3430 results about "Blood plasma" patented technology

The invention relates to the technical field of biomarkers, in particular to a blood biomarker combination for prediction and auxiliary diagnosis of ovarian reserve hypofunction (DOR), a corresponding detection kit and application of the blood biomarker combination. According to the invention, the content change of the nicotinamide mononucleotide (NMN) and the metabolite combination thereof in serum or plasma is screened for the first time and can be used as a detection index for predicting the ovarian reserve function decline. Based on the biomarker combination, the invention further provides an in-vitro detection kit containing a related standard substance, an internal standard solution and an extracting solution, and a data analysis method combined with a random forest model, so that an individual with a normal ovarian reserve function and an individual with hypofunction can be accurately distinguished. The method is noninvasive, simple, convenient, high in sensitivity and suitable for early recognition and layered screening of clinical ovarian reserve hypofunction.

The present invention relates to spray drying plasma methodology that includes pretreating a donated liquid plasma unit, drying the liquid plasma using a spray drying apparatus with the spray drying disposable device that results in a disposable having the dried plasma, finishing the disposable using the finishing apparatus that is designed to seal and separate the disposable, and transform the disposable into a dried plasma unit. The methods of the present invention include storing the dried plasma unit and, when ready for use, reconstituting the dried plasma unit with reconstitution solution to obtain a plasma unit ready for transfusion into a recipient.

The invention relates to a biotechnology, and particularly discloses a plasmin degradation product D-dimer antibody and application thereof. According to the application, a single B cell antibody preparation technology and a flow cytometry sorting method are applied to the development of a blood coagulation in-vitro diagnosis fibrinolysis system detection antibody for the first time, and a mammalian cell expression system (293F) is adopted to successfully express and obtain three strains of D-dimer monoclonal antibodies (antibody numbers are DD-1, DD-2 and DD-3) with biological activity. Compared with the on-sale Roch D-dimer antibody, the three antibodies have the same affinity with the DD antigen, and can identify and detect the D-dimer in plasma with high specificity and high sensitivity; meanwhile, the probe has no cross reaction with fibrinogen, primary fibrinolytic substances (X, Y and D) and soluble fibrin (SF), and can be used for qualitative or quantitative detection of D-dimer.

The invention relates to the technical field of image recognition, and discloses a carotid plaque stability and stroke risk prediction system fusing multiple modes, and the system comprises a data collection and fusion module, a feature extraction and association module, a risk assessment and layering module, an intervention decision module, and a report generation and feedback module. When carotid plaque stability and cerebral apoplexy risk prediction is carried out, plasma proteomics, radiomics and clinical data are synergistically integrated by establishing a multi-modal data fusion analysis framework, so that the limitation that a traditional method depends on a single data source is overcome; the plaque risk can be evaluated from multiple dimensions of biological activity and morphological features, the comprehensiveness and accuracy of risk prediction are improved, a more reliable diagnosis basis is provided for clinic, interaction and sensitivity influence among different modal features can be adaptively quantified by introducing dynamic feature correlation modeling and a real-time weight calibration mechanism, and the risk prediction accuracy is improved. And objectivity and consistency of risk assessment results are ensured.

The present invention belongs to the field of biological detection technology, and specifically relates to an anti-monkey C-reactive protein monoclonal antibody, an enzyme-linked immunosorbent assay kit and its application. Named CRP-13, CRP-13 includes a heavy chain variable region and a light chain variable region; the heavy chain variable region has three complementary determining regions CDR-H1 to CDR-H3, and the amino acid sequences are shown in SEQ ID NO.6-SEQ ID NO.8; the light chain variable region has three complementary determining regions CDR-L1 to CDR-L3, and the amino acid sequences are shown in SEQ ID NO.9-SEQ ID NO.11. The monoclonal antibody of the present invention can specifically bind to monkey C-reactive protein with high specificity. The above monoclonal antibody can be used to screen a paired monoclonal antibody, and a monkey C-reactive protein enzyme-linked immunosorbent assay kit is obtained based on the combination of the monoclonal antibodies, which can detect the content of monkey C-reactive protein in monkey serum, plasma or tissue fluid.

