Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

219 results about "Panax japonicus" patented technology

Panax japonicus is a PERENNIAL growing to 0.6 m (2ft). The species is hermaphrodite (has both male and female organs) Suitable for: light (sandy), medium (loamy) and heavy (clay) soils. Suitable pH: acid, neutral and basic (alkaline) soils.

Application of panax japonicus transcription factor gene PjWRKY1

The invention discloses application of panax japonicus transcription factor gene PjWRKY1, namely, application in improving the expression quantity of key enzyme genes in the biological synthesis of panax japonicus saponins, and increasing the content of saponins in panax japonicus callus. The nucleotide sequence of the PjWRKY1 gene is shown as SEQ ID NO: 1, and WRKY transcription factors are coded. Through the adoption of functional genomics and techniques related to metabolic engineering, a panax japonicus PjWRKY1 transcription factor is proved to have the effect of positively regulating the biological synthesis of panax japonicus saponins; when the panax japonicus PjWRKY1 transcription factor gene disclosed by the invention is established on a plant expression vector and transferred into the panax japonicus callus for over expression, the expression quantity of the key enzyme genes in the synthetic route of panax japonicus saponins is increased, and the yield of panax japonicus saponins is increased.
Owner:KUNMING UNIV OF SCI & TECH

Ginseng identification method and special kit

The invention discloses a ginseng identification method and a special kit. The method comprises the steps: a) extracting genomes DNA as templates from a to-be-tested sample and utilizing primers (sequence 1 and sequence 2) to perform PCR (Polymerase Chain Reaction) amplification; b) adding a fluorescent dye SYBR Green I to the amplified reaction system and determining whether the to-be-tested sample contains ginsengs according to the following methods; if green fluorescence is observed in the reaction system, the to-be-tested sample or the candidate product contains ginsengs; if no green fluorescence is observed in the reaction system, the to-be-tested sample or the candidate product does not contain ginsengs. The experimental results show that the rapid and accurate identification of ginsengs, American ginsengs, pseudo-ginsengs, panax japonicus, rhizoma panacis majoris and bipinnatifid ginseng rhizome can be realized by the method provided by the invention; the fluorescent dye method is introduced to detect true or false identification results and technical supports are provided to realize onsite application of identification of medicinal molecules.
Owner:INST OF CHINESE MATERIA MEDICA CHINA ACAD OF CHINESE MEDICAL SCI

Application of panax japonicus transcription factor gene PjERF1

The invention discloses application of panax japonicus transcription factor gene PjERF1, namely, application in improving the expression quantity of key enzyme genes in the biological synthesis of panax japonicus saponins, and increasing the content of saponins in panax japonicus callus. The nucleotide sequence of the PjERF1 gene is shown as SEQ ID NO: 1, and AP2 / ERF transcription factors are coded. Through the adoption of functional genomics and techniques related to metabolic engineering, a panax japonicus PjERF1 transcription factor is proved to have the effect of positively regulating the biological synthesis of panax japonicus saponins; when the panax japonicus PjERF1 transcription factor gene disclosed by the invention is established on a plant expression vector and transferred into the panax japonicus callus for over expression, the expression quantity of the key enzyme genes in the synthetic route of panax japonicus saponins is increased, and the yield of panax japonicus saponins is increased.
Owner:KUNMING UNIV OF SCI & TECH

Panax japonicus polysaccharides, preparation method and use thereof

The invention discloses panax japonicus polysaccharide.The main chain structure thereof is Beta-D-1 to 3-mannan and / or Alpha-D-3 to 4-mannan and heterosaccharide containing galactan, xylan and glucan, the weight-average molecular weight of the panax japonicus polysaccharide is 5,000 to 2,000,000, the intrinsic viscosity at 25 DEG C is 1 to 100ml / g, and the mole ratio of the three elements of C: H: O is 1: 2: 1. The preparation of the panax japonicus polysaccharide comprises the following steps: after being dried, smashed and skimmed, the panax japonicus is soaked by water under the normal temperature and is stirred for separation, the residue is extracted by high-pressure hot water, further extracted by alkali and reductive salt, and finally extracted by acid, and the panax japonicus polysaccharide which can be dissolved in water and DMSO and not be dissolved in methanol, ethanol and acetone is obtained by separation, neutralization by taking the solution, dehydration, protein removal, decolorization, desalination and drying. The panax japonicus polysaccharide which is prepared by the invention has higher anti-tumor activity and promotion of immune activity, which can be used for preparing drugs or health care products for improving immune function and anti-tumor. The method for preparing the product is simple and easy to operation, and the sources of the needed raw materials are wide.
Owner:WUHAN UNIV

