Panax japonicas beta-amyrin synthase gene and application thereof

A gene and amino acid technology is applied in the field of cloning and application of β-aromaticin synthase gene in Bamboo ginseng, which can solve the problems of long growth cycle of artificially cultivated medicinal materials and short supply in the market.

Inactive Publication Date: 2014-12-17
黄璐琦 +11
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Bamboo ginseng is a species recorded in the Chinese Pharmacopoeia, which has broad application prospects and considerable economic value. At present, the wild resources of Chinese bamboo ginseng are close to extinction, and the artificial cultivation of medicinal materials has a long growth cycle, resulting in the current situation that the market is in short supply.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Panax japonicas beta-amyrin synthase gene and application thereof
  • Panax japonicas beta-amyrin synthase gene and application thereof
  • Panax japonicas beta-amyrin synthase gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Transcriptome sequencing and data analysis of Panax ginseng

[0034] 1. Sample collection

[0035] The plants of Panax ginseng come from Enshi, Hubei. The rhizomes, leaves, flowers, and fruits are taken from them and put into liquid nitrogen for quick freezing, and then stored in a -80°C refrigerator for later use.

[0036] 2. Isolation and detection of total RNA of Panax ginseng

[0037] Fully grind all kinds of samples stored at -80°C in liquid nitrogen, and then use the optimized Trizol method to extract total RNA from the samples. The whole process is guaranteed to be carried out under low temperature conditions, and a certain concentration of PVP solution (polyvinylpyrrolidone) is added. , and appropriately increase the concentration of β-mercaptoethanol. After removing PVP and β-mercaptoethanol by centrifugation, use high-concentration NaAc solution to precipitate RNA, and DNase to remove residual DNA to complete RNA purification. The integrity of the RNA was de...

Embodiment 2

[0043] Cloning of β-Aryllin Synthase Gene from Panax japonicus

[0044]Use the forward primer P1: 5'ATGTGGAAGCTTAAGATAGCGGA3'; the reverse primer P2: 5'TTAGGTGCCAAGGGACGGTGAT3' to amplify the cDNA library of the rhizome of Panax japonicus as a template. Anneal for 1 min, extend at 72°C for 90 s, after 40 cycles, extend at 72°C for 10 min to clone the full-length sequence of the candidate gene, link it to the cloning vector pMD18-T and transform it into E. coli competent cells E.coli DH5α, the steps are as follows:

[0045] a) Take 100 μL of competent cell suspension from a -80°C ultra-low temperature refrigerator, thaw and place on ice;

[0046] b) Add 5 μL of the ligation product, gently blow and mix with a pipette, and ice-bath for 30 minutes;

[0047] c) Heat shock at 42°C for 90s, then place on ice for 5 minutes;

[0048] d) Add 1mL LB liquid medium (without antibiotics) to the EP tube, 37°C, 200rpm, 45min;

[0049] e) After shaking the bacteria, take 100 μL of the bact...

Embodiment 3

[0053] Bioinformatics analysis of PJβAS gene

[0054] The total length of the Panax japonicus β-amyrin synthase (PJβAS) gene involved in the present invention is 2292bp, its sequence is shown in SEQ ID NO.1, wherein the open reading frame is located at 1-2292bp, and the encoded protein sequence is SEQ ID NO.1 Shown in ID NO.2. Blast the full-length sequence of β-amyrin synthase that has been spliced ​​and analyzed in the NCBI database. The gene has a typical ISOP REN_C2_like superfamily domain, such as figure 2 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a panax japonicas beta-amyrin synthase gene and an application thereof. The panax japonicas beta-amyrin synthase gene is obtained by using a positive primer P1:5'ATGTGGAAGCTTAAGATAGCGGA3' and a reverse primer P2:5'TTAGGTGCCAAGGGACGGTGAT3', and taking a panax japonicas cDNA library as a template to amplify; the sequence of the panax japonicas beta-amyrin synthase gene is as shown in SEQIDNO.1. The panax japonicas beta-amyrin synthase gene is introduced into the panax japonicas by agrobacterium-mediated genetic transformation, so that the content of oleanane type saponin in the panax japonicas is increased.

Description

technical field [0001] The invention belongs to the field of biotechnology, and mainly relates to the cloning and application of the β-amyrin synthase (β-amyrin synthase) gene in Panax ginseng, Background technique [0002] Bamboo ginseng (Panax japonicus C.A.Mey) belongs to the Araliaceae Panax L. plant is one of the traditional precious Chinese medicinal materials, with high medicinal value, such as enhancing human immunity, anti-tumor, anti-virus, Anti-fatigue and myocardial protection. Its main active ingredients are saponins, of which oleanane-type pentacyclic triterpenoid saponins are the main ones, and a small amount of dammarane-type tetracyclic triterpene saponins are also contained. [0003] Bamboo ginseng is a species recorded in the Chinese Pharmacopoeia, which has broad application prospects and considerable economic value. At present, the wild resources of Chinese bamboo ginseng are nearly endangered, and the artificially cultivated medicinal materials have a l...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/90C12N15/61C12N15/82A01H5/00
CPCC12N9/90A01H5/00C12N15/8205C12N15/8242C12Y504/99039
Inventor 黄璐琦陈平张绍鹏杨涛朱闻君宋佳孙巧伍翀郑用琏邓琛
Owner 黄璐琦
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap