4521 results about "Nanotechnology" patented technology

The invention discloses a metal-doped carbon quantum dot as well as preparation and application of the metal-doped carbon quantum dot in a nano antibacterial agent, citric acid, urea and tea polyphenol are taken as precursors, metal salt is added, carbon dot synthesis and metal ion doping are synchronously completed in one step through a hydrothermal method, and the metal-doped carbon quantum dot is prepared; the surfaces of the metal-doped carbon quantum dots are negatively charged, and the metal-doped carbon quantum dots have peroxidase-like activity and catalase-like activity at the same time; the metal ions adopt any one of Fe < 3 + >, Cu < 2 + > and Ce < 3 + >; the metal-doped carbon quantum dots are in a sphere-like shape. The metal-doped carbon quantum dots prepared by the preparation method disclosed by the invention have peroxidase-like activity and catalase-like activity at the same time through precise doping of metal ions, and the two activities have a synergistic effect in an oral periodontitis microenvironment, so that a good antibacterial effect is achieved.

Development of resists are useful, for example, to form a patterning mask in the context of high-resolution patterning. Development can be accomplished using a halide-containing chemistry such as a hydrogen halide. A metal-containing resist film may be deposited on a semiconductor substrate using a dry or wet deposition technique. The resist film may be an EUV-sensitive organo-metal oxide or organo-metal-containing thin film resist. After exposure, the photopatterned metal-containing resist is developed using wet or dry development.

The invention discloses a supported nickel catalyst for preparing 1, 3-propylene glycol through hydrogenation of 3-hydroxypropionaldehyde as well as a preparation method and application of the supported nickel catalyst, and relates to the technical field of catalysts. The modified long-chain multi-carbon inducer is used, and a special long-chain molecular structure and a branched chain group of the inducer can effectively and selectively adsorb and occupy a micropore impregnation site; the preparation method has the beneficial effects that more active component nickel species are obviously promoted to be dispersed in main reaction confinement spaces such as mesopores and macropores and interact with the carrier to form effective active sites, and active component steeping liquor is inhibited from entering micropore channels due to capillary action; the active site failure caused by agglomeration of nickel species in micropores in the subsequent drying and roasting process of the catalyst precursor is avoided, the efficient and directional reaction is ensured, the generation of by-products is greatly reduced, the pressure is relieved for the subsequent product rectification separation, and the final product purity is improved. The catalyst provided by the invention can still keep an excellent catalytic effect when the air speed of a 3-hydroxypropionaldehyde solution is increased to 6.5 h <-1 >.

The invention relates to a three-dimensional spiral high-density neural electrode and a preparation method and application thereof. The three-dimensional spiral high-density neural electrode comprises a probe structure and a plurality of electrode sites. The probe structure is formed by curling a planar flexible electrode precursor, and at least one end of the probe structure is provided with a spiral outer surface of a three-dimensional spiral line structure. Electrode sites are distributed along a spiral path, have a size of 5-1000 [mu] m, and are used for contacting biological tissues. On the planar flexible electrode precursor, electrode sites are arranged on one or more straight lines forming an inclined angle alpha with the axial direction of the probe, and the spatial distribution is matched with the edge. Compared with the prior art, the method has the advantages that the constraint of a traditional wiring mode is broken through, the integration of high-density three-dimensional channels is realized under a micro size, and a new generation of solution is provided for a high-precision brain-computer interface, deep brain stimulation and a three-dimensional electroencephalogram.

