Chimeric immunoreceptor useful in treating human cancers

Inactive Publication Date: 2009-10-15
CITY OF HOPE
View PDF1 Cites 63 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0020]Bulk lines and clones of human T cells stably transformed to express such an immunoreceptor display redirected cytolysis of the cancer cell type to which they are specific, while showing negligible toxicity towards non-target cells. Such engineered T cells are a potent and selective therapy for malignancies, including difficult to treat cancers such as glioma.

Problems solved by technology

Currently available therapeutic modalities have minimal curative potential for these high-grade tumors and often exacerbate the already severe morbidities imposed by their location in the central nervous system.
The use of chemotherapy in the setting of recurrent disease should be in the context of available clinical trials, as its efficacy in this patient population is unsubstantiated.
The multiplicity of challenges faced in the development of effective adjuvant therapies for malignant glioma include the extensive infiltrative growth of tumor cells into normal brain parenchyma, the capacity of soluble factors elaborated from these tumors to attenuate the development of immune responses, and the difficulty of establishing clinically meaningful therapeutic ratios when administering therapeutics into the central nervous system (CNS).
Internalization of these toxins upon binding to IL-13 receptors is the basis of the selective toxicity of these fusion proteins.
However, the binding of IL-13-based cytotoxins to the broadly expressed IL-13Rα1 / IL-4β / γc receptor complex has the potential of mediating untoward toxicities to normal tissues outside the CNS, and thus limits the systemic administration of these agents.
Targeting infiltrating tumor cells within the brain parenchyma, however, is a potentially significant limitation of this approach.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric immunoreceptor useful in treating human cancers
  • Chimeric immunoreceptor useful in treating human cancers
  • Chimeric immunoreceptor useful in treating human cancers

Examples

Experimental program
Comparison scheme
Effect test

example 1

Construction of an Immunoreceptor Coding Sequence

[0043]The coding sequence for an immunoreceptor according to the present invention was constructed by de novo synthesis of the IL13(E13Y) coding sequence using the following primers (see FIG. 8 for a flow chart showing the construction of the immunoreceptor coding sequence and expression vector):

IL13P1:EcoRI(SEQ ID NO. 1)TATGAATTCATGGCGCTTTTGTTGACCACGGTCATTGCTCTCACTTGCCTTGGCGGCTTTGCCTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGTACIL13P2:(SEQ ID NO. 2)GTTGATGCTCCATACCATGCTGCCATTGCAGAGCGGAGCCTTCTGGTTCTGGGTGATGTTGACCAGCTCCTCAATGAGGTACCTGAGGGCTGTAGAGGGAGIL13P3:(SEQ ID NO. 3)CTCTGGGTCTTCTCGATGGCACTGCAGCCTGACACGTTGATCAGGGATTCCAGGGCTGCACAGTACATGCCAGCTGTCAGGTTGATGCTCCATACCATGCIL13P4:(SEQ ID NO. 4)CCTCGATTTTGGTGTCTCGGACATGCAAGCTGGAAAACTGCCCAGCTGAGACCTTGTGCGGGCAGAATCCGCTCAGCATCCTCTGGGTCTTCTCGATGGCIL13P5:BamHI(SEQ ID NO. 5)TCGGATCCTCAGTTGAACCGTCCCTCGCGAAAAAGTTTCTTTAAATGTAAGAGCAGGTCCTTTACAAACTGGGCCACCTCGATTTTGGTGTCTCGG

[0044]The final sequence (417 bp) was...

