2386 results about "Actinidia" patented technology

The invention provides intelligence-reinforcing health-care dried bean curd. The intelligence-reinforcing health-care dried bean curd is processed from raw materials of, by weight, 100 parts of black soybeans, 4-6 parts of Chinese hawthorn seeds, 1-3 parts of black sesame, 1-3 parts of walnut, 3-5 parts of loofah, 3-5 parts of kiwi fruit, 4-6 parts of longan pulp, 5-7 parts of grapes, 3-5 parts of ginseng, 4-6 parts of poria, 2-3 parts of dens draconis, 1-2 parts of polygala root, 1-2 parts of acanthopanax and 1-2 parts of sunflower discs. The intelligence-reinforcing health-care dried bean curd is prepared by boiling the intelligence-reinforcing raw materials to soup, soaking the raw beans, using mixed liquor of the nourishing soup and water as soybean milk grinding water for soybean milk grinding, filtering, boiling soybean milk, adding intelligence-reinforcing flavoring materials, pointing halide, pressing, marinating, packaging and sterilizing. The dried bean curd has nutrient of conventional dried bean curd, as well as has functions of intelligence reinforcing and health care, and is aromatic in taste.

The invention discloses a picking robot and a picking method for kiwi fruits. The picking robot for the kiwi fruits comprises a machinery execution system and a control system, and is characterized in that the machinery execution system comprises a car body, a telescopic slide platform, a five freedom degree picking robot arm and a two finger type end actuator, and the control system comprises an industrial personal computer, a motion control card, a data acquisition card, an image acquisition card, a servo motor driver, a binocular video camera, an infrared sensor, a pressure sensor, an electric control cabinet and a control circuit. The picking robot and the picking method for the kiwi fruits use a building block design philosophy to integrate the two finger type end actuator, the five freedom degree picking robot arm, the telescopic slide platform and a sensor system together and integrate image acquisition and feature extraction of fruits and barriers, intelligent mobility of the telescopic slide platform, counterguard and fruit positioning of the five freedom degree picking robot arm and grab motions of the two finger type end actuator together, and therefore achieve mechanization and automation of picking of the kiwi fruits, improve labor productivity, reduce production cost, and guarantee harvest quality of the kiwi fruits.

The present invention provides a pharmaceutical composition comprising the extract of hardy kiwifruit as an active ingredient in an effective amount to treat and prevent allergic disease and non-allergic inflammatory disease by reducing inflammation action, by inhibiting histamine release from mast cell, and by increasing the level of Th1 cytokines, IgG2a in serum and reducing the level of Th2 cytokines and IgE in serum. The present invention also provides a use of above extract for the preparation of pharmaceutical composition. The present invention also provides a health food or food additives, a cosmetic composition, a feed or feed additives comprising above extract for prevention or alleviation of allergic disease and non-allergic inflammatory disease by reducing inflammation action, by inhibiting histamine release from mast cell, and by increasing the level of Th1 cytokines, IgG2a in serum, and reducing the level of Th2 cytokines and IgE in serum.

A method for preparing preserved kiwi fruit by vacuum freeze drying. The method comprises steps of: peeling and slicing kiwi fruit, immersing the kiwi fruit in color protecting liquid, and then placing the kiwi fruit in a hardening liquid for hardening; after hardening, conducting an ultrasonic pretreatment in liquid glucose; and then successively carrying out vacuum sugar permeability, prefreezing, vacuum freeze drying, and packing to obtain the preserved kiwi fruit. According to the present invention, glucose lactone is added into a calcium chloride hardening liquid to coagulate protein in the fruit pieces and significantly improve hardening effect. The ultrasonic pretreatment and vacuum sugar permeability avoid a heat treatment process of rapid heating for a long time or short time, so that the kiwi fruit slices are still bright green (quite similar with an original fruit color). Vacuum freeze drying on the kiwi fruit realizes a high nutrient conservation rate.

