106 results about "Diagnostic Reagent" patented technology

This invention provides a highly pathogenic feline calicivirus strain, its vaccine, and its applications. The highly pathogenic feline calicivirus was isolated from pathogenic material and identified as a highly pathogenic strain, named FCV CC475, with its cDNA sequence shown in SEQ ID NO.1. This strain exhibits strong pathogenicity, causing infected animals to develop symptoms such as fever, paw pad ulcers, and dehydration by day 3 post-infection; the viral load after 5 generations is 10. 9.80 TCID 50 / ml. This strain produces high antibody titers after immunization of cats and rabbits, demonstrating good immunogenicity. Therefore, this highly pathogenic feline calicivirus has broad application prospects in the preparation of feline calicivirus infection vaccines, diagnostic reagents, or therapeutic drugs.

This invention belongs to the fields of molecular biology and bioinformatics, specifically relating to a truncated bovine virus-encoded protein phage library, its construction method, and applications. This library covers all 162 known bovine viruses that host bovine subfamily viruses, containing 51,794 non-redundant peptide coding sequences of 56 amino acids each. These peptides are fused and displayed on the surface of the T7 phage capsid, with all coding sequences having a uniform total length of 200 bp. The library construction was achieved through sequence acquisition, truncation and redundancy removal, codon optimization and DNA synthesis, and in vitro ligation and packaging with T7 phage. The resulting library exhibits a positivity rate of 93% and a titer of 2.8 × 10⁻⁶. 10 PFU / mL. This invention features an optimized single-round high-throughput screening process adapted to clinical bovine serum samples, enabling efficient identification of bovine virus B-cell epitopes and providing tools and candidate targets for bovine virus vaccine development and diagnostic reagent development.

The present invention provides isolated polypeptides capable of specifically binding to a protein target selected from LGALS9, CRP, BTLA, SAA, EGF, or FGA, or to a peptide thereof, especially under urinary conditions, which may be used for predicting in a urine sample of a subject suspected of having an infection whether the infection is a bacterial infection or a viral infection. The present invention further provides methods of diagnostics and treatment using the isolated polypeptides, and suitable diagnostic kits.

The application provides an anti-Spike protein antibody of a novel coronavirus and an application thereof. By means of genetic engineering and phage surface display library technology, specific antibodies against the S protein of the novel coronavirus are screened from a single-chain antibody library of non-immune full human sequences. The antibodies have an affinity to the S protein of the virus between 1nM and 50nM, the antibodies have an inhibiting effect on the combination of the S protein of the novel coronavirus and human receptor ACE2, and the anti-S protein antibodies of the application have a good ability to combine with the S protein and a potential neutralizing inhibiting effect. The application provides specific antibody candidate molecules for the development of diagnostic reagents, preventive and therapeutic antibody drugs against the novel coronavirus (2019-nCoV) and the treatment of other diseases such as pneumonia caused by the coronavirus.

The application relates to the fields of medical diagnosis and gene drugs, and particularly relates to application of long-chain non-coding RNA in preparation of a heart insufficiency diagnosis reagent or kit. The application also provides application of the long-chain non-coding RNA in preparation of a heart insufficiency treatment drug. The application first finds that LOC107984012 is long-chain non-coding RNA which is highly expressed in a failing heart, and provides a new diagnosis marker and treatment target for heart insufficiency.

The present application provides a PSMA-targeting ligand compound and chelate thereof and use thereof. The structure of the PSMA-targeting ligand compound is shown in formula I, wherein R1, R2 and R4 are each independently selected from H and optionally substituted C1-C5 linear or branched alkyl; R3 is selected from optionally substituted aryl ring group and optionally substituted aromatic heterocyclic group; X is a sulfur or oxygen atom; Y is selected from a chemical bond and -NH-(CH2)m-, wherein m is an integer selected from 0-18; and Z is a radioactive metal ion chelating group. The pharmacokinetic characteristics of the PSMA-targeting ligand compound are obviously improved, which can be more effectively absorbed by the human body, stably exist in the body, and be taken up and internalized by cancer cells, so that the coupling of the radioactive nuclide can obtain cancer treatment drugs and diagnostic reagents with obviously improved therapeutic effect.