example 2

Construction of Expression Vector

[0047]An expression vector containing the IL13 zetakine coding sequence was created by digesting the IL13zetakine / pSK of Example 1 with XbaI-NotI, and creating blunt ends with Klenow, and ligating the resulting fragment into the plasmid pMĜPac (Invirogen) (first prepared by opening with SgrAI, blunting with Klenow, and dephosphorylation with SAP), to yield the plasmid IL13zetakine / pMG. See FIG. 8. The hygromycin resistance region of IL13zetakine / pMG was removed by digestion with NotI-NheI, and replaced by the selection / suicide fusion HyTK, obtained from plasmid CE7RIHyTK-pMG (Jensen, City of Hope) by digestion with NotI-NheI, to create the expression vector IL13zetakine / HyTK-pMG (6785 bp). This plasmid comprises the Human Elongation Factor-1α promoter (hEF1p) at bases 6-549, the IL13zetakine coding sequence at bases 692-2185, the Simian Virus 40 Late polyadenylation signal (Late SV40pAN) at bases 2232-2500, a minimal E. coli origin of replication (O...

example 3

Expression of the Immunoreceptor

[0048]Assessment of the integrity of the expressed construct was first delineated by Wester blot probed with an anti-zeta antibody of whole cell lysates derived from Jurkat T cell stable transfectants107 cocultured in the presence or absence of tunicamycin, an inhibitor of glycosylation. FIG. 1. Jurkat T cell stable transfectants (Jurkat-IL13-pMG bulk line) were obtained by electroporating Jurkat T cells with the IL13zetakine / HyTK-pMG expression vector, followed by selection and expansion of positive transfectants. 2×106 cells from the Jurkat-IL13-pMG bulk line were plated per well in a 24-well plate with or without 5 μg / ml, 10 μg / ml, or 20 μg / ml Tunicamycin. The plate was incubated at 37° C. for 22 hrs. Cells were harvested from each well, and each sample was washed with PBS and resuspended in 50 μl RIPA buffer (PBS, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS) containing 1 tablet / 10ml Complete Protease Inhibitor Cocktail (Boehringer Mannheim, Indian...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to chimeric transmembrane immunoreceptors, named “zetakines,” comprised of an extracellular domain comprising a soluble receptor ligand linked to a support region capable of tethering the extracellular domain to a cell surface, a transmembrane region and an intracellular signalling domain. Zetakines, when expressed on the surface of T lymphocytes, direct T cell activity to those specific cells expressing a receptor for which the soluble receptor ligand is specific. Zetakine chimeric immunoreceptors represent a novel extension of antibody-based immunoreceptors for redirecting the antigen specificity of T cells, with application to treatment of a variety of cancers, particularly via the autocrin / paracrine cytokine systems utilized by human malignancy. In a preferred embodiment is a glioma-specific immunoreceptor comprising the extracellular targetting domain of the IL-13Rα2-specific IL-13 mutant IL-13(E13Y) linked to the Fc region of IgG, the transmembrane domain of human CD4, and the human CD3 zeta chain.

Description

[0001]This application is a continuation-in-part of prior co-pending application U.S. Ser. No. 11 / 274,344, filed Nov. 16, 2005, which is a continuation-in-part of application U.S. Ser. No. 10 / 134,645, filed Apr. 30, 2002, now abandoned, which claims the benefit of application U.S. 60 / 286,981, filed Apr. 30, 2001. This application also claims the benefit of application U.S. 61 / 091,915, filed Aug. 26, 2008. The disclosures of all of the above applications are hereby incorporated by reference in their entirety.[0002]This invention was made with government support in the form of Cancer Center Support Grant no. P30-CA33572-21 from the United States Department of Health and Human Services, National Institutes of Health. The United States government has certain rights in the invention.TECHNICAL FIELD[0003]The invention relates to the field of biomedicine and specifically methods useful for cancer therapy. In particular, embodiments of the invention relate to methods for specific CTL immuno...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K45/00C07K14/00C12N15/74A61P35/00
CPCC07K14/5437C07K14/7051C07K2319/30C07K2319/00C07K14/7155C12N15/63C07H21/04A61K38/1774A61K38/2086A61P35/00A61K39/4631A61K2239/15A61K2239/38A61K2239/47A61K39/46444C12N5/0636A61K39/4611A61K39/464419C07K16/46C07K19/00A61K35/17C07K14/70514
InventorJENSEN, MICHAEL
OwnerCITY OF HOPE