Composition for strengthening immune regulation function in human body and applications thereof

The invention relates to a composition for strengthening an immune regulation function in a human body and applications thereof. The composition comprises effective components of panax japonicus saponin and panax japonicus polysaccharide or the effective components and an acceptable carrier on a health medicament, health food, health tea, health wine or a beverage. The composition has the function of improving the immune function of an immunocompromised mouse. In an animal model with a weak immune system caused by cyclophosphamide (Cy), the composition can enhance the spleen index of the immunocompromised mouse, enhance the proportions of CD<4+> to CD<8+> and B lymphocytes to NK cells, and increase the content of cell factors IL-2 and IFN-gamma. The composition enhances the medicament effect and the medical value of panax japonicus; therefore, the planting of medicinal materials and the development of medicaments can be promoted. The composition has better social and economic benefits.
Owner:CHINA THREE GORGES UNIV

Traditional Chinese medicine immunopotentiator for enhancing immune function of broiler chickens during growth

The invention provides a traditional Chinese medicine immunopotentiator for enhancing an immune function of broiler chickens during growth. The immunopotentiator comprises crude medicines such as aleppo avens, panax japonicus, platycodon grandiflorum, pokeberry roots, fructus psoraleae, hawthorn fruits, Chinese yams, honeysuckle, sargentgloryvine stems, fructus cnidii, artemisia apiacea, bighead atractylodes rhizome, cinnamon, sealwort, wolfberries, radix glehniae, angelica sinensis, isatis roots, mistletoe, polygonum multiflorum, herba fibraureae recisae, thlaspi arvense, gynostemma pentaphylla and liquorice. The traditional Chinese medicine immunopotentiator has functions of increasing weight and promoting growth of the broiler chickens, has a function of promoting the immune function, can enhance the organism immunity, can improve the anti-bacterial and anti-virus capability and can improve the meat quality. The traditional Chinese medicine immunopotentiator plays an important role in adjusting immune organs, immune cells and the specific immune function of the broiler chickens and can effectively reduce drug residues and pathogenic microorganism residues of animal products.
Owner:广西万寿谷投资集团股份有限公司

Method for extracting and separating panax japonicus saponin and polysaccharide

The invention relates to a method for extracting and separating panax japonicus saponin and polysaccharide from the panax japonicus, which comprises the following steps of: extracting the panax japonicus; adjusting a pH value; performing foam separation; and purifying panax japonicus polysaccharide. The method has the advantages of high separating efficiency, high purity, large extraction volume, low energy consumption, simple device, low cost, no introduction of an organic solvent pollutant, no damage to the structure of the panax japonicus saponin and the like. A surfactant is not necessary to add in the foam extraction process, so the problems of recovery of the surfactant and the pollution caused by the recovery are solved.
Owner:CHINA THREE GORGES UNIV

Method for gaining panax japonicus secondary metabolite by using panax japonicus cell culture and biological transformation technique

The invention discloses a method by using panax japonicus cell culture and biological transfer technology to obtain secondary metabolites and pertains to plant cell culture engineering field. An improved RW culture medium is added with crane sugar, plant growth hormone and cytokinin and then coagulant; the obtained mixture is made into an induction culture medium after being disinfected in high temperature and then cooled; explants of panax japonicus are inoculated in the induction culture medium under an aseptic condition to be inducted to form callus; after an expansion, a plurality of cells are obtained; the expanded callus in the synthetic medium is inoculated into synthetic culture solution and then panax japonicus saponin crude extracts and byproducts thereof can be obtained through the extraction of cells from the solvent, thereafter the panax japonicus saponin, panax japonicus polysaccharide and other compounds can be obtained through purification. By adopting the method of the invention, secondary metabolites of the panax japonicus can be produced with low cost, short culture cycle, year-round production and no natural environmental limit.
Owner:TSINGHUA UNIV

