138 results about "Oleanane" patented technology

The invention discloses an oleanane-type triad compound, and also provides its preparation method and medical application. Acid phosphatase 1B activity of oleanane-type (oleanane-type) triad compounds, structure: R1 is hydroxyl, acetoxy, R2 is carboxyl, hydroxymethylene, R3 is methyl, carboxyl, R4 For carboxyl, methyl. Multiple in vitro protein tyrosine phosphatase 1B inhibition experiments show that the compound has obvious PTP1B inhibitory activity and can be used in the preparation of medicines for diabetes, obesity and complications.

The invention relates to a centella asiatica triterpenic acid single-glucopyranoside composition which is composed of ursane madecassic acid single-glucopyranoside, madecassic acid single-glucopyranoside and oleanane chebuloside II, wherein the mass ratio of ursane madecassic acid single-glucopyranoside to madecassic acid single-glucopyranoside to oleanane chebuloside II is 1:0.5-2:0.1-1, and the sum of the mass percentage content of three components is not less than 50%. The composition takes a centella asiatica extract as a substrate, the centella asiatica extract is fermented and hydrolyzed by microbes of beta-glucosidase or microbes capable of generating beta-glucosidase, and extracted by n-butanol or separated and purified by macroporous adsorption resin. The invention also provides a quantitative analysis method which is a HPLC quantitative analysis for three components by adding a proper amount of mobile phase of beta-cyclodextrin. Experimental research of pharmacodynamics proves that the composition has substantial activity for inhibiting tumor cells and fibroblast, the composition can be used for treating tumor and scar hyperplasia.

The invention discloses derivatives of 3-O-caffeoyloleanane type pentacyclic triterpene represented by general formula (I) in the specification (R1 and R2 in the general formula (I) are selected from -CH3, COOH, COOQ, CONQ2, or COSQ, wherein Q is hydrogen, alkyl, substituted alkyl, aryl, or substituted aryl; X is -C=O or CH2; and Y-Z is -CH2-CH2-, cis-CH=CH-, or trans-CH=CH-), a preparation method thereof, and pharmaceutically acceptable esters or salts thereof. The invention also discloses a medicinal composition. The composition comprises an effective dose of the derivatives of 3-O-caffeoyloleanane type pentacyclic triterpene or the pharmaceutically acceptable esters or salts thereof, and pharmaceutically acceptable carriers thereof. The invention also discloses an application of the derivatives of 3-O-caffeoyloleanane type pentacyclic triterpene or the pharmaceutically acceptable esters or salts thereof in the preparation of anti-inflammatory medicines, antiallergic medicines, liver protection medicines, antivirus medicines and the like.

The present invention relates to the use of oleanane-type triterpene saponin compounds, which are effective for improving memory and learning ability, as an effective ingredient of drugs for the treatment and prevention of dementia and mild cognitive impairment and health foods for the improvement of brain functions including cognitive function.

The invention belongs to the field of pharmacy of traditional Chinese medicines, relating to an extract of effective parts of total saponins in pterocephalus hookeri as well as a preparation method and application thereof. By taking the content of the total saponins in the pterocephalus hookeri as an index, the extract of the total saponins in the pterocephalus hookeri provided by the invention has the characteristics of high content of the total saponins, controllable and stable quality and obvious drug effect. The main component of the extract is oleanane type pentacyclic triterpene saponins, and the content of the total saponins is 50%-90%. The preparation method provided by the invention is economical and simple in extraction technique and is applicable to industrial production. The obtained extract has obvious function of restraining the tumor cell proliferation, and can be applied in preparation of anti-tumor drugs.

The invention discloses a novel organic salt-a berberine glycyrrhizic acid enantiomer salt which can be used for medicine, and a preparation method and usage thereof. The chemical name of the berberine glycyrrhizic acid enantiomer salt is 5,6-dihydro-9,10-dimethoxy-benzo (g)-1,3-benzo-dioxolane[5,6-a]quinolizidine.18a(beta),20beta-carboxy-11-oxo-30-norolean-12-alkene-3beta-yl-2-O-beta-D-glucopyranuronosyl-a-D-glucopyranosiduronic acid. The preparation method comprises the steps that berberine hydrochloride is dissolved with water according to the pharmaceutical co-crystal principle, anion exchange resin is added, then the mixture is stirred for one hour and filtered, the filtrate is put into a water solution of a glycyrrhizic acid enantiomer and stirred for 30 minutes for centrifugation, the precipitate is dissolved in ethanol, and decompression is carried out to remove the solvent to get the berberine glycyrrhizic acid enantiomer salt. The organic salt with double mother nucleuses has practical significance for human in resisting diabetes, hyperlipidemia, tumor and chronic inflammatory diseases of rheumatoid arthritis, hepatitis, Alzheimer and the like and developing the medical industry.