Described are embodiments that include methods and devices for separating components from multi-component fluids. Embodiments may involve use of separation vessels and movement of components into and out of separation vessels through ports. Embodiments may involve the separation of plasma from whole blood. Also described are embodiments that include methods and devices for positioning portions, e.g., loops, of disposables in medical devices. Embodiments may involve use of surfaces for automatically guiding loops to position them into a predetermined position.

The invention relates to the technical field of biological medicine, in particular to a wound repair material and a preparation method and application thereof.The wound repair material is in a gel shape and comprises hydrogel and platelet-rich plasma, the hydrogel is formed by dynamic crosslinking of collagen and oxidized hyaluronic acid, and the hydrogel physically encapsulates the platelet-rich plasma. The gelatinous wound repair material provides bionic mechanical support through a dynamic cross-linked network, synergistically regulates and controls an inflammation microenvironment and sequential release of PRP growth factors, remarkably promotes angiogenesis and wound healing, is suitable for the clinical treatment fields of diabetic ulcer, chronic difficult-to-heal wounds and the like, and has broad application prospects. The material has the functions of mechanical support, anti-inflammatory regulation and growth factor controlled release.

The invention relates to the technical field of aplastic anemia (AA) treatment research, discloses a biomarker method for predicting the curative effect of cyclosporine on aplastic anemia, and aims to detect plasma differential metabolites of patients with aplastic anemia by adopting a metabonomics technology, find potential biomarkers for treating AA patients and find the curative effect of cyclosporine on the AA patients. CsA) is used for treating the in-vivo metabolism of AA. The method is based on liquid chromatography-mass spectrometry (LC-MS) and gas chromatography-mass spectrometry (GC-MS) technologies, and comprises the following steps: collecting 5 plasma samples of AA patients, 5 plasma samples of healthy people and 5 plasma samples of patients in a stable period after treatment for comparative analysis; and screening differential compounds by adopting a multivariate statistical method, and further performing enrichment analysis on differential metabolites. Research of the method shows that in-vivo metabolites of AA patients and healthy people are obviously different, and the way related to immunity and energy metabolism may be a key target for treating AA; csA intervenes the occurrence and development of AA by regulating and controlling immune-related metabolic ways.

The invention discloses a block chain-based blood full-process traceability tracking and safety management system and method, and relates to the technical field of blood management, and the method comprises the steps: distributing an encrypted digital identifier with a timestamp for each blood unit; collecting physical characteristic data of the blood storage environment in real time; dynamically adjusting the state mark of the blood product based on a preset plasma quality evaluation model; a threshold signature technology is adopted to ensure that multiple medical institutions complete blood information verification and sharing on the premise of protecting privacy; when it is monitored that the blood environment parameters exceed a safety threshold value, graded early warning is generated, and an emergency processing flow is started; and establishing a blood circulation whole process auditing tracking system. The system has the advantages that the blood whole-process traceability system based on the block chain is constructed, transparent credible management of the whole life cycle of blood products from collection to use is achieved, the trust and privacy protection problem in multi-mechanism cooperation is solved, and the blood safety management level and the emergency processing efficiency are comprehensively improved.

The invention relates to an adjusting system applied to continuous kidney replacement treatment of acute kidney injury patients. Comprising the following steps: capturing the blood flow velocity and vascular endothelial permeability of glomerular capillaries in real time by using a micro sensor or a nano-scale optical imaging technology; the method comprises the following steps: pre-judging a risk time point of insufficient tissue perfusion through dynamic modeling of a capillary structure and a functional relationship; combining the microcirculation data with conventional biochemical indexes of the patient to create an early intervention model; when it is monitored that microcirculation perfusion is greatly reduced or kidney oxygen supply is insufficient, continuous renal replacement therapy CRRT parameter fine adjustment is triggered in advance; the method comprises the following steps: collecting plasma toxins of different patients at clinical and molecular levels, and constructing a common toxin map of the acute kidney injury AKI; whether the specific toxin concentration exceeds the standard or not is judged by combining a real-time sensor, and the removal priority is output in real time; a membrane material with an adjustable aperture or a special coating is adopted, so that inflammatory mediators and bacterial endotoxin molecules are adsorbed or intercepted, and the permeability of micromolecular electrolyte is kept.

