105 results about "Ophiopogon" patented technology

The invention relates to a natural plant composition for treating acne and application thereof. The composition comprises a scutellaria baicalensis extract, a fructus cnidii extract, a herba violae extract, a mangnolia officinalis extract, a Chinese herbaceous peony extract, a radix ophiopogonis extract, a silybum marianum extract and a gastrodia elata extract. The formula is designed according to the traditional Chinese medicine compatibility theory, and the composition formula has a synergistic effect and can effectively inhibit growth of propionibacterium acnes, reduce skin inflammation and generation of erythema and acne marks after acnes, promote fading of the acnes and skin repair and effectively treat the acnes. The composition is stable in formula quality, safe and free of skin irritation, provides a new thought for acne treatment and skin repair, and has a good market application prospect.

The invention relates to a traditional Chinese medicine composition for treating allergic dermatitis. The traditional Chinese medicine composition is prepared from the following traditional Chinese medicines in parts by weight: 5-35 parts of fried coix seeds, 5-35 parts of concha margaritifera, 1-30 parts of honeysuckle stems, 1-30 parts of smoked plums, 1-30 parts of fructus liquidambaris, 1-25 parts of fructus forsythiae, 1-25 parts of radix paeoniae rubra, 1-25 parts of raw sanguisorba officinalis, 1-25 parts of radix glehniae, 1-25 parts of radix ophiopogonis and 1-25 parts of raw radix polygonati officinalis. 1-25 parts by weight of talc and 1-25 parts by weight of lophatherum gracile. The traditional Chinese medicine composition has the effects of clearing heat, cooling blood without bitter cold, dispelling wind, eliminating dampness without hurting stomach, detoxifying, relieving itching and nourishing yin, is safe in clinical use, and has no adverse effect on liver and kidney.

The invention relates to a beauty and skin care enzyme and a preparation method thereof. According to the invention, fruits and traditional Chinese medicines are used as main fermentation raw materials, the fruits and the traditional Chinese medicines are crushed and mixed with fermentation strains, and active substances in each raw material are effectively retained through two-stage fermentation, filtration separation and freeze-drying treatment, SOD and sea buckthorn flavone contained in sea buckthorn fruits have the skin care effects of resisting oxidation and promoting collagen synthesis, and the sea buckthorn fruits have the skin care effects of resisting oxidation and promoting collagen synthesis. Salidroside contained in the rhodiola rosea has the skin care effects of resisting light aging and fatigue, astragalus polysaccharide and astragaloside contained in the astragalus membranaceus can repair a barrier and enhance immunity, ophiopogonin and polysaccharide contained in the radix ophiopogonis have the effects of preserving moisture and resisting saccharification, and hesperidin and nobiletin contained in the pericarpium citri reticulatae have the effects of resisting oxidation and adjusting grease secretion. The obtained compound enzyme has the effects of resisting oxidation, resisting inflammation and preserving moisture, has activity, stability and transdermal efficiency, and can be used in skin care products such as anti-oxidation essence, repair masks, late-up cream and the like.

The invention relates to the technical field of preparation processes, and discloses ancient Huangtai liquor, which is prepared from the following components in percentage by weight: 50 to 55 percent of base liquor, 10 to 15 percent of medicinal and edible traditional Chinese medicinal material extract, 2 to 4 percent of honey, 0.1 to 2 percent of flavor regulator and the balance of purified water, the medicinal and edible traditional Chinese medicinal materials comprise at least one of angelica sinensis, lily, radix ophiopogonis, Chinese dates, Chinese wolfberry fruits, American ginseng, rhizoma polygonati, papayas, astragalus membranaceus and poria cocos, and the liqueur is prepared through the processes of stepped extraction, compound blending, ultrasonic-assisted homogenization, dynamic ageing and membrane filtration. According to the invention, through a stepped extraction process, temperature and time are regulated and controlled in stages, volatile components are preferentially extracted at low temperature, and then non-volatile substances are extracted at medium temperature, so that effective components in the traditional Chinese medicinal materials are fully extracted, the natural flavor of the traditional Chinese medicinal materials is retained, the extraction rate of the effective components is improved, and the flavor level of the liqueur is enriched.

