349 results about "Cell activity" patented technology

The invention relates to the field of image processors and biological medicines, and discloses an NK cell activity rapid detection method based on image processing. The method comprises the following steps: acquiring an unmarked time sequence phase image sequence of an NK cell and target cell co-culture system; performing cell instance segmentation to track individual cells; extracting a morphological dynamic characteristic parameter set of the target cell, wherein the morphological dynamic characteristic parameter set comprises a volume change rate, a phase gradient entropy, a cytoplasm phase fluctuation frequency and a nuclear region phase mean value; inputting the parameters into a pre-trained death state discrimination model, and outputting a death probability; and calculating a killing efficiency index based on the death probability evolution curve, and judging the activity level of the NK cells. The system comprises a phase image acquisition unit, a cell segmentation unit, a feature extraction unit, a death judgment unit and an activity judgment unit. Through unmarked imaging and deep learning fusion analysis, high-precision, real-time, quantitative and ultra-early NK cell activity evaluation is realized, and the method is suitable for clinical instant inspection and immunotherapy monitoring.

The invention discloses a gradient alcohol extraction preparation method of compound honeysuckle flower drops for improving T cell activity, and relates to the technical field of traditional Chinese medicine compound preparations, honeysuckle flower and radix astragali are selected for pretreatment, an ethanol aqueous solution and an interaction regulating agent are added for infiltration, an online traditional Chinese medicine compound preparation HPLC is adopted for dynamic alcohol concentration adjustment and temperature extraction under monitoring of the traditional Chinese medicine compound preparation, the method disclosed by the invention has the advantages that the interaction regulating agent is added in the raw material infiltration stage to block bad interaction among active components, and the online monitoring system is utilized to dynamically adapt the ethanol concentration and the extraction temperature to realize step-by-step efficient dissolution of the multi-polar components; the antioxidant is matched to inhibit oxidation of thermosensitive components, and the solubilizer assists dissolution of insoluble components, so that the core defect that synergistic extraction of multi-polar active components, degradation of the thermosensitive components and interaction inhibition of the components in the compound honeysuckle flowers cannot be considered in the prior art is overcome, and loss or antagonism of the active components is effectively avoided.

The invention discloses a multifunctional hydrogel patch and a preparation method and application thereof.The biological patch comprises decellularized freeze-dried tumor tissue (dFCT) and a hydrogel layer loaded with hair melanin nanoparticles (HNPs), the dFCT is obtained by decellularizing and freeze-drying the tumor tissue, and rich natural extracellular matrix components are reserved; hNPs is extracted from hair and has excellent active oxygen scavenging capacity and photothermal conversion performance; it is preferable that the hydrogel layer is a methacrylated gelatin (GelMA). The patch disclosed by the invention shows a remarkable cell viability promoting effect and antibacterial ability in vitro, and can accelerate wound healing by reducing oxidative stress, inhibiting inflammatory response and promoting angiogenesis in vivo. The patch is simple and convenient in preparation process and natural in component source, has multiple functions of resisting bacteria, resisting oxidation, promoting tissue regeneration and the like, and is suitable for wound repair treatment.

The invention discloses a bioreactor multi-parameter adaptive control system and method based on machine learning, and belongs to the technical field of bioreactor intelligent control, and the bioreactor multi-parameter adaptive control system comprises a bioreactor hepatocyte culture unit, a data acquisition and control unit and a machine learning intelligent decision-making unit. And the data acquisition and control lower computer controls operation variables such as gas supply, sampling and perfusion in the culture unit execution mechanism, collects culture process data returned by the parameter detection module, constructs a data-driven cell state prediction model by utilizing machine learning, and optimizes model parameters and operation variables based on a prediction result to realize closed-loop control. The method can overcome the defect that there is no precise mechanism model for hepatic cell culture, and multi-parameter collaborative optimization can be realized only depending on process data, so that the state of the hepatic cells is sensed in real time, full-cycle optimization of cell viability and functions is realized, and the activity and density of hepatic cell culture are effectively improved.