The invention provides a yangtao lucid ganoderma composite ferment and a preparation method thereof. The preparation method comprises the following steps of: introducing ganoderma lucidum into fruit which takes the yangtao as a main raw material, and processing to obtain a ferment edible beverage which is higher in nutritive value and better in health-care effect after the processing of fermentation engineering and bio-extraction technologies. The raw material used in the yangtao lucid ganoderma composite ferment is the combination of the yangtao which is enriched in benefit ingredients such as vitamin C, polysaccharide and amino acid and the valuable medicinal and edible fungus, so that the yangtao lucid ganoderma composite ferment has various physiological activities such as antioxidation, stomach and intestine nourishing, the three high disease prevention and treatment, immunity improving and cancer prevention and treatment; the raw materials are treated by an ozone technology, the microorganisms on the surfaces of the raw materials can be effectively killed, the integrity of the raw materials can be guaranteed, and the nutrient substances and the active substances, i.e., the enzyme, can not be influenced; and the bio-extraction of the active substances, i.e., the yangtao, can be realized by adopting a normal-temperature (26-34DEG C) multi-flora, multi-stage and multi-level co-fermentation technology, so that the prepared ferment edible beverage simultaneously comprises the effective active ingredients, i.e., the yangtao and the lucid ganoderma, various probiotics and benefit metabolite of the active ingredients and the probiotics.

The invention discloses a compiling vector of a kiwi fruit gene AcPDS based on CRISPR-Cas9 as well as a construction method and application thereof. The compiling vector of the kiwi fruit gene AcPDS based on CRISPR-Cas9 established can quickly and simply perform efficient site-specific mutagenesis on the kiwi fruit gene, so that the blank of a gene fixed point compiling technology in kiwi fruit is filled. Experimental results verify that by means of agrobacterium-mediated kiwi fruit genetic transformation, the compiling vector of the kiwi fruit gene AcPDS based on CRISPR-Cas9 performs site-specific mutagenesis on two target spots of the kiwi fruit gene AcPDS successfully, and meanwhile, an albefactedphenotype is induced.

The invention discloses a kiwifruit tree planting method. Connected greenhouses are used for cultivation, greenhouse films and arrangement of the greenhouses are adjusted along with change of seasons, the four-prevention measures including anti-freezing measures taken in winter and spring, rain sheltering and disease preventing measures taken in the rainy season, and cooling and sun blocking measures and windproof measures taken in midsummer are adopted, matched labor-saving tree cultivating management is performed, the capacity for coping with extreme weather in rainy and high-temperature areas in the south is effectively improved, and the high temperature and high humidity disease problem and the like which are difficult to solve in open field cultivation and traditional facility cultivation are solved. Due to the adoption of the method, the kiwifruit disease transmission route can be effectively cut off, input cost is low, manpower is saved, the survival rate of kiwifruit trees reaches 95.2%, the average single weight of red kiwifruits can reach 86 g under the situation that no swelling agents are applied, and the largest single fruit weight reaches 103.5 g; the soluble solid reaches 17.4% to 19.1%; the fruit cleanness is obviously improved, use of swelling agents and high-poison and mediate-poison pesticide is effectively eradicated, and quality safety of the fruits is guaranteed.

The invention discloses a method for planting kiwi fruits. The method includes the following steps of (1) arranging filed ridges, (2) planting the kiwi fruits and building a frame, (3) shaping the kiwi fruits, (4) clipping the kiwi fruits, (5) carrying out pollination, flower thinning and fruit thinning on kiwi fruit plants, and (6) carrying out watering, pesticide spraying and fertilizing on the kiwi fruits. By means of the method, the kiwi fruit planting method is wide in application range and harmless in growth period, reduces production cost and improves quality of the kiwi fruits.

The invention discloses a scientific and reasonable method for planting kiwi fruits. The method comprises the steps of field selection and soil preparation, seedling selection, field planting, fertilizer applying, trimming, support erecting, plant disease and insect pest prevention and treatment, picking and the like, wherein the field selection and soil preparation comprise the field selection and the soil preparation, the field selection means the selection of subacidity soil where the transportation is convenient, the underground water level is below 1 meter, the irrigation and drainage conditions are good, and the PH value is 5.5-6.5, and the area where the organic matter is rich, the soil is fertile and loose, and the depth of a soil layer reaches more than 100cm. The soil preparation means that soil deep tillage is carried out, the depth of the soil is not less than 80cm, the soil deep tillage is carried out, meanwhile, the base fertilizer is applied, the bio-organic fertilizer applied in each mu is not less than 800kg, meanwhile, in the soil preparation, hole digging (including furrows) is carried out according to the 4m width, and the depth of the furrow is not less than 80cm. The method is adopted to conduct the field selection and the soil preparation, the kiwi fruits are not limited by the planting area, and the transportation cost is reduced. Meanwhile, the yield of the kiwi fruits can be greatly improved by the adoption of the planting method.