This invention discloses a traditional Chinese medicine composition for improving fever in wind-heat common cold, belonging to the field of traditional Chinese medicine preparation technology. Addressing the shortcomings of existing Western medicines that suppress fever through central nervous system suppression, easily damaging organs and inhibiting microcirculation, and the limitations of traditional Chinese medicine preparations such as bitter and cold properties that astringe pathogens, causing low-grade fever rebound, damaging yin and spleen, and insufficient ability to resolve phlegm and strengthen the body, this invention innovatively combines the principles of monarch, minister, assistant, and guide herbs in a synergistic formulation based on the core microscopic pathogenesis of wind-heat common cold: "constriction of visceral microvessels, stagnation of heat pathogens, high fever depleting body fluids, fluid deficiency and blood stasis, and phlegm production due to stagnation." This invention is prepared using gardenia, platycodon, angelica, peppermint, ophiopogon, dandelion, lily, coix seed, and rehmannia as core raw materials. It utilizes pungent and dispersing herbs to open up the microcirculation of the body surface and lungs, dispersing stagnant heat and replacing the traditional bitter and cold heat-suppressing mechanism. Combined with heat-clearing and anti-inflammatory components, it targets and inhibits the release of inflammatory factors, resulting in stable fever reduction. Small doses of yin-nourishing herbs repair the damage to body fluids and blood caused by high fever, reversing the pathology of fluid deficiency and blood stasis. Spleen-strengthening and dampness-removing herbs harmonize the medicinal properties and strengthen the spleen. This invention achieves a balance of hot and cold properties, and addresses both tonification and purgation, providing a one-stop solution for complex symptoms such as fever, sore throat, nasal congestion, yellow phlegm, dry mouth, weakness, and fatigue caused by dampness in wind-heat colds. It provides stable fever reduction without rebound, and avoids the side effects of Western medicine and bitter and cold Chinese patent medicines. It addresses both the symptoms and the root cause, effectively avoiding post-cold sequelae and reducing the recurrence rate. Furthermore, the preparation process is simple, allowing for processing into various dosage forms, suitable for industrial mass production and widespread clinical application, possessing extremely high medical value and market potential.

The present invention discloses a thin layer chromatography identification method for simultaneously identifying multiple components in a refined flat peach pill preparation and its application, which belongs to the technical field of quality control of traditional Chinese medicine. The thin layer chromatography identification method of the present invention is divided into two parts. The first part adopts methanol ultrasonic extraction and is developed by toluene-ethyl acetate-formic acid-methanol system, which can simultaneously identify the alpinia oxyphylla, wolfberry and fenxinmu in the refined flat peach pill; the second part is based on the methanol ultrasonic extraction, and hydrochloric acid is added to heat and reflux extraction, shaken and evaporated, and then ethanol is redissolved and developed by petroleum ether-ethyl acetate system, which can identify the ophiopogon in the refined flat peach pill. That is, only two sample preparation methods are required, and one thin layer plate can simply, quickly and effectively identify the four medicinal materials in the refined flat peach pill, and the color spots are clear, without tailing, without cross-linking and good specificity.

The invention discloses a fingerprint spectrum construction method of a traditional Chinese medicine composition containing salvia miltiorrhiza and astragalus membranaceus. The construction method comprises the following steps: taking a test solution and a reference solution of the traditional Chinese medicine composition for detection; obtaining content information of a reference substance of the traditional Chinese medicine composition according to a detection result; wherein the traditional Chinese medicine composition comprises salvia miltiorrhiza, radix polygonati officinalis, caulis clematidis armandii, ligusticum, liquorice, bighead atractylodes rhizome, rhizoma smilacis glabrae, radix saposhnikoviae, radix rehmanniae recen, radix ophiopogonis and astragalus membranaceus, and the reference substances are caffeic acid, liquiritin, rehmannia glutinosa libosch D, cimicifugin, astilbin, salvianolic acid B and ammonium glycyrrhizinate. The detection method is simple, accurate, efficient, good in stability, high in precision, good in reproducibility, convenient and easy to master, energy can be effectively saved, the analysis cost is reduced, and the technical content is not disclosed in the prior art.