Panax japonicus total saponins preparation and its applications in medicament for curing myocardial ischemia

The invention relates to a preparation method of total rhizoma panacis japonica saponins and the application thereof in the medicine for treating myocardial ischemia. Coarse powder of panax japonicus medicinal material is obtained, and coarse sizing ethanol solution is added in to dip in; the solution is extracted after being heated and refluxed, and the extracting solution is merged; the solution is decompressed to recover solvent until no odor of ethanol exists; the solvent is dilluted with water and is let stand, and the solution is centrifugated to obtain supernatant fluid; the supernatant fluid is extracted by using normal butanol containing water in an equivalent way, and the extract liquid is merged; the merged extract liquid is decompressed to recover the solvent until no normal butanol is distilled; thick extract is fully dissolved by using the ethanol solution of 85 percent, and acetone is added in slowly and the stirring is performed at the same time; then the solution is let stand under a normal temperature to lead the precipitate to be fully separated and is centrifugated, the precipitate is collected and is washed by the acetone, and the total rhizoma panacis japonica saponins is obtained after being dried. The invention can simply and effectively extract the total rhizoma panacis japonica saponins from the panax japonicus, the maximum metastasis rate of the total rhizoma panacis japonica saponins can reach 97.81 percent to show that the extraction technology is more stable and reliable, and the extraction rate is higher; the medicine which is obtained by utilizing the total rhizoma panacis japonica saponins as a main constituent has better curative effect for treating the myocardial ischemia.
Owner:CHINA THREE GORGES UNIV

Composition having physiological activity and production method thereof

InactiveUS6953580B2Complete curingOptimizationBiocideKetone active ingredientsPunicaWisteria floribunda
The present invention provides a composition containing an extract from Wisteria floribunda, Myristica fragrans, Punica granatum, Trapa bispinosa or a derivative thereof, Coix lachiryma-jobi, Elfvingia applanata and Ganoderma lucidum or a derivative thereof (optionally further containing Panax ginseng or Panax japonicus), which has a superior antiviral activity, a superior peripheral blood flow-improving activity and a superior hair growth-stimulating activity, and a production method thereof.
Owner:NITTO DENKO CORP

Method for preparing panax japonicus saponin IVa and application of panax japonicus saponin IVa in preparing a medicament for protecting liver and lowering transaminase

The invention discloses a method for preparing panax japonicus saponin IVa and an application of panax japonicus saponin IVa in preparing a medicament for protecting liver and lowering transaminase. The preparation method mainly comprises the following steps: crushing panax japonicus saponin IVa bulk pharmaceutical chemicals, extracting with water or a hydrophilic organic solvent, filtering and concentrating extract; passing the concentrated solution through a macroporous adsorption resin column chromatography column so as to enrich total saponin, eluting with water and an alcohol-water mixedliquid in turn, collecting the alcohol-water eluent, performing reduced pressure concentration at a low temperature, and drying to obtain the total saponin; and carrying out chromatograph separation on the total saponin, eluting with a solvent, recovering the solvent at reduced pressure, and drying so as to obtain crude panax japonicus saponin IVa; and repeatedly recrystallizing the crude productwith an organic solvent so as to obtain pure panax japonicus saponin IVa. According to verification, the panax japonicus saponin IVa has bioactivity of protecting liver and lowering transaminase, andcan be mixed with one or more of pharmaceutically acceptable carriers / auxiliary materials so as to be prepared into solid and liquid oral preparations with effects of protecting liver and lowering transaminase.
Owner:SHAANXI UNIV OF CHINESE MEDICINE

Micro-ecological synbiotic Chinese herbal medicine feed addictive, preparation method and application thereof