The invention provides a culture medium and a method for promoting mesenchymal stem cells to secrete exosomes, and belongs to the technical field of cell biology. The culture medium provided by the invention comprises a basic culture medium and the trichostatin A with the final concentration of 10-100nM. The TSA in the culture medium can significantly enhance MSCs exosome secretion under low-concentration and short-time stimulation, does not damage cell activity, does not affect basic biological characteristics and functions of the exosome, significantly increases the MSCs exosome secretion amount by more than 2 times, greatly improves the production efficiency, and provides a new strategy for large-scale production of the exosome.

The present invention relates to lipid-based nanoparticles comprising an antigen-binding domain capable of specifically binding to a target expressed on the surface of activated immune cells, and one or more mRNA molecules encoding an activity-enhancing protein of the activated immune cells, and to the use thereof.

The invention discloses an application of samidocardone in preparation of a medicine for treating pulmonary fibrosis. According to the application disclosed by the invention, the condition that the samidojun can inhibit the activity of the pulmonary fibrosis cells and reduce proliferation by inducing the ferroptosis of the pulmonary fibrosis cells is proposed and verified for the first time, and meanwhile, the expression of fibrosis-related proteins is reduced, so that the progress of the pulmonary fibrosis is effectively relieved, and a new direction is provided for treating the pulmonary fibrosis.

The invention discloses blood component single sampling equipment capable of monitoring in real time in the field of blood treatment equipment. The equipment comprises a blood sampling module, a centrifugal separation module, a component collection module and an anticoagulant conveying module, and further integrates a multi-dimensional real-time monitoring system and a closed-loop self-adaptive regulation and control module. The multi-dimensional real-time monitoring system comprises an online micro-fluidic component detection unit, a physiological parameter monitoring unit and an equipment operation monitoring unit, can realize real-time online detection of blood component purity, cell activity and pollutant residue in the separation process, and synchronously monitors circulation physiological parameters of a blood donor and an equipment operation state at the same time; the closed-loop self-adaptive regulation and control module can dynamically adjust parameters such as the centrifugal rotating speed, the fluid pump speed and the anticoagulant ratio according to real-time monitoring data, and precise closed-loop control over the separation process is achieved. The quality stability of blood single-sampling components can be remarkably improved, meanwhile, the operation risk is greatly reduced, and the method is suitable for clinical blood component single-sampling and preparation scenes.

The invention provides a cell activity detection method based on fluorescence labeling, and relates to the technical field of cell analysis. The cell activity detection method based on fluorescence labeling comprises the following steps: S1, co-incubating a cell sample to be detected with a mixed solution of propidium iodide, a JC-1 mitochondrial membrane potential dye, a DCFH-DA active oxygen probe, a Caspase-3 / 7 activated substrate and a Hoechst nuclear dye, completing synchronous multiple labeling, and generating a multi-labeled cell sample, S2, detecting the cell activity based on the multi-labeled cell sample, five-channel full-automatic scanning is carried out through a high-content imaging system, Z-stack images are collected, and a multispectral image data set is generated. The five probes are mixed and incubated at one time through a synchronous multiple labeling process, so that the operation time is remarkably shortened, and the risk of cell injury caused by multiple times of centrifugation is reduced; z-stack full-automatic scanning is combined with three-dimensional image acquisition, the capturing capability of weak fluorescence signals is improved through multi-focal plane fusion, and information loss caused by cell thickness or position offset in traditional two-dimensional imaging is overcome.

The invention belongs to the technical field of biomedicine, and relates to a novel application of 3-O-methyl chrysotoxin, in particular to an application of 3-O-methyl chrysotoxin in preparation of a medicine for treating xerophthalmia. The core of the 3-O-methyl chrysotoxin disclosed by the invention is that the 3-O-methyl chrysotoxin effectively relieves corneal epithelial cell injury induced by hyperosmosis and inhibits oxidative stress and proinflammatory factor release by activating an EGFR (Epidermal Growth Factor Receptor) signal channel. In-vitro and in-vivo experiments prove that the composition can remarkably enhance cell activity, reduce apoptosis and active oxygen accumulation and repair the steady state of a tear film. The compound is applied to preparation of xerophthalmia drugs and has important clinical value.