The invention provides a controlled-release and slow-release compound fertilizer specialized for kiwi fruit, and belongs to the technical field of fertilizers. The compound fertilizer comprises 8-9 parts of urea, 16-18 parts of calcium magnesium phosphate fertilizer, 1 part of potassium sulfate, 3.5-4.5 parts of potassium chloride, 60-70 parts of fermented chicken manure fertilizer, 7-9 parts of charcoal powder, 1.8-2.2 parts of calcium superphosphate, 0.8-1.2 parts of bentonite, 1 part of a solid inoculant, and 0.1 part of boric acid. The compound fertilizer provided by the invention has the beneficial effects that urea, the calcium magnesium phosphate fertilizer, potassium sulfate and potassium chloride are prepared according to the proportions, the demand of the kiwi fruit plants on nitrogen, phosphorous and potassium is satisfied, and needed secondary elements such as calcium, magnesium, chlorine, sulfur and boron are guaranteed at the same time; besides, large amounts of organic substances are supplied to the kiwi fruit by large amounts of the fermented chicken manure fertilizer; and moreover, needed trace elements such as ferric, copper, sodium, zinc, cobalt and the like are contained in the compound fertilizer, so the elements necessary for the kiwi fruit are basically completed.

The invention provides a foliar fertilizer specially used for Chinese gooseberries, which has the functions of cold resistance and consists of the following raw materials according to weight percentage: 0.1 to 8 percent of DMSO, 0.05 to 5 percent of trimethylene glycol, 0.05 to 5 percent of salicylic acid, 0.05 to 2 percent of compound ammonium nitrate, 1 to 15 percent of humic acid, 0.5 to 10 percent of chitosan, 1 to 10 percent of citric acid, 2 to 15 percent of urea, 1 to 10 percent of borax, 1 to 20 percent of zinc sulfate, 0.5 to 10 percent of ferrous sulfate, 0.05 to 5 percent of ammonium molybdate, 1 to 15 percent of manganese sulfate, 0.1 to 2 percent of SDBS and 35 to 80 percent of water. The foliar fertilizer has obvious effects of enhancing the cold resistance of the Chinese gooseberries, coordinating the nutrient balance in plant corpus, promoting the growth, increasing the output and improving the quality.

The invention provides a kiwifruit growth cold-resistant agent, which is composed of the following materials based on weight percentage: 0.05-5% of 5-nitro guaiacol sodium, 0.3-5% of humic acid, 0.1-2% of paclobutrazol, 0.5-5% of chitosan, 0.1-5% of rosin, 0.1-5% of castor wax, 0-3% of paraffin, 0-5% of citric acid, 0-6% of calcium chloride, 0.5-10% of propylene glycol, 0.1-15% of salicylic acid, 0.5-8% of vegetable oil, 0.05-10% of dimethyl sulfoxide, 0.1-2% of sodium dodecyl benzene sulfonate, and 35-85% of water. The cold-resistant agent can effectively increase the membrane stability of kiwi branches, remove harmful free radicals, regulate in-vivo water balance of the plants, improve anti-freezing performance and ensure kiwifruit yield.

The invention discloses a variety breeding and early-season high-yield cultivation technology for actinidia arguta. The variety breeding and early-season high-yield cultivation technology includes procedures of 1 variety selection, 2 seedling propagation, 3 field planting, 4 underground management, 5 pest control and 6 pruning. Seedling propagation carried out in a step 2 includes collecting and storing cuttings and performing root cutting on the cuttings in sunlight greenhouses, particularly, root cutting is performed on the cuttings in the nutrient pots, and greenwood cutting is performed on the cuttings. Compared with the prior art, the variety breeding and early-season high-yield cultivation technology has the advantages that seedlings are raised in the sunlight greenhouses by means of root cutting, so that the seedling growth time can be prolonged, the seedlings are healthy and are high in growth potential after being planted, and a foundation is laid for early and high yields; frame surfaces are replaced by small canopy frames, and accordingly operation and management can be facilitated.

The actinidia arguta is a specific precious wild resource. The meat of the actinidia arguta is jade green; the actinidia arguta tastes fine, juicy, fragrant and delicious; the sweetness and the sourness are proper; the nutrition is very rich; the actinidia arguta is a fruit well received by customers and is known as the king of fruits. Wild actinidia arguta resources are readily available in Changbai Mountains, but products of the actinidia arguta are few and cannot meet the consumption demands in different seasons, so that the demands of the customers for wild actinidia arguta products are suppressed. The invention discloses a preparation technology for Changbai-mountain pure natural wild actinidia arguta fruit powder. According to the technology, the freeze-dried fruit powder is prepared by selecting fresh and intact actinidia arguta, washing, smashing, pulping and concentrating the actinidia arguta, adding maltodextrin and performing vacuum freeze-drying on mixed fruit paste. The actinidia arguta freeze-dried fruit powder is high in nutrient value and is convenient food suitable for various groups of people.