The invention relates to a breast cancer plasma transporter miRNA marker and application thereof, and belongs to the technical field of biological detection. In the prior art, biomarkers for breast cancer liquid biopsy have the problems of low content, high heterogeneity, insufficient time resolution and the like, so that the detection reliability is limited. According to the invention, a specific miRNA (micro Ribonucleic Acid) marker (including one or more of let-7d-5p, miR-103a-3p and miR-22-3p) of the plasma transporter is provided. The marker can be used for preparing a breast cancer detection reagent or kit. Clinical verifications show that the miRNAs are remarkably and highly expressed in plasma migrators of breast cancer patients, the AUC value reaches 0.763-0.808, the sensitivity is 66.7%-86.7%, the specificity is 66.7%-88.3%, the miRNAs have the advantages of high signal-to-noise ratio and dynamic monitoring, and the accuracy and practicability of breast cancer detection are remarkably improved.

The present invention relates to the field of biomedicine and discloses a platelet-rich plasma for anti-aging and promoting tissue repair and regeneration, a preparation method, and an application thereof, comprising the following steps: obtaining concentrated platelet plasma, and treating the concentrated platelet plasma with low-intensity pulsed ultrasound; the treatment conditions are one of the following treatment methods: 1) the treatment power is 2 to 5 W / cm 2 , the pulse period is 50%, and the ultrasonic treatment time is 2~10 min; 2) First, the first ultrasonic treatment is performed: using 0.2~1.0 W / cm 2 , the pulse period is 50%, ultrasonic treatment is 1~5 min; then the second ultrasonic treatment is carried out: 1.5~5.0 W / cm 2 , the pulse period is 50%, and the ultrasonic treatment is 1 to 5 minutes; the present invention adopts a special ultrasonic treatment system to obtain a PRR product with special activation and lysis characteristics. The product has active substances that are beneficial to tissue repair and regeneration and anti-aging, and shows excellent effects in promoting cell proliferation, cell migration and wound healing.

The invention discloses a blood component separation system and a control method, and belongs to the field of blood separation.The system comprises a centrifugal device, a blood supply pipeline, an air detector valve and a blood pump, a liquid outlet of the centrifugal device is connected with a separation pipeline, and the separation pipeline is sequentially connected with a first plasma bag and a second plasma bag; a centrifugal pressure sensor, a centrifugal high-speed camera and a red blood cell sensor; and the control center comprises a data acquisition module, a data analysis module and a centrifugal control module. The control method comprises steps S1 to S4. Dynamic intelligent regulation and control and automatic control of the blood component centrifugal separation system are achieved, the centrifugal effect is optimized through the image recognition technology, the image recognition technology is superior to the photoelectric recognition technology in the prior art, excessive centrifugation is avoided, meanwhile, the centrifugal quality is guaranteed, and the quality and activity of separated blood components are effectively guaranteed.

The present invention is directed to a variant of a parent polypeptide containing an Fc region of a dog or cat IgG, that shows a higher binding activity to a dog or cat neonatal Fc receptor (FcRn) than a binding activity of the parent polypeptide to a dog or cat FcRn, wherein the Fc region contains at least one amino acid modification. The variant shows an enhanced FcRn binding activity under acidic conditions. Using the variant, therefore, an antibody (IgG) and Fc fusion protein having longer retention in plasma can be provided.

The disclosure relates to methods, compositions, and combinations for detoxification in a patient comprising performing therapeutic plasma exchange (TPE) on the patient. The disclosure also relates to methods, compositions, and combinations for removing toxins in a patient as a result of chronic exposure to the toxins, comprising performing one or more TPE sessions on the patient and administering an oral composition to the patient. The methods, compositions, and combinations of the disclosure may also be used to replenish biomarkers indicative of a healthy state of the body in order to improve immune system function or patient longevity, and / or reduce oxidative stress or inflammation. The methods, compositions, and combinations of the disclosure may also be used to reduce the level of atherosclerosis, improve cognitive function, prevent early cancer development, promote immune health, and / or treat health conditions or diseases such as autoimmune diseases, cancers, Alzheimer's disease, Parkinson's disease, chronic fatigue syndromes, or fibromyalgia. Additionally, the methods, compositions, and combinations of the disclosure may comprise an intravenous supplementation, wherein each TPE session is followed by administration to the patient of an IV composition. The disclosure further relates to oral compositions and IV compositions for use in the methods, compositions, and combinations of the disclosure.