The utility model discloses a portable preservation box for stem cell culture, which comprises a box body, the inside of a mounting shell is divided into circulation channels through a plurality of groups of placing boxes, and the circulation channels are used for prolonging the forced contact time of air and dry ice; the air inlet end of the air pump communicates with two sets of extraction pipes used for extracting air to flow in the circulation channel. Through the design of the mounting shell, the placement box, the air pump, the extraction pipe, the exhaust pipe and the like, and through the cooperation of the air pump, the extraction pipe and the exhaust pipe, air in the box body can quickly flow in the mounting shell, and the air is forced to be in contact with dry ice in the placement box when flowing in the mounting shell, so that the air is quickly cooled and uniformly circulated; therefore, a cold source can be utilized to the maximum extent, energy waste is reduced, a set low-temperature environment can be recovered in a short time through an active refrigeration mode, the time for exposing stem cells to non-ideal temperature is shortened, and cell activity decline or cell death is avoided.

The application discloses a kind of sulphur-containing amide compounds and its preparation method and application;It has the structural formula shown in formula I: Wherein, R1 Selected from H, C 1～6 Alkyl, naphthyl, wherein, R7 Selected from H, C 1～6 Alkyl, halogen, cyano, cyano-substituted phenyl, nitro, C 1‑6 Alkoxy, phenyl, C 1～6 Halogenated alkyl, C 2～6 Ester group;R2 Selected from H, C 1～6 Alkyl;R3 Selected from H, halogen, C 1‑6 Alkoxy;R4 Selected from H, halogen, cyano, nitro, C 1‑6 Alkoxy, C 1～6 Alkyl;R5 Selected from H, C 1～6 Alkyl;R6 Selected from H, C 1～6 Alkyl, wherein R8 Selected from C 1～6 Alkyl.The application develops a kind of novel structure sulphur-containing amide compounds, and the compound has the effect of inhibiting tumour cell activity.

The application provides an arginine methyltransferase 6 inhibitor and a preparation method, a pharmaceutical composition and a use thereof, relates to the technical field of biological medicine. The arginine methyltransferase 6 inhibitor provided by the application is a new compound obtained on the basis of a large number of design, synthesis and screening. The arginine methyltransferase 6 inhibitor is different from existing PRMTs inhibitors. The arginine methyltransferase 6 inhibitor can selectively degrade arginine methyltransferase 6, thereby regulating the protein level of arginine methyltransferase 6, has antitumor cell activity, can be used for preventing or treating diseases related to abnormal expression of PRMT6, and provides a new choice for development and application of antitumor drugs. The preparation method of the arginine methyltransferase 6 inhibitor provided by the application adopts raw materials which are easy to obtain, has the advantages of simple synthesis method, safety, easy realization and high yield, and can be used for industrial production.

According to an aspect, a user equipment comprising at least one processor and at least one memory, may receive, from a network node providing a serving cell, assistance information associated with a cell activity of the serving cell and a cell activity of one or more neighboring cells of the serving cell. Furthermore, the user equipment may further determine to omit at least one cell measurement based on the assistance information.

The invention relates to the technical field of biology, in particular to a cryopreserved stem cell diluent and application thereof.The cryopreserved stem cell diluent further comprises cysteine and polyvinylpyrrolidone besides a compound electrolyte injection, the concentration of cysteine in the cryopreserved stem cell diluent is 1-10 mM, and the concentration of polyvinylpyrrolidone in the cryopreserved stem cell diluent is 1-10 mM. The concentration of the polyvinylpyrrolidone in the cryopreserved stem cell diluent is 0.02 to 0.1 g / mL. The cryopreserved stem cell diluent can improve the cell activity and cell distribution after the cryopreserved cell preparation is recovered, and can monitor the application of cells in rat living body imaging.