The present invention provides practical GOTCAB saponin synthesis process. The synthesis process includes the following steps: connecting site-28 glucose chain; connecting site-3 glycosyl; connecting rest site-3 glycosyl after protecting radical operation; making site-6' hydroxy group empty via protecting radical operation; selectively oxidizing site-6' primer hydroxy group into carboxylic acid; and finally eliminating all the protecting radicals under alkali condition.

The invention discloses a wedelia trilobata anti-tumor extract and preparation and application methods thereof. The wedelia trilobata anti-tumor extract is prepared by adding solvent into wedelia trilobata powder for extraction, filtering and decompression-concentrating extracted liquor to obtain a total extract, mixing the total extract with water into a suspension, performing extraction sequentially through petroleum ether and ethyl acetate and performing decompressed recovery to obtain a petroleum ether solution, an ethyl acetate solution and a aqueous solution, wherein the petroleum ether solution contains one eudesmene type sesquiterpene lactone, five enantiotopic kaurane type diterpenoid compounds, two oleanane type triterpenes, one cycloartane type triterpene, one sterol compound, two dipeptide compounds and one caffeate compound. The prepared wedelia trilobata anti-tumor extract is high in yield, simple in technical process, low in cost and applicable to large-scale preparation, and meanwhile, has broad-spectrum anti-tumor activity and can serve as an active component applied to tumor control and treatment drugs.

The invention discloses an application of panax japonicus beta-amyrin synthase gene Pjbeta-AS, which is the application of the panax japonicus beta-amyrin synthase gene Pjbeta-AS for promoting the Panax notoginseng cells to synthesize oleanolic saponin, and a nucleotide sequence of the panax japonicus beta-amyrin synthase gene Pjbeta-AS is shown in SEQ ID NO: 1. Gene cloning is used to obtain thepanax japonicus beta-amyrin synthase gene Pjbeta-AS; a plant expression vector containing the Pjbeta-AS gene is constructed; the above vector is used for transforming Agrobacterium tumefaciens EHA105to obtain a strain of Agrobacterium tumefaciens containing the gene; the Panax notoginseng cell strain is transformed with the Agrobacterium tumefaciens strain, and the Panax notoginseng cell which positively transfects the Pjbeta-AS gene is obtained, the type and content of the main oleanolic saponin in the transgenic Panax notoginseng cells can be detected; in the transgenic Panax notoginseng cell obtained by the present invention, and the contents of the panax japonicas IV and the panax japonicus IVa belonging to the oleanolic saponin are 0.20 mg / g and 0.42 mg / g respectively.

The invention provides a preparation method of 2alpha, 3beta-dihydroxyl oleanane-13(18)-ene-28-acid and an application of 2alpha, 3beta-dihydroxyl oleanane-13(18)-ene-28-acid in preparing an antibacterial agent. A potent antibacterial agent (medicine) is extracted and separated from Rosaceae Rose fructus rosae laevigatae widely distributed in China. The acid is abundant in plant source and convenient to extract. The plant is not damaged but utilized for a long time when plant fruits are extracted. The acid provided by the invention is environmentally-friendly and has better economic benefit. The monomer compound product is stable and easy to store. The acid is wide in bacteriostatic activity spectrum and high in bacteriostatic activity, can be further developed as an effective and safe antibacterial agent of foods such as fruits and vegetables and novel anti-infection medicines, and has good market prospect.

The invention relates to an 18Alpha-glycyrrhetinic acid o-phthalate, a method for preparing the 18Alpha-glycyrrhetinic acid o-phthalate and the application thereof in drugs. The invention aims at providing an 18Alpha-glycyrrhetinic acid o-phthalate which has safe use, strong pharmacological activity, and fast effect, and a method for preparing the 18Alpha-glycyrrhetinic acid o-phthalate; and the method has the advantages of simple process, and high product quality and yield. The technical proposal provided by the invention is as follows: the 18Alpha-glycyrrhetinic acid o-phthalate is characterized by being a pentacyclic triterpenoid derivative of o-phthalic acid which has the chemical name of 3-(1-carboxy-2-oxidation phenoxy)-11-O-18Alpha-oleanane-12-ene-29-formate, the molecular weight of 618.8, and the molecular formula of C38H 50O7 question mark R.