The invention discloses a magnetic control liquid drop micro-fluidic chip, device and method for chemiluminescence immunoassay, and belongs to the technical field of chemiluminescence immunoassay, the micro-fluidic chip comprises: a chip main body, which comprises a plurality of vertically through separation chambers for loading a reagent and serving as a reaction container, if the chip has the function of separating plasma from the whole blood sample, the first cavity adopts a bottom closed structure, and no gap is formed in the separation position between the first cavity and the second cavity; the top thin film and the bottom thin film are used for sealing the separated cavity of the chip main body; and the top gland and the bottom gland are matched with the chip main body in structural shape and are used for firmly attaching the two layers of films to the chip main body. According to the invention, the whole process integration of sample pretreatment, reagent mixing, reaction incubation and chemiluminescence detection can be realized, and a chemiluminescence immunoassay solution which is efficient, low in cost and easy to operate is provided through chip design, device integration and method optimization.

The invention relates to an application of Danjie emodin in preparation of drugs for preventing or treating drug-induced liver injury. The liver injury is drug-induced liver injury induced by acetaminophen. According to the invention, the effective component Danleaf emodin in the traditional Chinese medicine rhubarb is used for preventing and treating drug-induced liver injury induced by acetamido, and the traditional Chinese medicine composition has the characteristics of safety, reliability and small toxic and side effects. Starting from the whole, multi-target intervention is performed on drug-induced liver injury induced by acetaminophen, the levels of glutamic-pyruvic transaminase, glutamic oxalacetic transaminase and malondialdehyde in plasma are remarkably reduced, the obvious anti-inflammatory and liver cell apoptosis inhibiting effects are achieved, the good clinical application prospect is achieved, and a new way is provided for prevention and treatment of liver injury.

A type of additive based on a fluorinated carbamate prepolymer, a preparation method therefor, and a use thereof in the preparation of a medical fluorinated anticoagulant polyurethane material. The preparation method of the additive comprises: reacting a polyester / polyether diol, a diisocyanate and a fluorinated small-molecule diol, to obtain a carbamate prepolymer having an isocyanate end group, and then capping with a monohydric alcohol having a fluorinated carbon chain, to obtain an additive based on a fluorinated carbamate prepolymer. The additive has a high fluorine content. After being blended with a polyurethane masterbatch, fluorine atoms having low surface energy can be enriched on the surface of the material, and the fluorine atom content on the surface of the material can be as high as 60%. This effectively reduces the adhesion of plasma proteins, cells and platelets on the surface of the material, providing the medical polyurethane material with an excellent anticoagulant effect. In addition, it maintains the excellent mechanical properties of polyurethane, and is thus widely applicable in the preparation of medical fluorinated anticoagulant polyurethane materials.

The invention discloses a plasma piRNA combination for early diagnosis of kidney cancer and application, the plasma piRNA combination for early diagnosis of kidney cancer is obtained on the basis of plasma piRNA expression profiles of Chinese population, and a kit for early diagnosis of kidney cancer is established on the basis of the plasma piRNA combination. The kit for early diagnosis of the kidney cancer can accurately predict the onset risk of early diagnosis of the kidney cancer and is beneficial to reduction of the detection cost, meanwhile, the Lasso Logistic regression model is used, the number of variables included in the model is greatly reduced, and application and popularization of the model are facilitated.