The present disclosure provides a cell patch cryopreservation solution, which includes: a cryoprotectant, a buffer, a reducing agent, a calcium channel inhibitor and an apoptosis inhibitor. The present disclosure also provides a method of cryopreserving a cell patch by using the aforementioned cell patch cryopreservation solution. The cell patch cryopreservation solution and the method of cryopreserving a cell patch provided by the present disclosure can maintain the structural integrity and the cell activity of the cell patch.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.

The application belongs to the technical field of biological medicine, and particularly relates to an anti-aging ergothioneine composition for improving mitochondrial function and a preparation method thereof. The composition comprises the following components: ergothioneine, sea hao polysaccharide and entada extract. The ergothioneine has good mitochondrial targeted antioxidant activity, can up-regulate the expression of Sirt1 to activate PGC-1a, and promote mitochondrial biosynthesis; the sea hao polysaccharide is helpful to restore mitochondrial function, promote the generation of mitochondrial high-energy phosphoric compounds, improve cell activity and energy supply for regeneration, and can up-regulate the expression of key genes for mitochondrial biosynthesis and ATP synthase related genes. The entada extract can synergize with the ergothioneine and the sea hao polysaccharide, significantly down-regulate the expression of aging related proteins such as p53, p21 and p16 in cells, simultaneously inhibit the transcription of aging related genes, and has a good protective effect on aging cells.

The invention relates to the field of cell activity detection, and discloses an animal cell activity rapid detection device which comprises a main body, a detection table is arranged at the upper end of the main body, a dustproof glass cover is arranged at the upper end of the detection table, and a rapid mixing assembly is arranged on one side of the upper end of the detection table. The rapid mixing assembly is used for mixing animal cells and trypan blue solution or other auxiliary detection solutions, a detection assembly is arranged on the side, corresponding to the rapid mixing assembly, of the upper end of the detection table, the detection assembly is used for detecting the activity of the animal cells, and an auxiliary detection structure is arranged on the other side, corresponding to the detection assembly, of the upper end of the detection table. According to the invention, the grid pattern design divides the microscopic view into standardized grids, and the AI image analysis is combined to automatically and randomly select a plurality of grids to count the number of live and dead cells, so that the traditional manual counting is replaced, the detection speed is increased, meanwhile, contrast experiment data can be formed, and the activity of animal cells can be rapidly and accurately detected; and human errors are reduced, and animal cell activity data are rapidly obtained.

The invention discloses a nucleolin aptamer modified carboxymethyl chitosan-based glycolysis regulation nano-drug delivery system as well as a preparation method and application thereof, and relates to the field of tumor treatment. The nucleolin aptamer AS1411 is coupled with glycolysis regulation nano-particles through covalent bonds, and the carboxymethyl chitosan-based glycolysis regulation nano-drug delivery system comprises a carboxymethyl chitosan-based glycolysis regulation nano-drug delivery system, a carboxymethyl chitosan-based glycolysis regulation nano-drug delivery system and a carboxymethyl chitosan-based glycolysis regulation nano-drug delivery system, the glycolysis regulation nano-particles take carboxymethyl chitosan as a carrier skeleton, the carrier skeleton is loaded with a lonidamine derivative through grafting modification, and the nano drug delivery system can synchronously entrap paclitaxel. According to the invention, a synergistic treatment system integrating active targeting, metabolic regulation and chemotherapy is constructed, and by virtue of a multi-mechanism synergistic effect, an antitumor drug for inhibiting tumor cell activity, glycolysis or tumor metabolism reprogramming is prepared; the huge potentials of overcoming the drug resistance bottleneck of traditional chemotherapy, enhancing the curative effect and reducing the toxic and side effects are shown.

The present invention relates to a chimeric protein of IL-2 protein and IL-15 protein, a variant thereof, a fusion protein comprising the same, and / or a genetically engineered cell modified to express any one or more thereof. In the present invention, the binding to IL-2Rβ is weakened, the side effects caused by the excessive immune cell activity of IL-2 can be inhibited, and the rapid exhaustion of natural killer cells is prevented, thereby allowing the appropriate level of cell activity and cell survival ability to be maintained for a long time. Accordingly, the present invention can be used for modulating the immune system and treating immune-related diseases, such as cancer, infectious diseases, and autoimmune diseases.