The invention discloses a macrocyclic covalent organic polymer material for inhibiting a pi-pi stacking effect and application of the macrocyclic covalent organic polymer material, and belongs to the technical field of biological medicines. The preparation method comprises the following steps: adding 5, 10, 15, 20-tetra (4-ethynylphenyl) copper porphyrin and a macrocyclic monomer into an organic solvent in a protective atmosphere, and carrying out solvothermal reaction in the presence of a catalyst and alkali to obtain the macrocyclic covalent organic polymer material. According to the invention, 5, 10, 15, 20-tetra (4-ethynylphenyl) copper porphyrin and a macrocyclic monomer form a porous polymer MCP-CU-POP, the material utilizes the photo-thermal capability to combine the effects of simulated photo-thermal (PTT), photodynamic (PDT), peroxidase (PODs) and glutathione peroxidase (GSH-Px) to perform synergistic antibiosis, and the inherent characteristics of an infected microenvironment can also be utilized to induce death of bacteria, so that the antibacterial property of the material is greatly improved, and the antibacterial property of the material is greatly improved. And the microenvironment of the bacterial infection part can be adjusted, so that the recovery of the bacterial infection wound can be obviously accelerated.

Sheets of material used in medical devices and filters are disclosed. The sheets may include a fibrous mat including a plurality of microfibers. The microfibers may include a polymer matrix and a plurality of additive particles. The additive particles may include carbon material particles, therapeutic micro particles, and any combination thereof. Medical devices and filters that use the sheets are disclosed. Methods of producing the sheets are also disclosed.

Development of resists are useful, for example, to form a patterning mask in the context of high-resolution patterning. Development can be accomplished using a halide-containing chemistry such as a hydrogen halide. A metal-containing resist film may be deposited on a semiconductor substrate using a dry or wet deposition technique. The resist film may be an EUV-sensitive organo-metal oxide or organo-metal-containing thin film resist. After exposure, the photopatterned metal-containing resist is developed using wet or dry development.

Microparticles for detecting biological materials are provided. Each of the microparticles includes: a core-shell structured microparticle consisting of a core including a magnetically responsive metal and a shell layer surrounding the core and having a uniform thickness; and capture probes introduced onto the shell layer to capture biological materials.

The invention relates to the field of nano-enzymes, in particular to a nano-enzyme, a preparation method and a method for detecting glucose by using the nano-enzyme. The nano-enzyme comprises a carrier and platinum nano-particles coated on the surface of the carrier, and the carrier is oxidized nano-diamond particles with the particle size of 20-30 nm. The core structure of the nano-enzyme, namely a composite system of the carrier and the platinum nano-particles, is defined, the platinum nano-particles serve as a metal nano-material with excellent catalytic performance and are a core component for simulating peroxidase activity, the size of the oxidized nano-diamond carrier is controlled to be 20-30 nm, the dispersity of the material is guaranteed, and the catalytic activity of peroxidase is improved. And the catalytic efficiency of the composite system can be further improved through a size effect. According to the structural design, the problems of insufficient catalytic activity and poor stability of a single nano material are solved through the synergistic effect of the carrier and the load component, and a material foundation is laid for subsequent efficient glucose detection.

The invention relates to the technical field of membrane separation, in particular to a composite forward osmosis membrane based on mussel bionic interface enhancement and a preparation method thereof. The preparation method comprises the following steps: immersing a base material in a dopamine hydrochloride solution for oscillation reaction to obtain a modified base material; the surface of the modified base material is coated with a membrane casting solution in a blade coating mode, then phase inversion is carried out, the residual solvent is removed, then airing is carried out, and the composite forward osmosis membrane based on mussel bionic interface enhancement is obtained. By introducing the mussel bionic polydopamine intermediate layer, the long-standing technical contradictions of poor interfacial compatibility and weak binding force between the hydrophobic substrate and the hydrophilic separation layer are ingeniously solved, and the internal concentration polarization effect is remarkably inhibited. The prepared composite membrane has the advantages of high water flux, low salt reverse flux, stable structure and the like, and has wide application prospects in the fields of water treatment and substance separation.

The invention discloses an administration agent in-vivo release and absorption visualization method based on a CFD-PBM coupling model. The method comprises the following steps: constructing a CFD model of a physiological environment of an injection site; establishing a population balance model (PBM) of the drug particles; the PBM is embedded into a CFD model solver, multi-scale coupling simulation is carried out, and a CFD-PBM coupling model is obtained; the three-dimensional visualization engine dynamically displays drug concentration distribution and particle behaviors; reversely adjusting preparation prescription parameters by using a multi-parameter optimization algorithm; and calibrating model parameters, and generating a key data report. According to the method, the prediction precision and the research and development efficiency can be remarkably improved, and the method is suitable for development of long-acting preparations such as microspheres and implants.