The application discloses a novel AIE photosensitizer and a preparation method and application thereof. The AIE photosensitizer of the application comprises TDQ shown in the following structural formula, has superior photo-thermal conversion performance and photodynamic performance, and can be used for preparing a tumor diagnosis reagent or a tumor treatment drug. The co-loading liposome of TDQ and a senescence-inducing molecule (Ali) can be used as a multi-modal light diagnosis and treatment agent to realize efficient delivery of drugs to tumor tissues, and the photo-thermal therapy and the photodynamic therapy based on TDQ not only induce cell apoptosis through oxidative stress and mitochondrial dysfunction, but also trigger cancer cell senescence and promote the secretion of SASPs, so that the anti-tumor immunity is significantly enhanced, and finally the growth of primary tumors, tumor recurrence and re-metastasis are inhibited. The material of the application has simple preparation process, low cost, and is suitable for scale production and clinical medical use.

The application belongs to the technical field of in-vitro diagnostic reagents, and particularly relates to thrombelastography quality control products and a preparation method and application in preparation of coagulation detection products, a coagulation detection product and a coagulation detection method. The application realizes high adhesion of quality control product coagulation parameters and clinical actual measurement values by optimizing plasma proportioning and screening special excipients, can simulate six typical clinical coagulation states from normal coagulation to low coagulation, high coagulation, fibrinogen abnormality, DIC and the like, and simultaneously has the characteristics of simple preparation process and excellent long-term stability.

The application provides an anti-Spike protein antibody of a novel coronavirus and an application thereof. By means of genetic engineering and phage surface display library technology, specific antibodies against the S protein of the novel coronavirus are screened from a single-chain antibody library of non-immune full human sequences. The antibodies have an affinity to the S protein of the virus between 1nM and 50nM, the antibodies have an inhibiting effect on the combination of the S protein of the novel coronavirus and human receptor ACE2, and the anti-S protein antibodies of the application have a good ability to combine with the S protein and a potential neutralizing inhibiting effect. The application provides specific antibody candidate molecules for the development of diagnostic reagents, preventive and therapeutic antibody drugs against the novel coronavirus (2019-nCoV) and the treatment of other diseases such as pneumonia caused by the coronavirus.

The application belongs to the technical field of biological detection, and particularly relates to the use of apolipoprotein A-I in the preparation of a diagnostic reagent or system for predicting the risk of severe acute hepatitis E. The application first discloses and verifies the significant correlation between the serum apolipoprotein A-I (apoA-I) level and the adverse clinical outcomes (including severe jaundice, liver failure and death) of patients with acute hepatitis E, and establishes the risk interpretation threshold (0.675 g / L and 0.435 g / L) with clinical practical value. The application can objectively and early identify high-risk patients, and provides a powerful auxiliary tool for clinical stratified management and resource optimization.

This invention provides the application of the IFI16 gene as a target in the preparation of bortezomib-resistant drugs for the treatment of multiple myeloma, involving drug targets, related diagnostic reagents, and treatment strategies for the diagnosis and treatment of multiple myeloma (MM). This invention reveals for the first time the core driving role of IFI16 in bortezomib resistance in MM and its novel mechanism of action through the Wnt / β-catenin pathway; more importantly, it provides novel biomarkers, drug targets, and highly feasible combination therapy regimens for accurate prognostic assessment of MM and overcoming the clinically challenging problem of bortezomib resistance, possessing significant theoretical implications and broad clinical application prospects.

The application provides application of serum sIL-2R as an ADAM10 inhibitor companion diagnostic marker and a corresponding kit, including two core application scenarios: before treatment, screening of a patient population with high activity of an ADAM10-sIL-2R pathway and most likely to benefit from ADAM10 inhibitor treatment by detecting the serum sIL-2R level of the patient; during and after treatment, evaluating the inhibition effect of the ADAM10 inhibitor on the target pathway and the treatment efficacy by dynamically monitoring the change of the serum sIL-2R level; the liquid companion diagnostic strategy will provide an indispensable supporting tool for the precise application of the ADAM10 inhibitor in pancreatic cancer, and significantly improve the precision and effectiveness of clinical medication.

This application relates to the biomedical field and discloses a combination of biomarkers based on mitochondrial oxidative stress for the auxiliary diagnosis of dilated cardiomyopathy and its application. The biomarker combination includes the TARS2, NOX4, and SNCA genes. This biomarker combination can be used to prepare auxiliary diagnostic kits for dilated cardiomyopathy. By detecting the expression levels of each gene in the biomarker combination, the auxiliary diagnosis of dilated cardiomyopathy can be achieved efficiently and accurately. Compared with traditional diagnostic methods, this application, based on the characteristics of mitochondrial oxidative stress-related genes, has higher diagnostic accuracy and better applicability.

