w / w)
commercially available
Dulbecco's Phosphate
salt buffer
(DPBS)
0.18mg / mL
Commercially available from Sigma, pH 7.2-7.4, including potassium dihydrogen phosphate
(KH2PO4), 1.47mM and Disodium Hydrogen Phosphate Sodium
Phosphate dibasic (Na2HPO4-7H2O),
8.06mM, Calciu...
Embodiment 2
[0068] Embodiment 2 assembles kit
[0069] Reagents used Taq polymerase and 10X Taq polymerase buffer, 50X dNTP Mix * , trypsin-versene (EDTA), and chemicals for preparing PBS buffers are commercially available.
[0070] Table 2
[0071] Kit ingredients:
1.Cellock solution (obtained by embodiment 1)
2. Reaction mixture
FP primer 100ng / μL
RP primer 100ng / μL
CP primer 100ng / μL
ICT template 0.01 amol / μL
50X dNTP Mix *
Taq polymerase 2Units / μL
10XTaq Polymerase Buffer
PCR grade water
3. Positive control standard: 250cells / μL
[0072] 1. The primer sequence is as follows, synthesized by the biological company:
[0073] FP: 5'[FAM]ATTGCCAATCCGTCGAGCAGAGTT[-DABSYL]
[0074] RP: 5'GCGCGGCTTACCCCTTACCCTTACCCTAACC
[0075] CP: 5'[ROX]ATCGCTTCTCGGCCTTT[-DABSYL]
[0076] ITC: 5'AATCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT
[0077] 2.PCR grade water: deionized water, no protease, DNase and RNase pollution....
Embodiment 3
[0083] Embodiment 3. The method for using the kit of the present invention
[0084] Step 1 template preparation;
[0085] (1) Take 200mL of the first morning urine of 10 pathological cases, add 2ml of Cellock solution for the first time according to the ratio of urine:preservation solution 100:1, centrifuge at 2000g at room temperature for 30min to precipitate urine sample cells; discard the supernatant , then add 10ml, Cellock solution to resuspend the urine sample cells, and the resuspension enters the next step of detection or stores at -75°C;
[0086] (2) Take 2ml of the urine sample cell suspension obtained in the previous step, centrifuge at 8000g at 4°C for 5min, discard the supernatant as much as possible;
[0087] (3) Add 20ul 1X cell lysate (recipe is the same as 2.2 in Example 1), and obtain urine cell samples from 10 cases respectively.
[0088] Step 2. Detection process design
[0089] To test 10 (n) samples, then each test will consist of 24 PCR reactions (2n+...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com