A field management method of high-end kiwi fruit during a fruiting period relates to a cultivation management method which is applied after a kiwi fruit plant can fruit. By systematic treatment of the method comprising application of fertilizer prior to flowering, bud picking, pollination, fruit thinning, application of fruit expanding fertilizer, application of leaf surface fertilizer, pest control, bagging, core picking, drought resistance, drainage of stagnant water, base fertilizer application, winter pruning, winter orchard-clearing disinfection and the like, the kiwi fruit can fully and efficiently utilize light, temperature, water, air and fertilizer, the relations of branch and leaf growth and fruiting are adjusted in real time, distribution of plant nutrient is adjusted, the fruiting capability of the kiwi fruit can be brought into play as far as possible, single-fruit grain weight and the number of contained seeds are increased, pest and disease damage can be eliminated simultaneously, and the disease-resistant capability of plants is enhanced. Besides, the trophic structure of the soil can be adjusted, soil fertility is not reduced all the year round, high quality, high yield and stable yield of the kiwi fruit are achieved, and the age limit of fruiting is prolonged.

The invention discloses a production method of kiwifruit vinegar, which comprises the following steps: (1) raw material processing, that is cleaning and beating kiwifruit, adding pectase, performing enzymolysis at 15-60 DEG C for 1-24 h to obtain kiwifruit syrup, filtering the kiwifruit syrup to obtain kiwifruit juice; (2) yeast activation and expanding culture; (3) acetobacter rancen seed expanding culture; (4) alcoholic fermentation; (5) acetic acid fermentation; (6) aging; (7) clarification, sterilization, and packaging. The invention is simple in process; kiwifruit is rich in vitamins; vinegar brewed by kiwifruit can be used not only as a high-grade flavoring, but also as a beverage with unique taste; the kiwifruit vinegar has moderate sour and sweet taste, unique mouthfeel, and also has good health care effect.

The invention discloses a grafting method for a kiwi tree, comprising the following steps: the trunk of a kiwi tree with the tree age more than 5 years is sawn off in the period of the end of November and the middle of December of the first year, the kiwi tree grows to the middle of the second year, the trunk of the kiwi tree is sawn off to reach the height of 100-120 cm, scions from a robust kiwi tree are selected and grafted onto the kiwi tree with the sawn-off trunk, grafting incisions are bandaged, and the grafting is finished. Through the grafting method, the disadvantage that a main stem branch is poor in renewability existing in the grafting of kiwi trees with the tree age more than 5 years is solved, the replacement pace of tree spices is accelerated, the trees are quick in recovering growth vigor, the diseases are less, and the fruiting capacity of cultured branch groups is strong.

The invention discloses a green high-yield kiwi fruit planting method. The green high-yield kiwi fruit planting method comprises the steps of seedling raising and grafting, cultivation management, soil management, water and fertilizer management and harvesting management. Therefore, by means of green and environmental planting techniques and planting materials, the green high-yield kiwi fruit planting method guarantees the flavor of kiwi fruits and meanwhile improves the eating safety of the kiwi fruit, thereby being more beneficial to people usage.

The invention belongs to the technical field of molecular biology and genetic breeding and specifically relates to molecular marker primers for identification of a Moshan series of male cultivars of kiwi fruits and an application thereof. The molecular marker primers provided by the invention are Geo15-115-F: CGAAGAAACAGGAAAGAGAATCG and Geo15-115-R: GGCACGGTGTACACCAGGAG. The primers can accurately distinguish and identify Moshan series of male cultivars of kiwi fruits and distinguish other species, have the universality of identification and are suitable for large-scale promotion.