The invention relates to the technical field of diamond material preparation, in particular to an integrated diamond growing and polishing method based on cluster beams and local substrate bias, which comprises the following steps: firstly, pretreating a diamond substrate, scanning by using an atomic force microscope to obtain a surface three-dimensional shape, determining concave and flat areas, and designing a local bias distribution map according to the concave and flat areas; applying large negative bias voltage to the concave area, applying small negative bias voltage to the flat area, generating a carbonaceous cluster beam with the size of 3-10 nanometers, guiding the carbonaceous cluster beam to the surface of the substrate, preferentially depositing high-energy clusters on the concave area and depositing low-energy clusters on the flat area under the effect of local bias voltage, and thus synchronously achieving integrated machining of diamond surface growing and polishing. The growth and polishing are integrated, the technological process is simplified, the machining time and cost are greatly reduced, and the production efficiency is improved.

The invention relates to a metallized microbubble and a preparation method thereof, a construction method of a multifunctional composite probe, and a rapid bacterium capturing and sterilizing method, and belongs to the technical field of functional material preparation. The method aims at solving the technical problems that in the prior art, a metal coating on the surface of the hollow glass microbubble is not uniform, combination is not firm, and stability is poor. According to the technical scheme, the method is characterized by comprising the following steps: mixing surface-activated hollow glass microbubbles with a polyethyleneimine solution for reaction, and washing and drying to obtain polyethyleneimine-coated hollow glass microbubbles; then reacting with a single-stranded DNA buffer solution to obtain an intermediate product loaded with DNA; then introducing a silver nitrate solution to load silver ions on the surface of the compound; and finally, reducing through a sodium borohydride solution to prepare the metallized microbubbles. The metalized microbubbles prepared by the method can be used for constructing a multifunctional composite probe to realize efficient capture and synergistic antibiosis of targets such as bacteria.

The present embodiments relate generally to systems and methods for measuring an analyte in a host. More particularly, the present embodiments provide sensor applicators and methods of use to insert the sensor into an individual's skin. Applicators are disclosed for inserting the sensor. Such applicators may be reusable applicators configured to implant multiple different sensors.

The invention provides a preparation method of an ADC foaming agent for improving foaming pore density, which comprises the following steps: step 1, mixing a modified inorganic nucleating agent with water according to a predetermined mass ratio, adding a dispersing agent, and uniformly mixing to prepare uniform and stable suspension slurry to prevent agglomeration of the nucleating agent; 2, when the conversion rate of the biurea reaches 80%-85%, adding the suspension slurry, so that the inorganic nucleating agent is uniformly attached to the surface of the ADC crystal; and 3, continuing the oxidation reaction until the biurea conversion rate reaches 92% or above, and then washing, centrifuging and drying to obtain the ADC foaming agent. The ADC foaming agent for improving the foaming pore density is prepared by the method. The inorganic nucleating agent is added in the stage of preparing the ADC foaming agent, and compared with the inorganic nucleating agent added in the subsequent foam material preparation process, the density of foaming pores can be remarkably improved.

The invention discloses a high-solid-content MIL-101 (Fe) / PIM-1 mixed matrix membrane and a preparation method thereof, and belongs to the technical field of gas separation membranes. The preparation method comprises the following steps: firstly, dissolving an iron source in a PIM-1 polymer solution to form a homogeneous membrane casting solution; forming the obtained membrane casting solution, and removing the solvent to obtain a PIM-1 / Fe (II) composite substrate containing Fe (III); then, the substrate is alternately immersed in a terephthalic acid methanol solution and a ferric salt methanol solution, and MIL-101 (Fe) is generated in the polymer matrix through in-situ limited crystallization by layer-by-layer limited crystallization. According to the method, the problem of interfacial compatibility between the MOF filler and the polymer matrix is effectively solved, and high loading capacity (up to 52.9 wt.%) of MIL-101 (Fe) is realized without agglomeration. Meanwhile, the membrane has excellent COplasticizing resistance and long-term operation stability, and has a wide application prospect in the fields of carbon capture and the like.