The invention relates to a micro-ecological synbiotic Chinese herbal medicine feed addictive, comprising a micro-ecological synbiotic feed addictive and a Chinese herbal medicine additive, wherein the micro-ecological synbiotic feed addictive comprises micro-ecological probiotics and oligosaccharide, the micro-ecological probiotics is a lactic acid bacillus preparation, and the oligosaccharide isone or more of fructo-oligo saccharide, xylo oligosaccharide, isomaltose oligosaccharide and soybean oligosaccharide, the weight of the micro-ecological synbiotic feed addictive accounts for 25-75 % of that of the total weight of the micro-ecological synbiotic Chinese herbal medicine feed addictive, and the Chinese herbal medicine additive comprises the following ingredients by weight parts: malt, pericarpium citri reticulatae viride, dried orange peel, rhizoma atractylodis, medicated leaven, coke hawthorn, coke gardenia, Chinese medical stone, folium artemisiae argyi, eucommia, dichroae radix, and panax japonicus. Separate application of the additive can raise animal culture production efficiency, reduce feeding cost, enhance the immunity and anti-stress capability of animals, and reduceincidence of diseases. Combined application of the additive and the Chinese herbal medicine additive has significant synergism.
Owner:山东施得维特生物工程有限公司

Leaves extract of panax sp., a process of making the same and uses thereof

The present invention relates to a composition for improvement of exercise performance, fatigue recovery or prevention of oxidation response comprising Panax species plant leaves extract or processed product of the leaves extract, or mixture of the both as an active ingredient. The present composition comprising Panax species plant leaves extract or processed product of the leaves extract, or mixture of the both increases the exercise performance, inhibit the accumulation of fatigue markers in blood and prevents oxidation response, and thus is useful to improve physical strength and exercise capacity.
Owner:株式会社优力竟

Process for gathering and purifying panax japonicus total saponins by using D101 macroporous absorption resin

The invention provides a process for gathering and purifying panax japonicus total saponins by using D101 macroporous absorption resin, which comprises the steps of: concentrating an extract of panax japonicus total saponins to 25.93mg / ml; filling a column with 95% ethanol by a wet method, wherein the diameter of the column is 15mm and the height of the column is 2220mm; balancing the volume of the column with distilled water to 33.5ml; absorbing 35 ml of 25.93mg / ml panax japonicus total saponin solution on the column at the speed of 1.85 multiplied column volume / hour; after absorbing in static state for 1 hour, absorbing once again; eluting with distilled water till liquid flowing out from the column has no purple ring reaction; eluting the column with 50% ethanol with 17.11 multiplied column volume; recovering eluent, concentrating and drying the recovered eluent to obtain the product of the panax japonicus total saponins. Through test, the purity of the panax japonicus total saponins reaches 98.02% and the recovery rate reaches above 96.5%. Proved by experiments, the in vitro antioxidation effects of purified panax japonicus total saponins with different concentrations are all higher than that of unpurified panax japonicus total saponins, which shows that the gathering and purifying of the panax japonicus total saponins facilitates the improvement of the antioxidation activity of the panax japonicus total saponins.
Owner:FARM PROD PROCESSING & NUCLEAR AGRI TECH INST HUBEI ACAD OF AGRI SCI

Panax japonicus var.major seedling method and culture method

The invention relates to a Panax japonicus var.major seedling method and culture method; the method can realize mutual promotion and cooperation of various special technical means, thus obviously improving seed germination rate and seedling emergency percentage, and greatly reducing seedling time; in the culture method, specific fertilizers are used so as to obviously improve transplanted survival rate and final yield; the Panax japonicus var.major seedling method and culture method can provide excellent application prospect and promotion potential in the Panax japonicus var.major planting field.
Owner:LIJIANG ZHICHENG BIOLOGICAL TECH CO LTD

Umbilical cord mesenchymal stem cell injection liquid, preparation method and application thereof

The invention relates to the technical field of stem cells and especially relates to an umbilical cord mesenchymal stem cell injection liquid, a preparation method and an application thereof. The injection liquid comprises umbilical cord mesenchymal stem cells, human albumin, low molecular heparin calcium, vitamin C, panax japonicus majoris saponin and a solvent. The injection liquid is prepared from the umbilical cord mesenchymal stem cells, so that the materials are convenient to obtain and the method does not violate ethical issue. The injection liquid can effectively prolong preservative time of the cells and the preserved stem cells have high activity, so that the injection liquid is convenient to use. After refusion, the injection can promote differentiation and maturation of the mesenchymal stem cell to liver cells, thus reducing incidence rate of GVHD.
Owner:GUANGZHOU SALIAI STEMCELL SCI & TECH CO LTD