The invention belongs to the field of biomedical engineering, and particularly relates to an amino acid modified molybdenum disulfide artificial extracellular matrix and application. Preparing an amino acid modified molybdenum disulfide artificial extracellular matrix, inoculating the neuron in-vitro model PC12 cell suspension onto the artificial extracellular matrix, and constructing the nerve cell in-vitro differentiation model. The artificial extracellular matrix with good biocompatibility is obtained by constructing different kinds of amino acid modified molybdenum disulfide nano material artificial extracellular matrixes as the artificial extracellular matrix of nerve cells PC12, and the artificial extracellular matrix improves the activity of the PC12 cells and promotes the differentiation of nerve cell synapses; a neuron in-vitro model with high differentiation and higher activity is constructed, and the artificial extracellular matrix can be used for nerve regeneration and neural engineering.

The application relates to the technical field of computers, in particular to a 3D printer multidimensional state data real-time acquisition system, which comprises a data acquisition module, a feature engineering module, a state prediction module and a self-adaptive control module; the data acquisition module is used for acquiring multidimensional state parameters in a printing process in real time; the feature engineering module is used for generating a comprehensive feature vector based on the multidimensional state parameters acquired by the data acquisition module; the state prediction module is used for predicting expected cell activity and expected geometric fidelity by adopting a physical information neural network model according to the comprehensive feature vector generated by the feature engineering module and a preset candidate printing speed; the self-adaptive control module is used for determining an optimal printing speed according to the expected cell activity and the expected geometric fidelity; and the instruction execution module is used for real-time regulation and control of the operation of the printer in response to the optimal printing speed. The application changes the contradictory relationship between the printing speed and the cell activity into a target that can be optimized in coordination, and realizes a fundamental change in the technical path.

The invention discloses application of DNASE1L3, CYP4B1 and / or FAM65B in enhancing the cisplatin sensitivity of nasopharyngeal carcinoma, and belongs to the field of biological medicine. The invention proves that overexpression of the DNASE1L3 gene, the CYP4B1 gene and / or the FAM65B gene can obviously inhibit the activity of nasopharyngeal carcinoma cells and obviously enhance the sensitivity of the nasopharyngeal carcinoma cells to cis-platinum. An in-vivo xenotransplantation tumor model further proves that the in-vivo anti-tumor effect of the cis-platinum can be remarkably enhanced by combining the overexpressed DNASE1L3 gene, the CYP4B1 gene or the FAM65B gene with the cis-platinum, and tumor growth is effectively inhibited. The invention provides a brand new molecular target for overcoming the cisplatin resistance of nasopharynx cancer, provides a new strategy for preparing high-efficiency and low-toxicity nasopharynx cancer treatment drugs and cisplatin sensitizers, and has important clinical application prospects and market values.

Disclosed herein are cells (e.g, immune cells such as T cells) engineered to contain and / or express a Lysis Sensor Receptors (LSR) comprising an extracellular domain with affinity and specificity for an intracellular product of a diseased cell such as a cancer cell; a transmembrane element and at least one signaling element, and a chimeric antigen receptor (CAR) comprising an extracellular domain with affinity and specificity for an extracellular product of a diseased cell such as a cancer cell; a transmembrane element and at least one signaling element. Also provided herein are various uses of such engineered cells, including in the treatment of cancer, for example to enhance T cell activity (e.g, TIL and / or CAR-T cell activity) and / or to enhance antibody-based therapy, such as cancer immunotherapy.