The invention relates to the technical field of flexible sensors, in particular to a gradient hierarchical porous structure flexible piezoresistive sensor and a preparation method thereof. The sensor is of a laminated structure and comprises an upper flexible packaging protection layer, a lower flexible packaging protection layer, a conductive fabric electrode and a middle piezoresistive sensing layer, and a limiting frame is arranged on the periphery of the sensor. The sensing layer is prepared by adopting a 3D printing ink direct writing technology, and adopted printing slurry takes silicone rubber as a matrix and is uniformly mixed with expanded conductive microspheres and conductive filler. The printing wires are stacked in order to form a macroscopic gradient porous network structure; after the expanded microspheres are subjected to in-situ foaming, micro closed pores are formed in the material, and a rough microstructure is constructed on the surface of the wire material, so that hierarchical multi-scale regulation and control of a conductive network are realized cooperatively, contact sites are increased remarkably, and the sensitivity of the sensor is further improved effectively. The flexible piezoresistive sensor prepared by the invention has the advantages of high sensitivity, wide pressure detection range and high linearity, and has the commercial values of simple preparation process, high repeatability, lower cost and the like.

This disclosure provides for devices, methods, and systems for generating a plurality of droplets within a collecting container at an extremely high rate (e.g., of at least 1 million droplets per minute, etc.), each of the plurality of droplets comprising an aqueous mixture for a digital analysis, wherein upon generation, the plurality of droplets is stabilized in position within a region of the collecting container. The inventions enable partitioning of samples for digital analyses at unprecedented rates, where readout of signals from targets within such partitions can still be achieved in accordance with various assays.

An article has a formed surface material. On at least a portion of the formed surface material is disposed an antimicrobial article having antimicrobial properties. This antimicrobial article has a non-electrically conductive substrate comprising first and second opposing surfaces; a catalytic ink disposed as a pattern on the first opposing surface; and a pattern of electrolessly plated copper metal disposed in registration with the catalytic ink pattern. The antimicrobial article provides antimicrobial properties when applied to the formed surface material that may be frequently touched, such as a touch screen, door handle, or other frequently touched surface. The antimicrobial article can inhibit or reduce the transmission of various microorganisms from one person to another.

The invention discloses a multi-modal sensory artificial synaptic device based on a framework material and a preparation method and application thereof. The artificial synaptic device comprises a substrate and a channel, wherein the channel is arranged on the surface of the substrate; the channel is an amorphous organic metal framework film which responds to light and gas stimulation; the metal electrode is arranged on the surface of the channel; the metal electrode comprises a source electrode and a drain electrode. Compared with the prior art, the framework material with excellent photoelectric response performance is adopted, and a novel artificial synapse device with multi-mode sensing ability is constructed by fully utilizing the regular pore structure, large specific surface area and good photoresponse characteristic of the MOF material. The two electrodes of the device are connected into electrical test equipment, the conductivity of the amorphous MOF thin film can be changed under the stimulation of optical pulse signals, and finally simulation based on photoresponse synaptic plasticity is achieved. The device is placed in different gas environments, and the conductivity of the MOF film can be changed by capturing and releasing target gas molecules through the porous characteristic of the amorphous MOF material, so that simulation based on gas response synaptic plasticity is realized.

A highly sealed invasive biosensing assembly and a biological information monitoring apparatus. The present invention relates to the technical field of biosensors. The highly sealed invasive biosensing assembly comprises a biosensor, and an electrode-protecting cover is snap-fitted to the lower part of the biosensor. A guide needle is snap-fitted into the biosensor, longitudinally penetrating the biosensor. The biosensor further comprises a sensing electrode and an electrode pressure plate. In a first state, the electrode pressure plate, the lower part of a needle guide seat, and the interior of the electrode-protecting cover form a first closed cavity. In a second state, the electrode-protecting cover is detached from the biosensor, so that at least part of the sensing electrode entering the first closed cavity and at least part of a needle body extend out of the first closed cavity. The invasive biosensing assembly and the biological information monitoring apparatus form a closed space inside the assembly and the apparatus by means of a snap structure and the positional relationship between components during assembly, thereby improving the hermeticity in the assembly and the apparatus, so that the assembly is in a sterile state before being implanted into a human body.