The present invention relates to a passion fruit-kiwi fruit composite juice and a preparation method thereof. The juice comprises 20-30% of a fruit-kiwi fruit juice, 10-15% of a kiwi fruit juice, 3-5% of honey, and the balance of water. The preparation method comprises: cleaning and cutting the passion fruit; taking the flesh with seeds; carrying out juicing on the flesh with seeds; cleaning the kiwi fruit; removing peel and carrying out juicing on the flesh of the kiwi fruit; uniformly mixing the resulting two juices; heating to a temperature of 20-60 DEG C; adding pectinase and amylase to carry out an enzymolysis treatment; adding water and honey to the filtered juice to adjust the taste; adopting a bacteria removal filtration membrane to remove partial bacteria; carrying out homogenizing and degassing on the bacteria-removed juice; carrying out vacuum packaging; and carrying out hyperpressure sterilization to perform an enzyme inactivation treatment to obtain the composite juice. With the preparation method of the present invention, the unique flavor of the passion fruit and the kiwi fruit fragrance can be maintained, the produced juice has characteristics of original juice remaining, original taste remaining, natural and persistent fragrance, and pure flavor, the juice quality is improved, and the pursuit of the majority of consumers on the natural juice is met.

The invention discloses a planting method for high-yield kiwi fruit. The planting method includes the following steps of 1 garden plot planning, 2 field planting preparing, 3 shed frame building, 4 kiwi fruit field planting, 5 kiwi fruit pollinating, 6 kiwi fruit clipping, 7 water and fertilizer managing on the kiwi fruit and 8 kiwi fruit managing. The planting method is beneficial for increasing the planting yield of the kiwi fruit, improving the quality of the kiwi fruit and increasing economic benefits.

The invention relates to a preservative technique for fresh kiwifruit, which comprises technique processes of cold storage disinfection, precooling, bagging, air regulate case vacuum pumping, air distribution, preservation and unhouse packaging. The technique of the invention carries out laboratory study test on the storage of the fresh kiwifruit, the test shows that the kiwifruit can be preserved for more than 200 days with average fruit firmness more than or equal to 3.0kg / cm<2>, fruit firmness rate more than or equal to 90 percent, commercial fruits rate more than or equal to 95 percent, Vc keeping-rate more than or equal to 80 percent and freshness index more than or equal to 0.90. Pilot scale study was carried out in an air conditioned storehouse in Zhouzhi County Shanxi Province in 2006 by the technique of the invention to store 50 tons of Hayward kiwifruit for 215 days with commercial fruits rate of 96 percent. The invention has the advantages of simple operation, long preservation period, good preservation effect, no environmental pollution, obvious economic benefit, etc., which can be widely applied.

The invention discloses a high-ridge cultivation method of Chinese gooseberries, which comprises steps of flattening soil; ridging, wherein space between ridges is controlled to be 6-8m, the height of the ridges is 0.5-0.6m, the ridges are formed by using improved surface soil and ladder-shaped, and ridges are smashed; planting, wherein the upper parts of the ridges are dug to be used for planting, and strong Chinese gooseberry seedlings are chosen to be planted; planting the seedlings in the center parts of furrows, tamping earthing soil, and fully watering seedlings with rooting water; after the surface soil of the ridge furrows and an organic fertilizer are mixed, digging the mixture of the surface soil and the organic fertilizer out and piling to the ridge sides to make the height of the ridges reach 0.9 m to 1 m; and fertilizing and earthing up according to the growth conditions of the Chinese gooseberry seedlings. The high-ridge cultivation method is simple in operation. The purpose of limiting the root region can be achieved by reducing the cost, the influence of overhigh ground water level to the Chinese gooseberry growth is avoided and the fruit quality is greatly enhanced.

The invention discloses a dealcoholic enzyme and a production process thereof. The dealcoholic enzyme is formed by mixing and fermenting raw materials of honey, flower fruits and mineral water and added saccharomycetes, acetobacter and lactobacillus, wherein the flower fruits comprise flos puerariae, kudzuvine root and hovenia acerba as well as one or several of green papaya, banana, kiwi fruit and lemon, wherein the mass ratio of the honey to the flower fruits to the mineral water is 1.4:4:10; the flower fruits comprise the following raw materials in percentage by weight: 15-20 percent of flos puerariae, 10-25 percent of kudzuvine root and 30 percent of hovenia acerba as well as one or the combination of several of the green papaya, the banana, the kiwi fruit and the lemon. The dealcoholic enzyme disclosed by the invention has good mouth feeling, abundant nutrition and health-care action, and can be used for dispeling the effects of alcohol and daily heath care and health preservation.