The present application relates to the technical field of biological cell culture, and particularly relates to a fixed bed device and method for improving secretion and expression of exosomes. The device comprises a fixed bed reactor, an ultrasonic generator, a connecting flange and a control unit. The ultrasonic generator is installed on the top of the fixed bed reactor through the connecting flange. The control unit is configured to control the ultrasonic generator to apply ultrasonic stimulation to the cells intermittently in the whole cycle of cell culture. The ultrasonic intensity is dynamically regulated in three stages according to the culture cycle. The present application uses pure physical stimulation without adding chemical reagents. Under the premise of maintaining normal growth and activity of cells, the yield of exosomes can be increased by more than 169%. The present application is suitable for animal cells and plant cells and has a wide industrial application prospect. The technical problems of low yield of exosomes, stimulation mode that may affect cell activity or introduction of chemical reagents that may interfere in the prior art can be effectively solved.

The invention relates to an expression line resisting composition containing cell signal factors and plant active ingredients and a skin care product of the expression line resisting composition. The expression line resisting composition is prepared from the following components in percentage by mass: 10 to 50 percent of cell signal factors, 10 to 50 percent of flos chrysanthemi extract and 10 to 50 percent of camellia seed oil. By adopting a composite strategy of metabolism regulation and neuromuscular regulation, nerve-muscular signal conduction is regulated, facial muscle tension is weakened, and dynamic formation of expression lines is reduced; the AMPK energy metabolism pathway is activated, and the cell activity is improved; rOS accumulation in cells is reduced, and the mitochondrial function is improved; strong fat-soluble anti-oxidation protection is provided, the action time is prolonged, barrier repair, moistening and anti-inflammation are facilitated, and therefore the more efficient expression line resisting effect is achieved.

The present invention relates to: a stem cell isolation kit manufacturing composition prepared with graphene dispersed therein, and a preparation method therefor, the composition enabling cell activity of stem cells to improve and blood clots to be prevented through mixing of graphene and a thermoplastic resin. The stem cell isolation kit manufactured using the stem cell isolation kit manufacturing composition comprising graphene, of the present invention, allows autologous stem cells to be activated by an environment in which biocompatible far-infrared (FIR) emission and electrical conductivity are increased, and, under hypoxic conditions, enables stem cell water amount to be increased through low oxygen permeability (water activity). In addition, the present invention is subjected to antibacterial treatment so as to provide an antibacterial effect, and can improve a platelet adsorption reduction rate through a water slip effect of the graphene composition.

Two push rod type linear stepping motors in the device are arranged at the two ends of a guide rail through L-shaped push rods, carrying tables are arranged above the L-shaped push rods, telescopic rotating motors are arranged on the carrying tables respectively, the telescopic rotating motors are vertically connected with magnet plates, and the magnet plates are arranged on the carrying tables. A third telescopic rotating motor is arranged at the rear end of one magnet plate, a vertical guide rail groove and a transverse guide rail groove are formed in one magnet plate, and the control module is connected with all the motors. According to the invention, the high gradient magnetic field advantage of the panel Halbach array is utilized, the precise control capability of the motor is combined, the automatic uniform field and gradient field conversion function of the device is utilized, and a microscope with an image acquisition function is matched, so that the degree of phagocytosis of magnetic particles by cells is automatically observed, and multiple sets of magnetic field devices do not need to be additionally arranged; the cell activity can be effectively protected, and the magnetic field application requirements in the fields of biomedical detection, analysis detection and the like are met.

This invention discloses a method and system for cell viability detection using dual-channel differential dynamic adhesion impedance analysis. The system utilizes a microfluidic chip integrating detection and reference channels to synchronously apply fluid disturbances to both channels, inducing a dynamic process of "adhesion → detachment → re-adhesion" in cells. During this process, the differential impedance curve (after background subtraction) is acquired in real time, and six dynamic feature parameters, including the amplitude and rate of decrease and recovery, are extracted. A ridge regression algorithm is used to construct a cell viability prediction model, and the six dynamic feature parameters are input into the model to obtain cell viability values. This invention effectively eliminates environmental and fluid common-mode noise through differential structure and achieves label-free, in-situ, highly sensitive measurement of cell viability using impedance analysis. It has advantages such as accurate results, good stability, and high automation, and is suitable for fields such as cytotoxicity testing and drug screening.