The invention provides an American ginseng and saffron crocus compound nutrient solid beverage, belongs to the technical field of nutritious foods, and aims to solve the problems of single formula and insufficient efficacy of the existing solid beverage. The solid beverage is prepared from the following components in parts by weight: 55 to 65 parts of maltodextrin, 20 to 30 parts of inulin, 10 to 20 parts of medicinal and edible traditional Chinese medicine extract, 0.1 to 0.3 part of stevioside, 0.1 to 0.3 part of vitamin C, 0.0011 to 0.0022 part of vitamin B2 and 0.02 to 0.033 part of nicotinic acid, the medicinal and edible traditional Chinese medicine extract is obtained by mixing and extracting eleven medicinal and edible traditional Chinese medicinal raw materials such as American ginseng, Chinese yam, Chinese dates, astragalus membranaceus, angelica sinensis, poria cocos, radix ophiopogonis, saffron crocus, peach kernels, rhizoma zingiberis and cinnamon. The preparation method comprises the steps of water extraction of the traditional Chinese medicinal materials, filtration, concentration, alcohol precipitation, concentration, proportioning, mixing, spray granulation, drying, packaging and the like. The beverage is scientific in formula, rich in nutrition, good in taste and suitable for daily drinking of sub-health people, and has a good market application prospect.

The present invention relates to a fingerprint construction method and detection method of an Mahuang Dingchuan Decoction composition. The fingerprint construction method of the present invention comprises the following steps: taking a reference substance and an Mahuang Dingchuan Decoction composition, and preparing a reference substance solution and a test solution respectively; using high performance liquid chromatography to detect the reference substance solution and the test solution, and obtaining corresponding detection patterns and reference patterns; importing the detection patterns into a traditional Chinese medicine chromatographic fingerprint similarity evaluation system for analysis, and obtaining a fingerprint of the Mahuang Dingchuan Decoction composition with identification. The present invention constructs a fingerprint of the Mahuang Dingchuan Decoction composition, which has rich chromatographic peaks and contains effective ingredients belonging to multiple medicinal materials such as ephedra, bitter almond, scutellaria, white mulberry bark, ophiopogon, platycodon, coltsfoot flower, radish seed, ginkgo, etc., which can more comprehensively reflect the overall chemical composition of the Mahuang Dingchuan Decoction composition, provide an effective means for the overall quality control and evaluation of the Mahuang Dingchuan Decoction preparation, can better monitor and evaluate the quality of this product, and has a high application value.

The present application belongs to the technical field of dermatosis treatment products, and particularly relates to a soft pelleted medicine and a preparation method thereof. The soft pelleted medicine is prepared from the following raw materials in parts by weight: 20-40 parts of Ramulus cinnamomi, 25-35 parts of Radix astragali, 5-15 parts of Semen persicae, 5-15 parts of Ophiopogon, 5-15 parts of Carthamus tinctorius, 15-30 parts of calcined Radix paeoniae alba, 10-20 parts of Radix angelicae sinensis, 15-30 parts of Radix rehmanniae preparata, 20-40 parts of Radix codonopsis, 5-15 parts of Radix paeoniae alba, 5-10 parts of Ephedra, 5-10 parts of Radix rubiae, 5-15 parts of Centella asiatica, 2-5 parts of Radix et Rhizoma aconiti, 5-10 parts of Salvinia natans, and 5-10 parts of Rhizoma zingiberis. The soft pelleted medicine provided by the present application has the main effects of warming yang and benefiting qi, promoting blood circulation to remove meridian obstruction, dispelling cold and dampness, removing blood stasis and promoting tissue regeneration, and is used for treating dermatosis such as scleroderma, frostbite, Raynaud's disease, skin atrophy, and the like, and particularly has remarkable effects on scleroderma, frostbite, Raynaud's disease, and skin atrophy.