The invention relates to the field of pharmacy, in particular to a synthesis method of 13 (18)-oleanane-type pentacyclic triterpene as shown in a formula II and derivatives or pharmaceutically acceptable salts or esters of the 13 (18)-oleanane-type pentacyclic triterpene by 12-oleanane-type pentacyclic triterpene as shown in a formula I and derivatives of the 12-oleanane-type pentacyclic triterpene. Definitions of R1-9 are as shown in specification.

The invention relates to oleanane saponin compounds aescin A and aescin B extracted and separated from aesculus carnea, and a purpose thereof. The oleanane saponin compounds have a chemical general formula as the following. The R group represents =O or -OH. As a result of experiments, the compounds has activities such as malignant tumor inhibiting, body immunity improving, liver disease preventing and curing, cardio-cerebrovascular disease preventing and curing, and diabetes mellitus preventing and curing. The invention provides novel medicine resources for treating malignant tumors, improving body immunities, and preventing and curing liver diseases, cardio-cerebrovascular diseases or diabetes mellitus.

The invention discloses a panax japonicas beta-amyrin synthase gene and an application thereof. The panax japonicas beta-amyrin synthase gene is obtained by using a positive primer P1:5'ATGTGGAAGCTTAAGATAGCGGA3' and a reverse primer P2:5'TTAGGTGCCAAGGGACGGTGAT3', and taking a panax japonicas cDNA library as a template to amplify; the sequence of the panax japonicas beta-amyrin synthase gene is as shown in SEQIDNO.1. The panax japonicas beta-amyrin synthase gene is introduced into the panax japonicas by agrobacterium-mediated genetic transformation, so that the content of oleanane type saponin in the panax japonicas is increased.

The present invention belongs to the field of organic chemistry and relates to a multi-substituted hydrogenated naphthalene compound, the preparation methods and uses. Specifically, the present invention relates to a chiral multi-substituted ten-hydrogen and / or eight-hydrogen naphthalene compound, the synthetic method and uses. The present invention aims to provide a chiral multi-substituted ten-hydrogen and / or eight-hydrogen naphthalene compound; the oleanane-type or usu-type five-ring triterpenoid compound is used as a raw material for preparing the compound. The multi-substituted ten-hydrogen and / or eight-hydrogen naphthalene compound of the present invention can be used for synthesis of drugs or spices containing multi-hydrogen naphthalene fragments and the analogues. The method of the present invention is simple and easy, low in cost, high in production rate, and can realize industrialization.

The invention discloses a compound 2-hydroxyl-3-carbonyl-23-oleanolic acid-1,4,12-triene-28-acid as well as a preparation method and application of the compound preparation of a glycosidase inhibitor medicine. An alpha-glucosidase inhibitor with high efficiency is extracted and separated from an akebia plant, a plant material is rich in source, an extraction preparation method is easy to operate, the plant can be used for a long time without being damaged when extraction is performed by adopting a plant fruit, and thus the economic benefit can be increased, and the environment friendliness is achieved; the monomeric compound is stable and easy to store. Pharmacological experiments prove that the inhibitory activity of the compound 2-hydroxyl-3-carbonyl-23-oleanolic acid-1,4,12-triene-28-acid is stronger than that of a first-grade diabetes drug acarbose by about 16 times, and thus the compound 2-hydroxyl-3-carbonyl-23-oleanolic acid-1,4,12-triene-28-acid can be expected to be further developed into a medicine for clinically treating type 2 diabetes mellitus and is good in prospect.

The invention belongs to the technical field of plant extraction and analysis, and particularly relates to an actinidia arguta root extract as well as an extraction and separation method and application thereof. The extract comprises the following 21 chemical components: 21 chemical components; the invention discloses a preparation method of 7-O-[beta-D-xylose pyranosyl-(1-6)-beta-D-glucopyranoside]-1, 2, 4, 5, 6, 7-O-[beta-D-xylose pyranosyl-(1-6)-beta-D-glucopyranoside]-1. The preparation method comprises the following steps: preparing 2, 8-dihydroxy-3-methoxy-ketone; 3-O-[beta-D-rhamnose-(1-6)-beta-D-galactopyranoside]-5, 7, 3 ', 4'-tetrahydroxy flavone, catechin, beta-sterol, quercetin, isoquercitrin, oleanolic acid, ursolic acid, 2alpha, 3beta-dihydroxy oleanane-12 alkene-28 acid, 2alpha, 3alpha, 24-trihydroxy ursolic acid and the like. The extract provided by the invention has a good application prospect in preparation of anti-cancer drugs for improving the advanced living standard of cancer patients.