The invention provides a method of rapid breeding of kiwi fruit with large seed by tissue culture. The invention comprises steps of selecting and treating explant, inducing culture medium, root culturing and replanting, etc. The invention takes MS culture medium as basis and adds BA, NAA, GA, ZT and other external plant growth regulator to induce the growth of axillary bud of the said kiwi fruit and strengthen sprout and root. The root growth rate is as high as 100%, the average bud height is 6.28 cm and the average replanting survival rate is 91% after 35 days culture. The invention solves the technique problem of rapid breeding of said kiwi fruit and provides a method of short period, high breeding rate and low cost for the industrial production of kiwi fruit with large seed.

A special fertilizer for Chinese goosebeery is prepared by oxidizing and modifying humic acid into humate and adding nitrogenous fertilizer, phosphorus fertilizer and potash fertilizer. The preparation process comprises the following steps: (1) humic acid modification: oxidizing humic acid material with oxidizing acid and adding sulphite for modification to obtain humate; (2) chelation: adding potash fertilizer and compound fertilizer auxiliary material into the humate, and leading steam into a reaction kettle, heating to more than 80 DEG C and preserving the temperature for chelation for more than 8 h; (3) mixing: after the chelation, adding nitrogenous fertilizer and phosphorus fertilizer and mixing; and (4) thickening: adding micro conditioner for thickening, measuring and packing. In the invention, through adding modified HA salt, the original special fertilizer (M fertilizer) for Chinese goosebeery is further processed, and the pure inorganic fertilizer in the M fertilizer is changed into an organic-inorganic compound fertilizer with different characteristic, so that the operating factor of the fertilizer is improved by 14 percent through the fertilizer modification.

The invention is related to pure natural fruits and vegetables and Chinese medicine beautifying & skin care article and its way of use, relating to preparation by selection of pure fruits, vegetables and edible Chinese medicine, and comprising said materials components according to weight ratio as follows, ( unit: g ) ginseng 4-8, almond 5-10, safflower 8-15, Chinese angelica 4-10, mulberry leaves 5-10, peony 1-5, bezoar 0.1-0.3, rose 6-10, pearl powder 10-30, Chinese flowering quince 4-10, celery 10-20, flour 30-60, olive oil 5-10, etc.

The invention discloses a cultivation method for the root stock grafting of Actinidia chinensis Planch, comprising the grafting and cultivating steps of cultivating parental stock and selecting a shoot bud that is used for producing Actinidia chinensis Planch as an ear bud. The invention is characterized in that in the cultivation step of the parental stock, the selected root stock material is Actinidia polygama (alias: sky-high polygonum; plant name: silvervine; Latin name: Actinidia polygama). The Actinidia polygama is a wild plantlet which is collected from the investigation of a deep ravine everglade with the elevation of 1500 meters, has a highly-developed fiber root system, shows strong appetency to the grafting of Actinidia chinensis Planch and is a completely new parental stock breed. Compared with the prior art, the invention has the advantages of strong resistance abilities of cold, drought, saturation and canker, low soil requirements, good adaptability, convenient cultivation and management, simple soil displacement, low investment and low cost, etc.; furthermore, the invention can implement asexual propagation and is favorable for the sustainable and protective utilization of wide plant resources.

The invention discloses a method for quickly improving the outplanting rate of culture of kiwi fruit seedlings. The method has the technical characteristics that seeds of delicious kiwi fruits (i.e. the hairy variety) are adopted. The method comprises the steps of: sterilizing soil of a seedbed five to seven days before sowing, and soaking the seeds in water with the temperature of 50-60 DEG C for two to three hours before sowing; sowing in the middle ten days and the last ten days of January, transplanting at the appropriate time of the last ten days of March and the first ten days of April when young seedlings have four to five leaves, extirpating one to two knots at the tips of rootstocks in the first ten days of June, removing coppice shoots 5-10cm at the base parts of seedling trunks in time to guarantee smoothness of the parts of the seedlings to be grafted, grafting single-bud branches at the venter of the rootstocks in the first ten days and the middle ten days of June to the first ten days and the middle ten days of July, breaking the rootstocks off in the last ten days of July and the middle ten days of August, reserving four to five knots above engrafting buds, and breaking off the rootstocks with only barks remained; shearing the rootstocks in the first ten days of September, reserving 4-5cm stumps during stock shearing, removing buds of the rootstocks in time after stock shearing, removing the buds and shearing the coppice shoots as soon as the buds and coppice shoots are come out, and promoting the grafting buds to grow vigorously in combination with the supply of fertilizers and water; and making the kiwi fruit seedlings reach the standard of outplanting at the end of the same year, wherein the rate of outplanting in the same year reaches 80 percent to 90 percent.