The invention relates to the technical field of traditional Chinese medicine pharmacy, and discloses a traditional Chinese medicine composition for treating rhinitis based on a fructus xanthii extract and a preparation method of the traditional Chinese medicine composition. 5%-7% of liquorice; 15%-20% of dark plum; 2%-5% of bighead atractylodes rhizome; 20%-25% of schisandra chinensis; 1%-3% of almonds; 5%-8% of cortex mori radicis; 4%-11% of centipeda minima; 4%-7% of fructus chebulae; 0.2%-0.5% of cassia twig; 1%-3% of radix saposhnikoviae and 4%-9% of 4%-7% of radix astragali; 3%-6% of radix ophiopogonis; the raw materials are processed and proportioned, and the traditional Chinese medicine ointment is prepared through the processes of decoction of the detoxifying and synergistic group, concentration of the orifice-opening and exterior-strengthening group, extraction of the qi-tonifying and yin-nourishing group, mixed light decoction and concentration. When the ointment is used, a cotton swab is coated with the ointment, the cotton swab coated with the ointment is fed into the nasal polyp part of a rhinitis patient and stays for about 20 minutes, after the drug effect of the ointment is slowly released, the nasal polyp necroses, part of the nasal polyp can fall off after about 15 days, and the treatment process can be repeated for multiple times and once every 15 days until the nasal polyp completely falls off. The ointment can effectively relieve nasal obstruction, running nose, rhinocnesmus and sneezing symptoms of rhinitis patients; the traditional Chinese medicine is not required to take medicine but is only externally used, is very safe to use and has no toxic or side effect.

The invention relates to the technical field of traditional Chinese medicine compositions, and discloses a traditional Chinese medicine composition for athletes and a preparation method of the traditional Chinese medicine composition. The traditional Chinese medicine composition comprises 4 parts of ginseng, 8 parts of polygala tenuifolia, 20 parts of Chinese yam, 12 parts of bighead atractylodes rhizome, 4 parts of pseudo-ginseng, 15 parts of rhizoma polygonati, 12 parts of flax seed, 10 parts of wolfberry, 15 parts of radix ophiopogonis, 15 parts of prepared rehmannia root, 15 parts of prepared fleece flower root, 15 parts of longan aril, 10 parts of mulberry leaf, 12 parts of wild chrysanthemum flower, 10 parts of eucommia ulmoides, 12 parts of rhizoma cibotii, 12 parts of cortex acanthopanacis and 12 parts of radix achyranthis bidentatae. According to the traditional Chinese medicine composition for the athletes and the preparation method of the traditional Chinese medicine composition, the composition of a decoction formula and a beverage formula can help the athletes to accelerate elimination of exercise-induced fatigue, improve mental functions and enhance physique, physical strength, intelligence and memory; the composition of the weight-losing formula definitely provides a conditioning scheme for hyperlipemia obesity, obesity due to spleen deficiency and obesity due to qi deficiency.

The traditional Chinese medicine comprises (1) radix puerariae, (2) radix angelicae sinensis, (3) radix salviae miltiorrhizae, (4) radix codonopsis, (5) radix astragali, (6) fructus perillae, (7) fructus ziziphi jujubae, (8) radix bupleuri, (9) radix scutellariae, (10) flos carthami, (11) radix curcumae, (12) radix et rhizoma rhei, (13) pericarpium zanthoxyli, (14) radix glycyrrhizae, (15) radix ophiopogonis, (16) fructus schizandrae, (17) radix aconiti carmichaeli, (18) radix ginseng, (19) poria cocos, (20) gypsum, (21) oyster, (22) cassia twig and (23) semen plantaginis. Or extracts of the above components, the amount of the extracts being equivalent to the amount of the raw materials of the corresponding components. The invention aims at the clinical curative effect of amyotrophic lateral sclerosis diseases with different pathological manifestations. The medicine can be combined with western medicines for use.

The invention discloses a traditional Chinese medicine composition for removing freckles and resisting wrinkles, gel and a preparation method thereof, and belongs to the technical field of cosmetics, the traditional Chinese medicine composition is mainly prepared by mixing angelica sinensis, ginseng, radix bupleuri, curcuma zedoary, leonurus, peach kernel, safflower carthamus, liquorice, radix ophiopogonis, radix cynanchi bungei and other components according to a certain proportion. The preparation method of the gel mainly comprises the following steps: firstly preparing a 65-80% traditional Chinese medicine composition concentrated solution, then preparing a carbomer solution, firstly adding a proper amount of the traditional Chinese medicine composition concentrated solution into the carbomer solution under a stirring condition, then adding a proper amount of N-methyl pyrrolidone, then adding a proper amount of an ethylparaben-propylene glycol solution, and uniformly stirring to obtain the gel. And finally, adding a proper amount of triethanolamine to obtain the freckle-removing and anti-wrinkle gel. The preparation method is simple in process, convenient to prepare and high in production efficiency, and the produced product is good in quality. The gel is good in safety, good in moisturizing effect and good in freckle-removing and anti-wrinkle effect, and can also effectively help skin to be compact, reduce wrinkles and improve skin elasticity.