The invention discloses a 3-monouronic acid o-glycoside oleanane type and ursane type triterpenoid saponin derivative. The derivative has a structural formula as shown in the specification, wherein R4 is one of H atom, alkyl containing 1-10 carbons, alkyl amido containing 1-10 carbons, aryl containing 6-11 carbons and saturated or unsaturated ring containing 3-7 carbon atoms. According to the preparation method, oleanolic acid or ursolic acid is used as a lead compound, and is structured to synthesize a novel 3-monouronic acid o-glycoside oleanane type and ursane type triterpenoid saponin derivative. The synthesizing method is simple and convneient, the product has high purity, and the anti-arrhythmia activity of the 3-monouronic acid o-glycoside oleanane type and ursane type triterpenoid saponin derivative is remarkably enhanced by means of structure transformation. The 3-monouronic acid o-glycoside oleanane type and ursane type triterpenoid saponin derivative has a relatively good cardiac muscle protecting effect.

The invention discloses new 2-hydroxy-3-carbonyl-23, 29-dinorolean-1, 4, 12, 20 (30)-tetraene-28-acid, a preparation method thereof and an application in preparation of glucosidase inhibitor medicines. An alpha-glucosidase inhibitor with strong effects is extracted and separated from an akebia plant, and plant sources are rich. Furthermore, when fruit extraction is performed, the plant can not be damaged and can be utilized for a long time, so that economic benefits are improved, and the environment-friendly effect is further achieved. Pharmacological experiments show that the in-vitro alpha-glucosidase inhibition activity of the compound, namely 2-hydroxy-3-carbonyl-23, 29-dinorolean-1, 4, 12, 20 (30)-tetraene-28-acid is about 5 times of that of a first-line diabetes medicine, namely acarbose, so that the compound is expected to be used for developing medicines for preventing and treating type II diabetes and has good application and development potentials.

The invention discloses oleanane type triterpenoid saponin as well as extraction and separation method and application thereof. A spectrum technology shows that the oleanane type triterpenoid saponinis a novel compound which is separated from nigella glandulifera. The invention discloses a method for extracting and separating oleanane type triterpenoid saponin from the nigella glandulifera, totalsaponins are obtained after primary extraction and separation with 70% ethanol, the total saponins are fed through a silica gel spectrum column to prepare a crude product of oleanane type triterpenoid saponin, and through separation and purification operation of Sephadex LH-20 gel column and high performance liquid chromatography, a target compound NGTS can be successfully separated. The invention further discloses that the oleanane type triterpenoid saponin has an anti-tumor function, in-vitro anti-tumor experiment shows that the compound has a remarkable inhibition function on stomach cancer cells and glioma cells, and results show that the compound can be further studied and developed as a novel anti-tumor medicine.

The invention provides oleanane-type triterpenoid saponin compounds as shown in the structural formula (I). In the structural formula (I), R1 represents alpha-L-rhamnose-(1->2)-alpha-D-galactose-(1->2)-beta-D-glucuronic acid, or beta-D-glucose-(1->3)-[alpha-L-rhamnose-(1->2)]-alpha-D-galactose-(1->2)-beta-D-glucuronic acid; R2 is replaced by glucose or hydrogen. The invention further provides combinations of the oleanane-type triterpenoid saponin compounds, plant extracts containing the oleanane-type triterpenoid saponin compounds, preparation methods of the oleanane-type triterpenoid saponin compounds, the oleanane-type triterpenoid saponin compounds and the plant extracts, and application of the oleanane-type triterpenoid saponin compounds, the plant extracts and the compositions to the field of sweeteners. Researches on folk characteristic medicinal plants in Yunnan show that the sweetness of Dai medicine derris eriocarpa How. is obvious; via gustation activity-guided isolation, the oleanane-type triterpenoid saponin compounds of high sweetness are separated from derris eriocarpa How.

