Check patentability & draft patents in minutes with Patsnap Eureka AI!

Mercuric ion detection kit based on constant-temperature cascading nucleic acid amplification and detection method thereof

A mercury ion, cascade technology, applied in the biological field, can solve the problems of insufficient sensitivity, long time, complicated design, etc., and achieve the effect of improving sensitivity, wide application range and simple design.

Inactive Publication Date: 2016-01-20
XI AN JIAOTONG UNIV +1
View PDF4 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In order to overcome the defects in the above-mentioned prior art, the object of the present invention is to provide a mercury ion detection kit and its detection method based on constant temperature cascade nucleic acid amplification, so as to overcome the insufficient sensitivity, complicated design and long time-consuming of the prior art. shortcoming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mercuric ion detection kit based on constant-temperature cascading nucleic acid amplification and detection method thereof
  • Mercuric ion detection kit based on constant-temperature cascading nucleic acid amplification and detection method thereof
  • Mercuric ion detection kit based on constant-temperature cascading nucleic acid amplification and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The detection kit of the present embodiment comprises the following components:

[0030] (1) A DNA recognition element containing thymine that can specifically bind mercury ions: the last base at the 3' end of DNA is thymine, and its nucleotide sequence (5' to 3'):

[0031] TGAGGCTAGAGCGAGCTGAGGCTGTAATGGAAAAAACCATTT

[0032] After binding to mercury ions, it forms a 3' end complementary through intramolecular folding, forming a stem-loop structure that can be recognized by polymerase;

[0033] (2) Amplification substrate: including dNTPs mixture;

[0034] (3) Tool enzyme: DNA polymerase and nuclease nickase with strand displacement amplification activity, the DNA polymerase is KlenowFragment, and the nuclei nickase is Nt.BbvCI; used to trigger SDA to generate SDA products;

[0035] (4) Molecular beacon probe with a stem-loop structure: its two ends are respectively labeled with a fluorescent group and a quencher group. The molecular beacon probe has a sequence that ca...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a mercuric ion detection kit based on constant-temperature cascading nucleic acid amplification and a detection method thereof. Thymine-containing DNA identification elements are specifically bound with mercuric ions and then are folded to form an intra-molecular stem-loop structure; The 3' terminal of the DNA can be identified by polymerase, the DNA itself serves as a template to start strand displacement amplification reaction so as to produce a large amount of single-stranded DNA products; the single-stranded DNA products can open a restriction enzyme cutting site containing molecular beacon stem-loop structure to produce fluorescence signals; at the same time, the single-stranded DNA products can be also used as primers, and hybridization combined molecular beacons are used as templates to trigger secondary strand displacement amplification reaction, and released SDA products can form heteroduplexes with new molecular beacons so as to produce cascaded-amplified fluorescent signals. The detection method is high in sensitivity, ingeniously achieves cascading amplification of strand displacement amplification reaction without system complexity increase, is high in amplification efficiency and response speed and can achieve mercuric ion quantification within 30 minutes, and the detection limit is as low as 2 nM.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to the quantitative detection of mercury ions, in particular to a mercury ion detection kit based on constant temperature cascade nucleic acid amplification and a detection method thereof. technical background [0002] Heavy metal ions have high stability in the environment and are difficult to be degraded by microorganisms. Once they enter the environment, they are difficult to be repaired naturally, and can be continuously enriched and passed on in the ecosystem. Even a small amount of ingestion can cause great toxicity, which is a major threat to ecological balance and human health. As a typical representative of heavy metal ion pollution, the accumulation of mercury ions in biological tissues causes DNA damage, affects ligand-receptor interactions, destroys the immune system, and causes a series of diseases, such as brain damage, kidney failure, various cognition and movement disorder...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
CPCC12Q1/6844
Inventor 赵永席赵越袁慧刘华青白凯魏帅杨卫军王芳霞王亚玲
Owner XI AN JIAOTONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More