The invention provides an all-silicon molecular sieve confined Pt-based bimetallic catalyst and application thereof in preparation of propylene through propane dehydrogenation. The preparation method comprises the following steps: mixing a silicon source, a template agent, a Pt precursor, an auxiliary element Cu precursor and the like by adopting an in-situ synthesis method, synthesizing under a hydrothermal condition, washing, drying, roasting and reducing to obtain the Pt-based bimetallic molecular sieve catalyst. According to the present invention, the pure silicon molecular sieve Silicalite-1 (S-1) is adopted as the carrier, such that the good carrier characteristics of high thermal stability, low acidity, rich pore structure and the like are provided, and the silicon hydroxyl group (Si-OH) in the S-1 pore channel can further provide the metal species anchoring effect so as to easily disperse and limit the active site; and the Cu auxiliary agent improves the metallicity of Pt. The synergy of the two significantly improves the performance of propylene preparation by direct dehydrogenation of propane. The synthesized PtCu-coated S-1 catalyst is low in Pt loading capacity, Pt and Cu are highly dispersed, side reactions such as deep dehydrogenation of propylene can be inhibited, and good stability is achieved.

The invention discloses a nano flower-shaped covalent organic framework material as well as a preparation method, a device and application thereof, and belongs to the field of water treatment. An amino compound and an aldehyde group compound form a covalent organic framework structure with a specific flower-shaped structure under the action of a catalyst and a regulating agent, the covalent organic framework structure continues to react with a carboxyl compound, then metal is loaded, and the nano flower-shaped covalent organic framework material is obtained. Carboxyl in the carboxyl compound responds to uranium in water and does not respond to other metal ions, other interference ions are eliminated, in addition, the carboxyl compound further has sulfydryl which can fix subsequently-loaded metal ions, the loading capacity of the metal ions is improved, and the metal ions can be loaded on the surface of the metal ions in the surface of the surface of the surface of the surface of the surface of the surface of the surface of the surface of the surface of the surface of the surface of the surface of the surface. When the nano flower-shaped covalent organic framework material prepared by the method is used for treating water, uranium ions can quickly reach adsorption sites, and the material as an adsorbent is higher in stability and higher in adsorption selectivity.

The invention discloses a shape memory polymer micro-nano column array preparation method based on femtosecond laser processing, and belongs to the technical field of bionic adhesive materials. According to the method, an epoxy resin type shape memory polymer serves as a matrix, an anodic aluminum oxide template and a femtosecond laser micromachining technology are combined, a nano-column array is formed through AAO template copying, then a micron-column array is formed on the surface of the template through femtosecond laser machining, and finally the micron-nano composite column array with the gecko foot imitating structure is obtained. The method has the advantages of being high in machining precision, high in structural controllability, simple in process, capable of achieving large-area preparation and the like, and is suitable for material preparation in the fields of bionic adhesion, micro-nano sensing, intelligent surfaces and the like.

The invention discloses composite hydrogel bio-ink with a function of space-time delivery of double growth factors as well as a preparation method and application of the composite hydrogel bio-ink, and belongs to the technical field of biomedical materials and tissue engineering. According to the preparation method, imidazolyl-modified methacrylated gelatin and double-bonded PF127 are compounded, and meanwhile, free vascular endothelial growth factors and connective tissue growth factor-loaded PLGA microspheres are entrapped in a system, so that the bio-ink with excellent printability, high adhesion, swelling resistance and space-time delivery function is formed; the bio-ink physically has the advantages of high printing fidelity, low swelling property, high mechanical strength and strong tissue adhesion of a synthetic material; in biology, the system can be used as an intelligent carrier to realize programmed space-time delivery of various growth factors, so that complex cell biological behaviors are accurately arranged, and real regeneration of functional tissues is guided.

