Unlock instant, AI-driven research and patent intelligence for your innovation.

Method, reagent, primer and probe for quickly detecting Ebola viruses under constant-temperature and isothermal conditions

An Ebola virus, room temperature isothermal technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. Requires simple, regional and territorial effects

Inactive Publication Date: 2015-11-25
ZHEJIANG SHANCE HEQISHI BIO SCI& TECH CO LTD
View PDF1 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, RAA nucleic acid amplification technology has been used at home and abroad to establish new detection methods for some pathogenic microorganisms, such as dengue virus, Salmonella enterica, Mycobacterium tuberculosis and methicillin-resistant Staphylococcus aureus, etc. This technology was used in Ebola Virus detection has not yet been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method, reagent, primer and probe for quickly detecting Ebola viruses under constant-temperature and isothermal conditions
  • Method, reagent, primer and probe for quickly detecting Ebola viruses under constant-temperature and isothermal conditions
  • Method, reagent, primer and probe for quickly detecting Ebola viruses under constant-temperature and isothermal conditions

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048]Embodiment 1: Screening of primers

[0049] With reference to the 20 EBOVNP gene sequences published on GenBank, the inventors of the present application have carried out relatively in-depth research on information such as the genome, protein structure and function of the NP of EBOV, and the content of the NP gene in EBOV is relatively high. The present invention selects The NP gene of EBOV was used as the target gene. A large number of experiments have shown that different primers have a certain influence on the effect and sensitivity of isothermal amplification. Therefore, this study preliminarily designed three pairs of different primers for the NP gene of EBOV-Z subtype: NP-1, NP-2 and NP-3 (as shown in Table 1), and these sequences can be compared with EBOV-S subtype The corresponding sequence of the NP gene specifically binds.

[0050] Table 1: Sequences of primers and probes

[0051]

[0052] image 3 It is the electrophoresis pattern showing the influence ...

Embodiment 2

[0057] Example 2: Fluorescence reverse transcription RAA detection

[0058] This example is used to illustrate the normal temperature and constant temperature fluorescence reaction performed on the Twista instrument.

[0059] 1. According to the NP gene sequence of Ebola-Zaire virus (EBOV-Z) published on NCBI GenBank, the NP gene of Ebola-Zaire virus was synthesized from the whole gene.

[0060] 2. Based on the design principles of primers and fluorescent probes, a pair of primers (NP-3-F and NP-3-R) and a fluorescent probe (NP-Probe) were designed according to the sequence of the Ebola virus NP gene. As shown in table 2:

[0061] The sequences of the primers and probes of table 2 Ebola virus NP gene

[0062]

[0063]

[0064] *(F) is a fluorescent group (Fluorophore), (H) is a tetrahydrofuran site (THFresidue), (B) is a quencher group (Quencher), and the 3' end is modified by SpacerC3 (Biotin-TEG).

[0065] 3. The components of the freeze-dried powder reaction unit a...

Embodiment 3

[0074] Embodiment 3: Fluorescent reverse transcription RAA detects influenza A virus

[0075] This example is used to illustrate the feasibility of fluorescent reverse transcription RAA detection of actual samples.

[0076] 1. According to the gene sequence of the influenza A virus matrix protein published on NCBIGenBank, sequence homology analysis was performed to find a highly homologous gene sequence, as shown below:

[0077] 5’-ATGAGTCTTCTAACCGAGGTCGAAACGTATGTTCTCTCTATCGTTCCGTCAGGCCCCCTCAAAGCCGAGATAGCGCAGAGACTTGAAGATGTTTTTGCAGGGAAAAACACCGATCTTGAGGCACTCATGGAATGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTAAGGGGATTTTAGGATTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAGAATGCCCTCAATGGGAA-3’

[0078] 2. Based on the design principles of primers and fluorescent probes, a pair of primers (FluA-M-F and FluA-M-R) and a fluorescent probe (FluA-M-Probe) were designed according to the conserved sequence of the above-mentioned influenza A virus matrix protein. As shown in Table 5:

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a method, a reagent, a primer and a probe for quickly detecting Ebola viruses under constant-temperature and isothermal conditions. The method, the reagent, the primer and the probe have the advantages that the Ebola viruses can be quickly, sensitively and accurately detected by the aid of the method in real time under the constant-temperature and isothermal conditions, nucleic acid targets can be quickly detected in instruments with fluorescence detection functions under the combined actions of the specific primer, the specific fluorescence probe, six engineering enzymes and other chemical constituents, closed-tube detection can be guaranteed by strict experiment operation steps, and aerosol pollution can be effectively prevented; the method, the reagent, the primer and the probe are applicable to detecting the Ebola viruses by the aid of diversified fluorescence detection devices.

Description

technical field [0001] The invention is a new technology and application in the field of Ebola virus detection, and relates to a rapid, real-time and specific detection method for Ebola virus under normal temperature and isothermal conditions, which can be used for clinical detection in vitro, food It has broad application prospects in the fields of security, biosafety and agriculture. Background technique [0002] Ebola virus (EBOV) can cause an acute hemorrhagic, zoonotic infectious disease - Ebola hemorrhagic fever (Ebola hemorrhagic fever, EHF). The virus was first discovered in 1976 in the Ebola River area of ​​southern Sudan and the Democratic Republic of the Congo (formerly known as Zaire). It was named Ebola hemorrhagic fever because it caused systemic hemorrhagic symptoms in patients. EBOV belongs to the Filoviridae family and is a long filament, single-stranded negative-strand RNA virus with an envelope. The pure virion is composed of a helical ribose nucleocapsid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/6844C12Q1/70C12Q2521/507C12Q2521/101C12Q2522/101C12Q2563/107
Inventor 刘国宪曹伟周国辉程奇
Owner ZHEJIANG SHANCE HEQISHI BIO SCI& TECH CO LTD