Method for acquiring secondary metabolites including panax japonicus saponins and the like with large-scale culture and bioconversion technology for panax japonicus cells

The invention relates to the field of plant cell culture and provides a method for acquiring secondary metabolites including panax japonicus saponins and the like with large-scale culture and a bioconversion technology for panax japonicus cells. The method comprises steps as follows: (1), auxins, cytokinins and a coagulator are added to an RW culture medium; (2), explant surface of panax japonicas is sterilized and callus is formed through induction; (3), the callus of the panax japonicas is subjected to subculture, and loose cell clusters are obtained; (4), a culture solution is prepared; (5), the loose cell clusters are transferred into the culture solution for culturing; (6), high-yield cell strains are cultured and screened; (7), the high-yield cell strains are subjected to multiplication culture; (8), a synthetic medium is prepared; (9), cells are continuously cultured in the synthetic medium, and bioconversion is completed; (10), purification is performed after extraction with a solvent. With the adoption of the method, the secondary metabolites of the panax japonicas can be produced, the production cost is low, the culture period is short, the method is not limited by natural environment, and annual production can be realized.
Owner:郭志刚 +1

Panax japonicas beta-amyrin synthase gene and application thereof

The invention discloses a panax japonicas beta-amyrin synthase gene and an application thereof. The panax japonicas beta-amyrin synthase gene is obtained by using a positive primer P1:5'ATGTGGAAGCTTAAGATAGCGGA3' and a reverse primer P2:5'TTAGGTGCCAAGGGACGGTGAT3', and taking a panax japonicas cDNA library as a template to amplify; the sequence of the panax japonicas beta-amyrin synthase gene is as shown in SEQIDNO.1. The panax japonicas beta-amyrin synthase gene is introduced into the panax japonicas by agrobacterium-mediated genetic transformation, so that the content of oleanane type saponin in the panax japonicas is increased.
Owner:黄璐琦 +11

Chinese herbal medicine extracting solution capable of preventing hair loss and holding hair, and preparation method and application of Chinese herbal medicine extracting solution

The invention discloses a Chinese herbal medicine extracting solution capable of preventing hair loss and holding hair. The Chinese herbal medicine extracting solution is prepared from the following ingredients in parts by weight: 30-50 parts of angelica sinensis, 45-70 parts of the root of three-nerved spicebush, 15-37 parts of crocus sativus, 15-50 parts of panax japonicus, 30-66 parts of garden nasturtium, 45-70 parts of polygonum multiflorum, and 50-90 parts of ligusticum wallichii. The Chinese herbal medicine extracting solution capable of preventing hair loss and holding hair can induce the hair, promote the hair growth, promote the hair follicle cell proliferation, prevent hair loss and hold the hair. The invention further discloses a preparation method of the Chinese herbal medicine extracting solution capable of preventing hair loss and holding hair, and the method is less in step, simple in procedure, safe in operation and low in cost. The invention further discloses a hair-growing cream and a preparation method thereof. The hair-growing cream is capable of effectively downward permeating from the healthy hair follicle of the hair to activate nearby necrotic hair follicle cells, thereby achieving the effect of growing new hair.
Owner:广州立恒化学科技有限公司

Application of panax japonicus transcription factor gene PjbHLH1

The invention discloses application of panax japonicus transcription factor gene PjbHLH1, namely, application in improving the expression quantity of key enzyme genes in the biological synthesis of panax japonicus saponins, and increasing the content of saponins in panax japonicus callus. The nucleotide sequence of the PjbHLH1 gene is shown as SEQ ID NO: 1, and bHLH transcription factors are coded. Through the adoption of functional genomics and techniques related to metabolic engineering, a panax japonicus PjbHLH1 transcription factor is proved to have the effect of positively regulating the biological synthesis of panax japonicus saponins; when the panax japonicus PjbHLH1 transcription factor gene disclosed by the invention is established on a plant expression vector and transferred into the panax japonicus callus for over expression, the expression quantity of the key enzyme genes in the synthetic route of panax japonicus saponins is increased, and the yield of panax japonicus saponins is increased.
Owner:KUNMING UNIV OF SCI & TECH

