Method, reagent, primer and probe for quickly detecting Ebola viruses under constant-temperature and isothermal conditions
An Ebola virus, room temperature isothermal technology, applied in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc. Requires simple, regional and territorial effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048]Embodiment 1: Screening of primers
[0049] With reference to the 20 EBOVNP gene sequences published on GenBank, the inventors of the present application have carried out relatively in-depth research on information such as the genome, protein structure and function of the NP of EBOV, and the content of the NP gene in EBOV is relatively high. The present invention selects The NP gene of EBOV was used as the target gene. A large number of experiments have shown that different primers have a certain influence on the effect and sensitivity of isothermal amplification. Therefore, this study preliminarily designed three pairs of different primers for the NP gene of EBOV-Z subtype: NP-1, NP-2 and NP-3 (as shown in Table 1), and these sequences can be compared with EBOV-S subtype The corresponding sequence of the NP gene specifically binds.
[0050] Table 1: Sequences of primers and probes
[0051]
[0052] image 3 It is the electrophoresis pattern showing the influence ...
Embodiment 2
[0057] Example 2: Fluorescence reverse transcription RAA detection
[0058] This example is used to illustrate the normal temperature and constant temperature fluorescence reaction performed on the Twista instrument.
[0059] 1. According to the NP gene sequence of Ebola-Zaire virus (EBOV-Z) published on NCBI GenBank, the NP gene of Ebola-Zaire virus was synthesized from the whole gene.
[0060] 2. Based on the design principles of primers and fluorescent probes, a pair of primers (NP-3-F and NP-3-R) and a fluorescent probe (NP-Probe) were designed according to the sequence of the Ebola virus NP gene. As shown in table 2:
[0061] The sequences of the primers and probes of table 2 Ebola virus NP gene
[0062]
[0063]
[0064] *(F) is a fluorescent group (Fluorophore), (H) is a tetrahydrofuran site (THFresidue), (B) is a quencher group (Quencher), and the 3' end is modified by SpacerC3 (Biotin-TEG).
[0065] 3. The components of the freeze-dried powder reaction unit a...
Embodiment 3
[0074] Embodiment 3: Fluorescent reverse transcription RAA detects influenza A virus
[0075] This example is used to illustrate the feasibility of fluorescent reverse transcription RAA detection of actual samples.
[0076] 1. According to the gene sequence of the influenza A virus matrix protein published on NCBIGenBank, sequence homology analysis was performed to find a highly homologous gene sequence, as shown below:
[0077] 5’-ATGAGTCTTCTAACCGAGGTCGAAACGTATGTTCTCTCTATCGTTCCGTCAGGCCCCCTCAAAGCCGAGATAGCGCAGAGACTTGAAGATGTTTTTGCAGGGAAAAACACCGATCTTGAGGCACTCATGGAATGGCTAAAGACAAGACCAATCCTGTCACCTCTGACTAAGGGGATTTTAGGATTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAGAATGCCCTCAATGGGAA-3’
[0078] 2. Based on the design principles of primers and fluorescent probes, a pair of primers (FluA-M-F and FluA-M-R) and a fluorescent probe (FluA-M-Probe) were designed according to the conserved sequence of the above-mentioned influenza A virus matrix protein. As shown in Table 5:
...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 