The invention relates to an application of a traditional Chinese medicine composition in preparation of a medicine for treating hypertension, which is characterized in that the traditional Chinese medicine composition is prepared from gypsum, rehmannia, ophiopogon root, rhizoma anemarrhenae and achyranthes root. The composition disclosed by the invention can be used for remarkably reducing systolic pressure of spontaneously hypertensive rats and reducing blood pressure rise of the rats caused by feeding of high-fat feed, so that the traditional Chinese medicine composition has a relatively good treatment effect on hypertension.

The application discloses a traditional Chinese medicine composition for treating Sjogren's syndrome, which is prepared from the following traditional Chinese medicine decoction pieces: 10-20 parts of ginseng, 5-15 parts of radix codonopsis, 15-25 parts of radix polygonati, 10-20 parts of polygonatum, 5-15 parts of cortex moutan, 10-20 parts of ophiopogon, 5-15 parts of radix paeoniae alba, 5-15 parts of dendrobium, 10-20 parts of radix rehmanniae, and the like, and discloses a preparation method and application thereof. The application can supplement lung qi and lung yin, supplement the spleen and the earth to generate gold, promote the functions of moistening the lung and nourishing yin, benefiting the stomach and generating saliva, supplement kidney yin and heart blood, activate blood and remove blood stasis, dredge the liver and regulate qi, and achieve the purpose of treating Sjogren's syndrome of qi and yin deficiency.

An endophytic fungus of Ophiopogon japonicus and use thereof provided. The endophytic fungus is isolated from the living Ophiopogon japonicus plants, an Ophiopogon plant of Liliaceae, by a traditional tissue block separation method, with a category name of Fusarium falciforme OJ106, and a deposit number of CGMCC No. 40703. The methylophiopogonanone B is prepared through the PDB liquid fermentation of endophytic fungus strains. The endophytic fungus of Ophiopogon japonicus is an important microorganism for searching for new resources of the methylophiopogonanone B, and has a high application value.SEQ ID NO. 1cgactttggtgtgcgggagggacattaccgagttatacaactcatcaaccctgtgaacatacctataacgttgcctcggcgggaacagacggccccgtaacacgggccgcccccgccagaagaccccctaactctgtttctataatgtttcttctgagtaaacaagcaaataaattaaaactttcaacaacggatctcttggctctggcatcgatgaaaaacgcagcgaaatgcgataagtaatgtgaattgcaaaattcagtgaatcatcgaatctttgaacgcacattgccccgacagtattctggcgggcatgcctgttcaagcgtcattacaaccctcaggcccccgggcctggcgttggggatcggeggaagccccctgcgggcacaacgccgtcccccaaatacagtggcggtcccgccgcagcttccattgcgtagtagctaacacctcgcaactggagagcggcgcggccacgccgtaaaacacccaacttctgaatgttgacctcgaatcaggtaggaatacccgctgaacttaagcatatcaataagcggtagtta

The invention discloses an effective part of a pulse-activating decoction as well as an extraction and purification method and application thereof, and the extraction and purification method comprises the following steps: taking red ginseng, radix ophiopogonis and schisandra chinensis as raw materials, adding water for extraction, and freeze-drying to obtain freeze-dried powder; dissolving the freeze-dried powder with distilled water, loading the dissolved powder on a macroporous adsorption resin column, carrying out gradient elution with water and a 20% ethanol aqueous solution in sequence, and separating fractions Fr1-Fr8; the chromatographic characteristics of each fraction are analyzed by using a C18 chromatographic column through a liquid chromatograph, the fractions with the same chromatographic characteristics are combined, the fractions Fr1-Fr4 are combined into a component yf-1, the fraction Fr5 is combined into a component yf-2, and the component yf-2 is the effective part of the pulse-activating decoction. According to the effective part disclosed by the invention, toxic parts are removed, so that H9c2 cell injury caused by adriamycin can be more effectively and stably protected with lower toxicity, and the application of the component yf-2 in preparation of medicines for treating myocardial cell injury is prompted.