The invention provides an oleanane derivative whose C ring is provided with carbonyl and oxygen substituent, represented as formula (1). The inventive compound can inhibit the growth activity of tumor cell, thereby bing applied in the preparation of anti-tumor drug and can inhibit mice ear swelling caused by dimethylbenzene, thereby being applied in the preparation of anti-inflammatory agent. The formula (1) is represented as above.

The invention relates to an oleanolic acid glucuronyltransferase, a coding gene and an application thereof, belonging to the field of plant genetic engineering and biotechnology. The amino acid sequence of the oleanolic acid glucuronyltransferase of the present invention is shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4. A nucleotide sequence is shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8. The oleanolic acid glucuronyltransferase of the invention can specifically take uridine diphosphoglucuronic acid as a glycosyl donor and catalyze the glycosylation of oleanolic acid C-3 to produce oleanolic acid 3-O-beta-Glucuronic acid. This enzyme is the upstream step in the synthesis of oleanolic saponins, which is of great significance for the elucidation of the synthetic pathway of oleanolic saponins.

The invention discloses a triterpene compound as well as a preparation method and application thereof, and belongs to novel compounds and medicinal application thereof. The novel triterpene compound alpha-cyclopentenolone-21,22-co-3, 10-epoxy-5-hydroxy- oleanane- 19, 22-bis [2, 2, 0] cyclohexane named as pericarpium juglandis triterpene ketone A is obtained by extracting, separating and purifyingfresh peel of pericarpium juglandis by method of combination of extracting with an organic solvent, treating with Girard reagent and column chromatography and the like. The novel triterpene compound has a relatively good effect of inhibiting tumor cell growth through experiments, and has an application prospect in the aspect of anti-tumor.

The invention relates to a gel taking 3 beta, 12, 13- trihydroxy- oleanane-28-acid as active ingredient, and provides a gel composition. The gel is characterized by containing the 3 beta, 12, 13- trihydroxy- oleanane-28-acid (I) taken as the active ingredient as well as one or more auxiliary material(s) which can be applicable to the gel, and the content of the 3 beta, 12, 13- trihydroxy- oleanane-28-acid in the gel composition is 0.01-2%.

The invention belongs to the field of organic chemistry and relates to a polysubstituted decalin compound, and a synthesis method and an application thereof. The structural formula of the polysubstituted decalin compound is shown above. The preparation of the polysubstituted decalin compound includes septs as follows: AB fragment which is obtained by the c-bond cleavage of an oleanane type or an ursolic alkane type pentacyclic triterpenoid compound is treated with different reduction methods to obtain a compound 2 or 3. The polysubstituted decalin compound of the invention is used to synthesize the medicine or the apice and the analogues which contain the structural fragment of the polysubstituted decalin. The invention has the advantages of simplicity, practicability, low cost, high yield and being capable of industrialization.

The invention discloses a preparation method of a novel oleanane triterpenoid saponin derivative. The preparation method comprises the following steps: (1) adding glycyrrhizic acid into an ionic liquid and fully dissolving the glycyrrhizic acid in proportion to prepare a glycyrrhizic acid dissolved liquid; (2) adding concentrated sulfuric acid in proportion into the dissolved liquid, and after reaction, adjusting the pH value and separating an aqueous liquid from the system; and (3) performing concentration and crystallization of an organic solvent to obtain the oleanane triterpenoid saponin derivative. The preparation method disclosed by the invention is mild in reaction condition and high in yield, can be recycled and is suitable for industrial production.

The invention provides an application of an oleanane type pentacyclic triterpene ester derivative in preparation of a medicine for delaying aging and treating aging disease, and the medicine is prepared by a pharmaceutical acceptable carrier or an excipient of the oleanane type pentacyclic triterpene ester derivative. The oleanane type pentacyclic triterpene ester derivative can obviously prolong the activity of yeast replicability life, and be used for preparing the medicine for delaying aging and treating aging disease. A structural formula of the oleanane type pentacyclic triterpene ester derivative is shown as following.

The invention provides an 11-bromo-12-olefin oleanane type pentacyclic triterpene compound, which has a structure as shown in formula (1). The compound has certain inhibition tumor cell growth activity, and can be used to make drugs for preventing and curing tumor diseases. Moreover, the compound has remarkable inhibition action on mice ear tumescence caused by toluene, and can be used to make anti-inflammatory agents. The structural general formula of the 11-bromo-12-olefin oleanane type pentacyclic triterpene compound as shown in formula (1) is shown in the graph.