The invention relates to a plasma biomarker for predicting the curative effect of non-small cell lung cancer immunotherapy and application of the plasma biomarker. The biomarker for predicting the curative effect of the non-small cell lung cancer immunotherapy, disclosed by the invention, comprises phosphoglycerate kinase 1 (PGK1), fibronectin 1 (FN1), chromogranin A (CHGA), elastin (ELN), heterogeneous ribonucleoprotein H3 (HNRNPH3) and an Aly / REF output factor (ALYREF). The plasma biomarkers for predicting the non-small cell lung cancer immunotherapy curative effect can be detected by adopting a mass spectrum method, and the non-small cell lung cancer immunotherapy curative effect of a patient is judged by the markers.

The present disclosure, in some aspects, provides one or more biomarkers (e.g., plasma biomarkers or circulating biomarkers) for Facioscapulohumeral muscular dystrophy (FSHD). In some embodiments, a biomarker (e.g., plasma biomarkers or circulating biomarkers) described herein is regulated by DUX4. Methods (e.g., non-invasive methods) of using the biomarkers, e.g., for detection (e.g., early detection) and monitoring patient as well as treatment efficacy are also provided. The present disclosure, in other aspects, provides one or more biomarkers (e.g., transcriptome biomarkers) for Facioscapulohumeral muscular dystrophy (FSHD). In some embodiments, a biomarker (e.g., transcriptome biomarkers) described herein is regulated by DUX4. Methods of using the biomarkers, e.g., for detection (e.g., early detection) and monitoring patient as well as treatment efficacy are also provided.

The utility model relates to a platelet-rich plasma preparation device which comprises a main body pipe and an upper cavity, and a containing part, a first assembly communicated with the containing part and an overflow part capable of being communicated with the first assembly through an outer overflow opening formed in the first assembly are arranged in the main body pipe; the upper cavity is used for opening or closing the outer overflow port; the outer overflow port is opened through the upper cavity, and platelet-poor plasma in the first assembly can overflow to the overflow part, so that the concentration multiple of platelet-rich plasma can be adjusted.

The invention relates to a plasma metabolite composition for auxiliary diagnosis of sub-clinical mastitis of dairy cows and application of the plasma metabolite composition. The plasma metabolite combination is a first combination and / or a second combination, and the first combination is composed of glyceryl monolinoleate, 2-methylthiophene, L-cystine, (S)-(+)-citramalic acid, 9-hydroxy-10, 12-octadecadienoic acid, 16-hydroxyhexadecanoic acid, tyrosine hydroxyproline, stearoyl serotonin and histamine; the first composition is composed of 4, 5-dimethyl-2, 4, 5-trimethyloxazole, 12, 13-epoxy octadecadienoic acid, 2-cyclotetradecene-1-ketone, 4 [alpha]-carboxyl-5 [alpha]-cholest-8-ene-3 [beta]-alcohol, N-arachidonyl dopamine d8, 9 (Z) and 11 (E)-conjugated linoleic acid, and the second composition is composed of 2, 5-dihydro-2, 4, 5-trimethyloxazole, 12, 13-epoxy octadecadienoic acid, 2-cyclotetradecene-1-ketone, 4 [alpha]-carboxyl-5 [alpha]-cholest-8-ene-3 [beta]-alcohol, N-arachidonyl dopamine A product prepared based on the plasma metabolite composition and used for auxiliary diagnosis of cow subclinical mastitis is simple in use method and high in accuracy, can be used for assisting a milk somatic cell number method to diagnose cow subclinical mastitis, and reduces the probability of false negative and false positive.

The invention discloses an LC-MS / MS detection method for a palbozuril monoclonal antibody drug in a blood sample, which comprises the following steps: enriching and purifying the palbozuril monoclonal antibody drug in serum and plasma by coupling an enrichment reagent I with magnetic beads, magnetically separating the enriched blood sample, discarding the supernatant, adding a buffer solution I for leaching, and adding a buffer solution II for diluting after leaching; the method comprises the following steps: carrying out high-temperature denaturation on a diluted blood sample, sequentially adding an internal standard and protease for enzymolysis, and then adopting a high performance liquid chromatography-tandem mass spectrometry to realize high-sensitivity rapid detection of the drug concentration of the palbozuril monoclonal antibody in the blood sample. In the pretreatment process, the steps of protein reduction and alkylation are removed, the proteolysis time is shortened, the whole process is simple, convenient and rapid, and multiple requirements of clinical detection on timeliness, accuracy and low detection cost can be met at the same time.