The application discloses a bird's nest compound product with the effect of improving female body health and a preparation method and application thereof. The preparation method comprises the following steps: mixing red ginseng, Gastrodia elata, ophiopogon, donkey-hide gelatin, eucommia and ganoderma lucidum with a solvent to form a mixed slurry; treating and extracting the mixed slurry by applying an electric field to prepare a compound liquid; and mixing the compound liquid with bird's nest to prepare the bird's nest compound product with the effect of improving female body health. The bird's nest is matched with the medicine-food homologous material, and on the basis of the theory of "suo zhuo jun chen", the bird's nest compound product capable of obviously improving menopausal syndrome is prepared, the hormone level is effectively adjusted, symptoms such as hot flashes, night sweats, sleep quality improvement, ovary and uterus repair promotion and the like are relieved, and the product is mild in action, high in safety, good in flavor and color.

The invention relates to the technical field of pharmaceutical preparations, in particular to a myocardial protection traditional Chinese medicine composition capable of clearing heat, promoting blood circulation and removing blood stasis, a preparation and a preparation method and application of the myocardial protection traditional Chinese medicine composition. The traditional Chinese medicine composition is prepared from the following medicinal materials in parts by weight: 5-15 parts of gentiana acuminata, 10-20 parts of salvia miltiorrhiza, 5-15 parts of angelica sinensis, 10-20 parts of gynostemma pentaphylla, 5-15 parts of rhodiola rosea, 3-10 parts of hematoxylon, 5-15 parts of radix paeoniae rubra, 3-10 parts of lumbricus, 3-10 parts of radix curcumae, 10-20 parts of astragalus membranaceus, 3-10 parts of ginseng, 5-15 parts of radix ophiopogonis, 3-8 parts of schisandra chinensis and 3-8 parts of liquorice. According to the traditional Chinese medicine compound provided by the invention, through the synergistic effect of clearing heat, promoting blood circulation, removing blood stasis, tonifying qi and nourishing yin, the synergistic effect can be achieved more comprehensively aiming at the pathogenesis of heat-blood stasis intermingling. The traditional Chinese medicine composition has remarkable advantages in the aspect of treating myocardial ischemia reperfusion injury, the curative effect of the traditional Chinese medicine composition depends on complete monarch, minister, assistant and guide compatibility, and the overall medicine effect can be reduced if part of components are lost.

The invention discloses a double-drum closed air energy heat pump radix ophiopogonis drying and cell sap recycling system which comprises an air energy heat pump, an air heating assembly, a drying storeroom, an airflow guiding mechanism, a temperature and humidity detector, a drying drum machine and a cell recycling mechanism, the air energy heat pump is connected with the air heating assembly through a pipeline, the air heating assembly is arranged in the drying storeroom, and the cell sap recycling mechanism is arranged in the drying storeroom. The drying storeroom is located on one side of the air energy heat pump, the airflow guiding mechanism is installed in the drying storeroom, the temperature and humidity detector is installed in the drying storeroom, the two sets of drying roller machines are symmetrically installed in the drying storeroom, the two sets of drying roller machines are connected with the cell recycling mechanism through pipelines, and the drying storeroom is further provided with a PLC control cabinet. According to the designed drying equipment, on the basis of clean energy, the radix ophiopogonis can be efficiently dried, cell sap can be separated and recycled, and the radix ophiopogonis drying effect is improved.

The invention provides a processing and preparing method of sperm-adding hemeletic pills. The processing and preparing method comprises the following steps: S1, treating raw materials; the preparation method comprises the following steps: drying and crushing ginseng, Chinese yam, dogwood pulp, radix ophiopogonis, semen cuscutae, cistanche, prepared rehmannia root, morinda officinalis, schisandra chinensis, semen boitae and cinnamon in a prescription to obtain a medicinal powder component; s2, preparing a glue solution: performing glue melting treatment on deer-horn glue, tortoise-plastron glue and swimming bladder in the prescription to obtain a glue solution component; s3, mixing and pelleting: mixing the medicinal powder component with the glue solution component to prepare pellets; s4, post-treatment: drying and sterilizing the pills to obtain the sperm-increasing hemeletic pill, and the processing and preparation method of the sperm-increasing hemeletic pill can be researched and developed, so that the problems that due to the fact that glue medicinal materials are high in viscosity, the glue medicinal materials are difficult to uniformly mix with dozens of times of medicine powder in amount in a traditional method, effective components in the pill are easily distributed unevenly, and the quality of the pill is influenced are solved. The quality fluctuation among different batches is large, the stability of the curative effect is influenced, and the uniformity and the stability of medicinal materials are improved.

