Panax japonicas beta-amyrin synthase gene and application thereof
A gene and amino acid technology is applied in the field of cloning and application of β-aromaticin synthase gene in Bamboo ginseng, which can solve the problems of long growth cycle of artificially cultivated medicinal materials and short supply in the market.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Transcriptome sequencing and data analysis of Panax ginseng
[0034] 1. Sample collection
[0035] The plants of Panax ginseng come from Enshi, Hubei. The rhizomes, leaves, flowers, and fruits are taken from them and put into liquid nitrogen for quick freezing, and then stored in a -80°C refrigerator for later use.
[0036] 2. Isolation and detection of total RNA of Panax ginseng
[0037] Fully grind all kinds of samples stored at -80°C in liquid nitrogen, and then use the optimized Trizol method to extract total RNA from the samples. The whole process is guaranteed to be carried out under low temperature conditions, and a certain concentration of PVP solution (polyvinylpyrrolidone) is added. , and appropriately increase the concentration of β-mercaptoethanol. After removing PVP and β-mercaptoethanol by centrifugation, use high-concentration NaAc solution to precipitate RNA, and DNase to remove residual DNA to complete RNA purification. The integrity of the RNA was de...
Embodiment 2
[0043] Cloning of β-Aryllin Synthase Gene from Panax japonicus
[0044]Use the forward primer P1: 5'ATGTGGAAGCTTAAGATAGCGGA3'; the reverse primer P2: 5'TTAGGTGCCAAGGGACGGTGAT3' to amplify the cDNA library of the rhizome of Panax japonicus as a template. Anneal for 1 min, extend at 72°C for 90 s, after 40 cycles, extend at 72°C for 10 min to clone the full-length sequence of the candidate gene, link it to the cloning vector pMD18-T and transform it into E. coli competent cells E.coli DH5α, the steps are as follows:
[0045] a) Take 100 μL of competent cell suspension from a -80°C ultra-low temperature refrigerator, thaw and place on ice;
[0046] b) Add 5 μL of the ligation product, gently blow and mix with a pipette, and ice-bath for 30 minutes;
[0047] c) Heat shock at 42°C for 90s, then place on ice for 5 minutes;
[0048] d) Add 1mL LB liquid medium (without antibiotics) to the EP tube, 37°C, 200rpm, 45min;
[0049] e) After shaking the bacteria, take 100 μL of the bact...
Embodiment 3
[0053] Bioinformatics analysis of PJβAS gene
[0054] The total length of the Panax japonicus β-amyrin synthase (PJβAS) gene involved in the present invention is 2292bp, its sequence is shown in SEQ ID NO.1, wherein the open reading frame is located at 1-2292bp, and the encoded protein sequence is SEQ ID NO.1 Shown in ID NO.2. Blast the full-length sequence of β-amyrin synthase that has been spliced and analyzed in the NCBI database. The gene has a typical ISOP REN_C2_like superfamily domain, such as figure 2 .
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com