Panax japonicus var. major glycosyl transferase UGTPjm1 gene and application thereof in preparing ginsenoside Ro

The present invention discloses a panax japonicus var. major glycosyl transferase UGTPjm1 gene and an application thereof in preparing ginsenoside Ro. A nucleotide sequence of the panax japonicus var.major glycosyl transferase UGTPjm1 gene is represented by SEQ ID NO:1. Panax japonicus saponin IVa and a glycosyl donor UDP-glucose are used as raw materials and a glucuronic acid group at a C3 position of the panax japonicus saponin IVa is once further glycosylated to form the ginsenoside Ro catalyzed by panax japonicus var. major glycosyl transferase encoded by the panax japonicus var. major glycosyl transferase UGTPjm1 gene. The biosynthesis regulation gene UGTPjm1 of the ginsenoside Ro is first identified and successfully verified. By synthesizing the ginsenoside Ro in vitro, management is more convenient, controllability is strong, demand for raw material planting can be reduced, agricultural land is saved, a production product is single, and separation and purification of the ginsenoside Ro in a late stage are facilitated. The panax japonicus var. major glycosyl transferase UGTPjm1 gene is used as a key gene for the biosynthesis of the ginsenoside Ro and can also be used for breeding studies of panax japonicus var. major and other plants.
Owner:YUNNAN AGRICULTURAL UNIVERSITY

Panax japonicus glycosyltransferase UGTPjm2 and application thereof to preparation of panax japonicus sapinogenin IVa

The invention discloses panax japonicus glycosyltransferase UGTPjm2 and an application thereof to preparation of panax japonicus sapinogenin IVa. The panax japonicus glycosyltransferase UGTPjm2 has anamino acid sequence as shown in SEQ ID No.1. The panax japonicus glycosyltransferase UGTPjm2 disclosed by the invention can catalyze glycosylation of C-28 site carboxyl groups of oleanolic acid-3-O-beta-glucuronide, and further, the panax japonicus sapinogenin IVa is generated. An important way is provided for artificial production of the panax japonicus sapinogenin IVa.
Owner:YUNNAN AGRICULTURAL UNIVERSITY

Organic fertilizer applicable to culturing of ginseng in farmlands and preparation method of organic fertilizer

The invention provides an organic fertilizer applicable to culturing of ginseng in farmlands and a preparation method of the organic fertilizer. According to the preparation method of the organic fertilizer, organic matters can be adequately decomposed, the transformation of the organic matters can be promoted, and available nutrients of the organic matters can be increased; secondly, the total amount of beneficial microorganisms of leavenings is greatly increased, and the number of harmful bacteria is greatly decreased; besides, the zymolysis of half-mature composts and livestock manures can be promoted, the fertilizer efficiency is improved, and the content of available nutrients of general composts prepared from same raw materials is increased by 20%-30%; finally, by adding nutrient substances such as humic acid according to the nutrient proportion of a basic organic fertilizer, the indexes of the prepared organic fertilizer can meet requirements of the culturing of ginseng in farmlands to soil, and the organic fertilizer is especially applicable to the culturing of ginseng in the farmlands.
Owner:SHANGHAI CHUANGBO ECOLOGICAL ENG

Panax japonicus saponin as well as preparation method and application thereof

The invention relates to panax japonicus saponin used as a vaccine adjuvant as well as a preparation method and application thereof. The method comprises the following steps: extraction of the panax japonicus, extraction separation, resin adsorption and the like. The panax japonicus saponin is further separated and purified, the weaknesses of the traditional method that only the total saponins component is used and the main components of the samponin is not studied can be overcome, so that the problem that the drug ingredients are not known by people can be solved; an active part of the panax japonicus saponin has an obvious immunity adjuvant effect, and a way for developing the vaccine adjuvant is provided.
Owner:湖北森元药业有限公司

Chikusetsusaponin IVa, derivatives thereof, preparation method thereof and application thereof to preparation of medicines