The invention provides a Wuxian oral liquid and a preparation method thereof, and belongs to the field of traditional Chinese medicine preparations, the preparation method comprises the following steps: adding water into ginseng, bighead atractylodes rhizome, poria cocos, chrysanthemum, barbary wolfberry fruit, rehmannia root, dwarf lilyturf tuber, dried orange peel, kudzuvine root, fructus viticis and medicated leaven, decocting, mixing all decoctions, filtering, concentrating the filtrate under reduced pressure, adding xylitol and potassium sorbate, cooling the prepared liquid medicine to room temperature, and filling to obtain the Wuxian oral liquid. The sealed oral liquid is sterilized, cooled, wiped, subjected to light inspection, labeled and packaged, cane sugar and citric acid in an original formula are comprehensively replaced with xylitol, xylitol metabolism is not adjusted by insulin, the taste is cool, refreshing and sweet, the taste correction requirement can be met, and the taste of the oral liquid is improved. The medicine safety of diabetics and other people who avoid sugar is ensured, the application range of the product is greatly widened, the product is quantitatively filled, can be taken once a bottle is opened, is accurate in dosage, is convenient for the patient to carry about and take on time, and the treatment compliance of the patient is remarkably improved.

The invention belongs to the field of biological medicine, and particularly relates to a traditional Chinese medicine composition for treating heart yin deficiency and myocardial fibrosis and application thereof. The traditional Chinese medicine composition is prepared from the following raw medicinal materials in parts by weight: 5-13 parts of lily, 5-13 parts of radix ophiopogonis, 3-9 parts of ginseng, 5-13 parts of radix scrophulariae, 3-9 parts of semen boitae and 1-5 parts of schisandra chinensis. The invention also provides a preparation method of the composition. The composition has the effects of reinforcing qi, nourishing yin, calming the heart and tranquilizing the mind, and can be used for preparing medicines for treating heart-yin deficiency and myocardial fibrosis or improving heart-yin deficiency symptoms. Experimental results show that the traditional Chinese medicine composition can significantly improve the heart function of a chronic heart failure model mouse, inhibit myocardial cell hypertrophy and collagen deposition, and down-regulate fibrosis-related gene expression. Clinical observation shows that the traditional Chinese medicine can effectively relieve the symptoms of palpitation, insomnia, dysphoria with smothery sensation and the like of patients with heart yin deficiency. The traditional Chinese medicine composition is clear in formula and controllable in quality, and a novel safe and effective traditional Chinese medicine choice is provided for treating heart yin deficiency related myocardial fibrosis.

The invention discloses a composition for treating children oral ulcer, which is prepared from the following components in parts by weight: 10 to 35 parts of indigo naturalis, 8 to 35 parts of fructus jujubae, 5 to 20 parts of montmorillonite powder, 0.010 to 3 parts of VB2, 5 to 8 parts of flos lonicerae, 6 to 10 parts of radix ophiopogonis, 8 to 12 parts of poria cocos, 4 to 6 parts of fructus forsythiae, 7 to 11 parts of rhizoma dioscoreae, 5 to 9 parts of radix polygonati officinalis, 0.5 to 1.5 parts of menthol and 6 to 10 parts of Arabic gum. According to the traditional theory of traditional Chinese medicine, the traditional Chinese medicine composition has the effects of clearing away heat and toxic materials, strengthening the spleen and regulating the middle warmer, combines the Western medicine montmorillonite powder for astringing and inducing astringency, VB2 for supplementing vitamins, menthol and Arabic gum for easing pain and taking effect, has long adhesion time and high healing speed, and is convenient to use, definite in clinical curative effect, economical and practical.

