17beta-estradiol visualization detection method based on DNA nano-structure, and 17beta-estradiol visualization detection kit based on DNA nano-structure
A detection kit and nanostructure technology, applied in the field of analytical chemistry, can solve the problems of high detection cost, troublesome storage, limited wide application, etc., and achieve the effects of high sensitivity, simple operation and good specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] A 17β-estradiol visualization detection kit based on DNA nanostructure, which comprises the following components:
[0051] (1) DNA1:
[0052] 52*51*17β-estradiol nucleic acid aptamer
[0053] 5'-ATGGGT—CTCACT--ATGGGT--TCAACG—GCTTCCAGCTTATTGAATTACACGCAGAGGGTAGCGGCTCTGCGCATTCAATTGCTGCGCGCTGAAGCGCGGAAGC-3' (SEQ ID NO. 1)
[0054] The 5' or 3' end of the 17β-estradiol aptamer was extended to form DNA1, which included 5 units, 2* units, 5 units, 1* units and the 17β-estradiol aptamer region.
[0055] (2) DNA2:
[0056] 5'-ATTCAATAAGCTGGAAGCCGTTGA-3' (SEQ ID NO.2)
[0057]DNA2 is complementary to the 1* region of DNA1 and part of the 17β-estradiol aptamer region.
[0058] (3) Stem-loop DNA probe A:
[0059] 415*25*53*
[0060] 5'-TGGGTAGGGCGGGT--CGTTGA-ACCCAT--AGTGAG-ACCCAT-ATGGGT--CAAGAC--ATGGGT--CTCACT--ATGGGT-3' (SEQ ID NO. 3)
[0061] 52*5
[0062] Stem-loop DNA probe A comprises 4 units, 1 unit, 5* unit, 2 units, 5* units, 5 units, 3* units, 5 units, 2* units and...
Embodiment 2
[0089] Utilize the kit established in Example 1 to detect 17β-estradiol, the steps are as follows:
[0090] (1) First use Tris-HCl buffer (20mM, pH 7.4, containing 200mMNaCl and 50mMKCl) to dissolve DNA1, DNA2 and stem-loop DNA probes respectively;
[0091] (2) Mix 100 nM DNA1 and 400 nM DNA2, and react at room temperature for 20 minutes to form a DNA1-DNA2 mixture;
[0092] (3) Add the sample to be tested into the DNA1-DNA2 mixture, and react at room temperature for 45 minutes;
[0093] (4) Then add 1 μM stem-loop DNA probes A, B, and C, and react at room temperature for 60 minutes;
[0094] (5) Add 0.3 μM hemin (hemin) and react at room temperature for 30 minutes;
[0095] (6) Take 50 μL of the reaction solution and add it to 950 μL of chromogenic buffer (containing 26.6 mM citric acid, 51.4 mM disodium hydrogen phosphate, 25 mM KCl, 10 μL of 0.5% TMB, 20 μL of 30% H 2 o 2 , pH=5.0), reacted at room temperature for 15 minutes, and observed the color change;
[0096] If ...
Embodiment 3
[0098] Detection of different concentrations of 17β-estradiol:
[0099] Prepare 17β-estradiol standard solutions with concentrations of 100fM, 1pM, 10pM, 100pM and 1nM respectively, and store at room temperature.
[0100] 17β-estradiol solutions of different concentrations were added to the reaction system described in Example 1 respectively, and the experimental results were observed after sufficient reaction, such as figure 2 As shown, 100fM of 17β-estradiol can produce obvious blue color change, indicating that its detection limit is 100fM. As the concentration of 17β-estradiol increased, the color also increased and gradually became saturated.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 