InactiveCN103524593AOrganic active ingredientsSugar derivativesChikusetsusaponin IVaDiabrezide
The invention relates to the technical field of medicines and in particular relates to a triterpenoid saponin compound chikusetsusaponin IVa separated from panax japonicus, derivatives and a preparation method thereof, a medicine composition containing the same and new medical application thereof to preparation of medicines for treating diabetes mellitus II. Biological activity tests show that the compound and the derivatives thereof have significant insulin sensitization activity, and can be used for preparing the medicines for treating diabetes mellitus II and complications which are caused by the diabetes mellitus II.
Owner:KUNMING INST OF BOTANY - CHINESE ACAD OF SCI

Biological soil conditioner for cultivation of ginseng

The invention relates to a biological soil conditioner for cultivation of ginseng. The conditioner is characterized in that the conditioner comprises the following raw materials in parts by weight: 50-70 parts of corn straw, 20-30 parts of bean cakes, 5-10 parts of wheat bran, 4-8 parts of a 5% allicin micronemulsion, and 1-2 parts of a composite microbial inoculant fermentation stock solution. The biological soil conditioner can be used for improving farmland soil for cultivation of ginseng and long-cultivated land soil for cultivation of ginseng, effectively controlling soil borne diseases of ginseng, and at the same time improving yield of ginseng; and the conditioner is adapted to be applied to woodland cultivation and farmland cultivation of ginseng.
Owner:JILIN ACAD OF AGRI SCI

Panax japonicus extract and application thereof

The invention provides a panax japonicus extract, comprising an IVa compound as an active component or a pharmaceutically acceptable salt. The invention also provides a monomeric compound extracted from panax japonicas root and stem. The monomeric compound comprises a panax japonicas extract according to the claim 1, and pharmaceutically acceptable auxiliary material and carrier. The panax japonicas extract is applied to preparation of medicines for treating intestinal mucosal injuries; the intestinal mucosal injuries are intestinal mucosal injuries caused by non-steroidal anti-inflammatory drugs. The result shows that the intestinal mucosal injuries of a medication administration team of the panax japonicas IVa and permeability transition are obviously reduced; and the panax japonicus IVa has therapeutic effect on intestinal mucosal injuries caused by the non-steroidal anti-inflammatory drugs.
Owner:湖北森元药业有限公司

Deep caring and moisturizing aqua-essence

The invention discloses deep caring and moisturizing aqua-essence which is prepared from the following raw materials in parts by weight: 8-16 parts of a seaweed extract, 8-16 parts of a ginseng extract, 4-8 parts of rose essential oil, 1-3 parts of tea tree leaf oil, 3-6 parts of diazolidinyl urea, 15-30 parts of deionized water, 5-12 parts of betaine, 7-14 parts of carbomer, 1-3 parts of sorbitol, 2-6 parts of soybean oil, 7-14 parts of vitamin E, 3-6 parts of propylene glycol, 7-9 parts of sodium hyaluronate and 5-10 parts of hydrogenated castor oil. The invention provides deep caring and moisturizing aqua-essence which has the effects of repairing deep necrotic skin, moisturizing, hydrating skin and reducing wrinkles.
Owner:QINGDAO CHENXUTONG COMMERCE & TRADE

A Chinese medicinal composition for replenishing kidney and strengthening bone and preparation method thereof

The invention discloses a Chinese pharmaceutical composition for kidney-nourishing, which is prepared mainly from homalomena rhizoma, safflower, amomum fruit, prepared rehmannia root, Chinese angelica root, fleece-flower root, root of red rooted saliva, morinda root, eucommia bark, epimeddium, white atractylodes rhizome, notoginseng, Ligusticum wallichii, gen-seng and ligustrum japonicum thumb by predetermined weight proportions. The medicine can be prepared into any of the conventional oral administration dosage.
Owner:YUNNAN CONBA BOTANICALS CO LTD

Application of panax japonicus IV a in prevention and treatment of cardiovascular disease and complication of cardiovascular disease

The invention relates to application of panax japonicus IV a in prevention and treatment of cardiovascular disease and complication of the cardiovascular disease. Experiments show that the panax japonicus IV a has obvious protection effect on ischemia / reperfusion C57 mouse myocardium, the optimum dose is determined, and a medicine for preventing and treating the cardiovascular disease and related complication of the cardiovascular disease can be further prepared.
Owner:FOURTH MILITARY MEDICAL UNIVERSITY