The invention is applicable to the technical field of virus detection, and provides a norovirus detection kit based on a photo-thermal isothermal amplification technology and a detection method, the norovirus detection kit comprises a nucleic acid amplification chamber, the nucleic acid amplification chamber is provided with reaction micropores for nucleic acid amplification; an RT-PRA system, a CRISPR-cas12a system, a blank control and a positive control are placed in the reaction micropore, the RT-PRA system comprises RT-PRA solutions R1-R5, and the CRISPR-cas12a system comprises CRISPR-Cas12a solutions C1-C3; and the photo-thermal film covers the nucleic acid amplification chamber and is used for converting sunlight into heat energy and radiating the heat energy to liquid in the reaction micropores so as to provide reaction temperature for nucleic acid amplification. According to the invention, the portable, rapid and accurate detection of norovirus infection can be realized, the detection cost can be effectively reduced, the application scene is wide, workers can be helped to deduce the virus transmission path, and key support is provided for investigation and analysis of norovirus epidemic situations.

The application provides application of SEBS in implanting a biological electrode base. The biological electrode based on the SEBS base can be implanted in biological tissues, and is used for continuously or discontinuously analyzing physiological parameters of the biological body. Compared with other flexible bases, the SEBS base has the characteristics of being thinner and more flexible, can reduce the interference of body movement on the electrical signal, reduce the volume range of the implanted tissue and reduce the inflammatory reaction, thereby improving the measurement accuracy and long-term stability, is expected to meet more implantation site requirements when used for implanting a sensor, and has a good application prospect.

The invention discloses a Ce-doped CoP / NiCoP-coated NM self-supporting structure electrode and a preparation method and application thereof, the electrode takes a pretreated nickel net as a conductive substrate, a two-step method combining pulse electrodeposition and constant potential deposition is adopted, a compact NiCoP bottom layer and a Ce-doped CoP outer layer are constructed in sequence, and a CoP / NiCoP heterojunction structure with a three-dimensional coralline open morphology is formed. The method is mild in process, green, simple and convenient, and a traditional high-temperature phosphating step is abandoned. The prepared self-supporting electrode combines the charge regulation advantage of a heterojunction interface, the Ce-doped electronic structure optimization effect and the mass transfer advantage of a three-dimensional porous structure, so that the self-supporting electrode has extremely high hydrogen evolution catalytic activity, strong bonding force with a substrate and excellent long-period operation stability.

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.

The invention discloses an internal-acid and external-alkali type organic-inorganic hybrid molecular sieve catalyst as well as a preparation method and application thereof, and belongs to the technical field of heterogeneous catalytic materials and chemical processes. According to the catalyst, a hydrogen type Beta molecular sieve is used as an acidic inner core, polyvinylpyrrolidone (PVP) is used as an organic shell, and a unique inner-acid outer-alkali structure is formed. The preparation method comprises the following steps: hydrothermally synthesizing a hydrogen type Beta molecular sieve with a specific silica-alumina ratio, and then coating PVP through surface adsorption. The catalyst is used for catalyzing the condensation of methylal and trioxymethylene under mild conditions (40-70 DEG C and normal pressure) to prepare polyoxymethylene dimethyl ethers (DMMn). The PVP shell covers acidic sites on the outer surface of the molecular sieve to form an external neutral / weak base and internal strong acid microenvironment, so that the secondary side reaction of the product is effectively inhibited, the trioxymethylene conversion rate of more than 98% and the DMMn selectivity of more than 96% can be obtained in the reaction at 50 DEG C and normal pressure, the product distribution can be regulated and controlled, and the traditional Anderson-Schulz-Flory distribution limitation is broken through. The catalyst disclosed by the invention has the advantages of high activity, high selectivity, mild conditions and easiness in separation, and has a good industrial application prospect.