The invention discloses a radix ophiopogonis and pericarpium citri reticulatae composition for relieving anxiety mood and improving sleep. The composition comprises the following components in parts by weight: 50-80 parts of a radix ophiopogonis extract, 20-40 parts of a pericarpium citri reticulatae extract, 10-30 parts of spina date seed powder, 10-30 parts of poria cocos powder, 10-30 parts of maltodextrin and 5-10 parts of xylitol. The invention further discloses a preparation method and application of the radix ophiopogonis and pericarpium citri reticulatae composition. The composition disclosed by the invention realizes synergistic interaction through triple pathways of neuroinflammation inhibition, intestinal brain axis regulation and GABA energy system activation, and can effectively relieve anxiety mood and improve sleep disorder.

The utility model discloses a kind of for ophiopogon processing's grinding device, it is related to grinding device technical field.The utility model includes grinding disc, is provided with adjusting mechanism and grinding mechanism on the grinding disc;Several leakage grooves one are opened in the grinding disc, the bottom of the grinding disc is fixedly connected with hopper, the adjusting mechanism includes the support plate being set on the top of grinding disc, the grinding mechanism includes the motor being fixedly connected in the bottom of grinding disc, several rotating shafts are penetrated in the grinding disc, and several rotating shafts are all rotatably connected with grinding disc.The utility model passes through setting adjusting mechanism, solved the grinding device of current ophiopogon processing in use process, if discharging is too fast, grinding component is difficult to carry out sufficient grinding to a large amount of material in short time, will lead to material to accumulate in grinding cavity, if discharging is too slow, grinding device cannot give full play to its grinding capacity, reduce the problem of grinding efficiency.

The present invention relates to a composition for preventing and treating chapped skin and its preparation method and application, and belongs to the technical field of daily chemical products. The composition includes the following components in parts by weight: licorice chalcone A: 0.05-1 part, tea tree oil: 0.5-8 part, lithospermum officinale oil: 1-10 part, ophiopogon root extract: 2-15 parts; the present invention adopts the compounding of specific components, and by controlling the weight of each component in the composition, each component is coordinated with each other, and a synergistic effect is played, and by multiple angles such as moisturizing, anti-inflammatory, antibacterial and promoting skin regeneration, skin healing is helped, and the purpose of preventing and treating chapped skin can be achieved, with significant effect and mild effect; and the composition has antibacterial effect, can replace chemical preservatives, and reduces irritation to the skin during use. The anti-chapped cream prepared by the present invention has a liquid crystal structure, can provide better skin feel and excellent stability, and can prolong the action time of active substances.

The present invention belongs to the technical field of traditional Chinese medicine, and in particular to a Chinese medicine composition for treating depression. The Chinese medicine composition is mainly prepared from astragalus, codonopsis, ophiopogon, polygonum multiflorum, epimedium, kudzu root, angelica, salvia miltiorrhiza, honeysuckle, seaweed, kelp, oyster, and immature bitter orange. The Chinese medicine composition of the present invention can significantly improve the symptoms of loss of appetite and weight loss in depression model rats, improve the symptoms of loss of interest in depression model rats, effectively alleviate the symptoms of increased inflammatory factors TNF-α, IL-1β, and INF-γ caused by depression, significantly increase the levels of 5-hydroxytryptamine and dopamine in rat cortex and hippocampus, and effectively treat depression.

The invention discloses an extraction process of non-denatured type II collagen for relieving osteoarthritis as well as a product and application of the non-denatured type II collagen, and belongs to the technical field of non-denatured type II collagen extraction.The extraction process comprises the following steps: (1) pretreating to obtain cartilage particles; (2) enzyme activation: mixing medlar, radix ophiopogonis, chicory and honeysuckle, adding water for extraction to obtain an extracting solution, adding pepsase, and uniformly mixing to obtain an activating enzyme; (3) enzymolysis: adding an activating enzyme into the cartilage grains for enzymolysis to obtain a precipitate; and (4) post-treatment: drying and crushing the precipitate. The extraction process is simple, the production efficiency is high, the enzyme dosage is small, the cost is low, the method is green and environment-friendly, the requirement of large-scale production is met, and the prepared non-denatured type II collagen has good improvement and treatment effects on osteoporosis and osteoarthritis.