Provided herein are compositions comprising allogeneic human plasma and platelet derived product, and methods for making the compositions and using the compositions as a therapeutic for example, in orthopedic indications.

The invention discloses a plasma tsRNA molecular marker for predicting postoperative delirium of old patients and application of the plasma tsRNA molecular marker, and is characterized in that the plasma tsRNA molecular marker is tRF-Gly-14 and / or tRF-Arg-39, the nucleotide sequence of the tRF-Gly-14 is AATGGTAGAATTTCGGCC, the nucleotide sequence of the tRF-Arg-39 is TCAGAAGATTGAGGGTTCGAATCCTTCGTGGTTG, and the nucleotide sequence of the tRF-Gly-14 and / or the tRF-Arg-39 is / are AATGGTAGAATTTCGGTGGTTG. The invention further provides application of the plasma tsRNA molecular marker in preparation of a kit for predicting postoperative delirium of old patients. The kit comprises forward and reverse primers for fluorescent quantitative PCR (Polymerase Chain Reaction) amplification of tRF-Gly-14 and / or tRF-Arg-39; the method has the advantages of high POD prediction accuracy, high sensitivity and strong specificity, and is helpful for identifying high-risk patients in time.

Provided herein are methods of treating a subject with heart failure, comprising administering to the subject an initial dose of a cardiac sarcomere activator (CSA) for an initial time period, and subsequently administering to the subject a dose of the CSA based on the subject's plasma concentration of the CSA at the end of the initial time period.

The invention belongs to the field of traditional Chinese medicines, and particularly discloses a traditional Chinese medicine composition with an anti-depression effect, which is prepared from the following medicinal materials by weight: 6g of pericarpium citri reticulatae viride, 6g of pericarpium citri reticulatae, 6g of radix paeoniae alba, 6g of thunberg fritillary bulb, 4.5 g of rhizoma alismatis, 4.5 g of fried gardenia and 4.5 g of moutan bark. The composition regulates functions of hypothalamus-pituitary-adrenal axis (HPA axis) and repairs hippocampal neurons and relieves symptoms such as pleasant sensation loss and behavioral despair of depression patients by relieving qi stagnation, clearing heat, cooling blood, promoting diuresis and reducing phlegm. Experiments prove that the traditional Chinese medicine composition can remarkably improve the sweet water preference rate of depression rats, shorten the forced swimming immobility time, reduce the levels of CRH, ACTH and CORT of plasma and improve pathological injuries of hippocampus tissues. The composition adopts medicinal and edible medicinal materials, is small in side effect and high in safety, and can be prepared into an oral preparation for treating depression.

The invention relates to the technical field of traditional Chinese medicine research, in particular to a discovery method of a cough relieving and phlegm eliminating quality marker of cough relieving granules and the quality marker. According to the application, the cough-relieving and phlegm-eliminating drug effects of the cough-relieving granules are evaluated by virtue of concentrated ammonia water cough inducing and phenol red excretion tests, plasma pharmaceutical chemistry research of the cough-relieving granules is developed by virtue of a UHPLC-Q-Exactive Plus Orbitrap HRMS technology, and 26 prototype blood-entering components of the cough-relieving granules are analyzed and identified; through network pharmacological analysis of components entering blood, 11 potential active components for relieving cough and eliminating phlegm of the cough-relieving granules are screened, relate to 40 common targets such as IL6, TLR4, STAT3 and the like, and mainly participate in signal channels such as PI3K-Akt, HIF-1, EGFR (epidermal growth factor receptor) and the like; the seven prototype blood-entering components are quantitatively analyzed by utilizing pharmacokinetics. The three compounds of azelaic acid, caffeic acid and vanillin are used as the cough relieving and phlegm eliminating quality markers of the cough relieving granules through effectiveness, transitivity and testability. The research result is of great significance in deeply defining the pharmacodynamic material basis of the cough-relieving granules, optimizing the quality standard and promoting the clinical application of the cough-relieving granules.