The application discloses a kind of modular serum-free cell culture medium and its application, belong to biomedical technology field.The culture medium includes: epidermal growth factor, recombinant insulin, cholesterol-phospholipid nanoparticles, beta-mercaptoethanol, pluronic F-68, glucose / glutamine, trace element mixed solution.The modular serum-free cell culture medium provided by the application can not only meet the large-scale culture of stem cells, but also be used for the industrial production of in vitro diagnostic reagent raw materials such as recombinant antigen, viral vector, recombinant protein and monoclonal antibody, with wide cell adaptability, low production cost, significant economy, stable process, and strict requirements of FDA / EMA for biological products.

The invention discloses a novel serum metabolite composition based on dried blood spot detection and elaborates application of the serum metabolite composition as a marker in preparation of a congenital hypothyroidism diagnostic reagent or kit. The serum metabolite composition comprises thyroxine, 2-piperidone and phosphorylcholine PC (14: 0 / 20: 4). The serum metabolite composition can be used for screening and diagnosing patients with the congenital hypothyroidism, and has the characteristics of low detection cost, good repeatability and relatively high sensitivity and specificity.

This invention belongs to the field of biomedicine and tumor immunotherapy technology, specifically relating to a monoclonal antibody targeting the immune checkpoint molecule CD276 (B7-H3) and its applications. The applicant conducted immunization and screening work around the human CD276 antigen, selecting two representative monoclonal antibody clones, 2B2-1 and 5G4-2, from multiple candidate antibodies. The nucleotide and amino acid sequences of their heavy and light chain variable regions were determined, and their performance in flow cytometry, T-cell killing assays, immunohistochemistry, ELISA, and Biacore affinity assays was systematically evaluated. Experimental results show that the above antibodies can specifically recognize and bind to CD276, efficiently distinguish between CD276-high and low-expressing cells, and enhance the killing activity of T cells against CD276-high expressing tumor cells in an in vitro co-culture system. This provides an excellent antibody backbone for the subsequent construction of diagnostic kits, ADC drugs, or bispecific antibodies.

This invention relates to a diagnostic kit for liver fibrosis. The kit comprises a solid-phase conjugate containing anti-MASP2 antibody and an anti-MASP2 antibody labeled with a chemiluminescent marker. This invention has found that using MASP2 as a marker of liver fibrosis, combined with chemiluminescent detection, can improve the sensitivity and specificity of liver fibrosis diagnosis, thereby increasing its accuracy.

The present application relates to the use of a miRNA combination in the preparation of a non-invasive diagnostic reagent for prostate cancer. Specifically, the present application provides the use of a miRNA combination as a diagnostic marker for prostate cancer, which includes multiple of hsa-miR-21-5p, hsa-miR-100-5p, hsa-miR-141-3p, hsa-miR-375-5p, and hsa-let-7f-5p. The expression levels of the miRNA combination in serum are detected by a method based on rolling circle amplification and single-strand cleavage protein, and a diagnostic model is constructed by combining a machine learning algorithm, significantly improving the diagnostic accuracy of prostate cancer. The method of the present application is a non-invasive, rapid, accurate and low-cost method for detecting prostate cancer, and has a broad application prospect.

This invention discloses a cPGES protein based on immunological screening of a bovine cysticercosis cDNA prokaryotic expression library and its applications, belonging to the field of biochemistry. The purpose of this invention is to provide a method for the detection, treatment, and prevention of bovine cysticercosis. This invention provides a bovine cysticercosis antigen, the amino acid sequence of which is shown in SEQ ID NO.4. This provides a new candidate antigen for the development of novel vaccines and specific diagnostic reagents.

The present invention relates to a novel microRNA for in vitro early diagnosis of mild cognitive impairment and Alzheimer's dementia, and a convergence diagnostic cartridge and diagnostic device using same. The novel miRNA of SEQ ID NO: 1 obtained by molecular analysis exhibits differences in expression levels in the plasma of a normal group, a mild cognitive impairment patient group, and an Alzheimer's dementia patient group, and has the effect of reducing the expression levels of mild cognitive impairment- and Alzheimer's dementia-related proteins. Therefore, by using a novel miRNA present in plasma as a molecular diagnostic index in a non-invasive manner, the present invention enables not only early diagnosis of Alzheimer's dementia but also screening for mild cognitive impairment and Alzheimer's dementia.

This invention relates to a system and method for automatically analyzing PCR test results to identify the risk of early pancreatic cancer in individuals. The system includes a computation module, which performs the following computational processes: S1, calculating the corresponding ΔCT based on the CT values ​​of miRNAs and internal controls, and preprocessing abnormal data; S2, removing data exceeding a preset threshold and calculating the Dx value; S3, determining the positive or negative value of the Dx value based on the preset Dx judgment threshold of the selected miRNA combination to determine the sample type. The miRNA combination is a diagnostic reagent used to determine the likelihood of a subject having pancreatic cancer. The miRNA combination is selected from at least three of miR-200c / miR-154 / miR-132 / miR-130b / miR-577 / miR-30c / miR-24 / miR-23a, with one of them being miR-23a.

The present application relates to the technical field of molecular biology, and discloses DNA methylation markers and application thereof in an acute ischemic stroke diagnosis kit, including methylation regions of CDH2, PCDHB10, PCDHB11, PCDHB14, PCDHB16, PCDHB3 and PCDHB9 genes. The present application screens and obtains a combination of 12 methylation regions of 7 marker genes with high specificity and high sensitivity and highly related to early onset risk of acute ischemic stroke, and the combination of the methylation regions is used as a marker for early detection of acute ischemic stroke, and the result is highly accurate, and can provide a reference for auxiliary diagnosis for clinicians.

The application discloses an intestinal microbial marker combination for cirrhosis diagnosis and application thereof, which is composed of 8 specific intestinal bacterial species. The application accurately identifies the core combination from 181 differential characteristics by performing metagenomic sequencing on fecal samples of cirrhosis patients and healthy controls, and combining random forest, LASSO regression and recursive feature elimination algorithms. The random forest diagnosis model based on the 8 markers realizes an excellent performance of area under curve (AUC) 0.841, sensitivity 84.3% and specificity 83.7% on a completely independent test set, and the performance does not decrease compared with the full feature model in the case of reducing the number of characteristics by 86.9%. The marker combination provided by the application is highly simplified and has strong discrimination, and provides a clear and efficient microbiological basis and technical scheme for developing a cirrhosis non-invasive diagnosis kit, a gene chip and other products based on intestinal flora.

The application belongs to the technical field of biological medicine, and specifically discloses application of a reagent for detecting a tsRNA molecular marker in intestinal mucosa tissue in preparation of a Crohn's disease diagnosis kit, characterized in that the tsRNA molecular marker is tRF-28-PW5SVP9N1503, and the sequence is GCCGTGATCGTATAGTGGTTAGTACTCT; the reagent for detecting the tsRNA molecular marker in intestinal mucosa tissue comprises tRF-28-PW5SVP9N1503 fluorescent quantitative PCR upper and lower stream primers, the upper stream primer is AATGCCGTGATCGTATAGTGGTT, and the lower stream primer is TATCCTTGTTGACGACTGGTTGAC; and the reagent has the advantages that absolute quantitative detection of the target molecule can be quickly and accurately completed only by using a small amount of sample, the reagent is used for early screening and identification of Crohn's disease, and has high sensitivity and strong specificity.

A method for the extraction and enrichment of Hepatitis C Virus (HCV) antigens by conjugating specific antibodies targeting Envelope 1, Envelope 2, NS3, and NS4 antigens to a temperature-responsive smart polymer (NIPAAm-Co-HIPAAm-Co-SAKIPAAm). The application also relates to a detection kit for HCV antigens, comprising the smart polymer conjugated to specific antibodies, colloidal gold nanoparticles conjugated to specific antibodies, and instructions for detecting HCV antigens in serum, plasma, or whole blood samples.

This invention discloses a hybridoma cell line that secretes a canine OSMRβ monoclonal antibody and its applications. The monoclonal antibody binds to the extracellular terminal region of canine OSMRβ cells, exhibiting high affinity and specificity, and can be used for immunofluorescence detection, flow cytometry, and ELISA. The monoclonal antibody of this invention shows significant application potential in the development of canine OSMRβ detection reagents and diagnostic reagents for diseases and symptoms related to canine OSMRβ.

This application discloses an anti-human IL-17A protein monoclonal antibody, its preparation method, and its application. The anti-human IL-17A protein monoclonal antibody is mouse-derived and has a heavy chain complementarity-determining region as shown in SEQ ID NO. 1-3 and a light chain complementarity-determining region as shown in SEQ ID NO. 4-6. As a labeling antibody, this anti-human IL-17A protein monoclonal antibody can pair with monoclonal antibody 1E9 as a coating antibody to detect human IL-17A. It has high detection sensitivity and specificity and does not cross-react with other cytokine antigens, providing a raw material guarantee for the downstream development of high-quality diagnostic reagents.

Compositions, assays, methods, diagnostic methods, kits, and diagnostic kits are disclosed for the specific and differential detection of SARS-COV-2 and / or other viruses from samples, including veterinary samples, clinical samples, food samples, forensic sample, environmental samples (e.g., obtained from soil, garbage, sewage, air, water, food processing and manufacturing surfaces, or likewise), or biological sample obtained from a human or non-human animal.