90 results about "Rabies" patented technology

The invention discloses a dual fluorescent quantitative PCR (polymerase chain reaction) primer probe combination for identifying a PRV (pseudorabies virus) vaccine strain and a wild strain. The dual fluorescent quantitative PCR primer probe combination comprises two pairs of primers gB-F and gB-R, gE-F and gE-R, and probes gB-probe and gE-probe, wherein the two pairs of primers are used for specifically amplifying a PRV gB gene and a PRV gE gene; through existence of real-time fluorescence PCR amplification curves of the PRV gB gene and the gE gene, a PRV vaccine strain (gE gene deletion) and a wild strain can be rapidly, specifically, sensitively and stably identified, technical support can be provided for porcine pseudorabies epidemic disease monitoring, and thorough purification of the PRV in a live pig breeding link is facilitated.

This invention discloses a method and apparatus for assessing rabies exposure risk. The method includes: generating a patient information set based on the patient's answers to questions about rabies exposure; analyzing the patient information set using a pre-trained question-and-answer analysis model, and acquiring the patient's wound visual content if the analysis result exceeds a pre-set threshold; assessing the rabies exposure risk based on the wound visual content and the patient information set, thereby enabling a more scientific and accurate rabies exposure risk assessment, providing corresponding treatment suggestions, and generating patient medical records for physician reference, thereby improving physician work efficiency and providing patients with safer, more accurate, and faster medical services.

The invention belongs to the technical field of biology, and particularly relates to a porcine pseudorabies virus gB-gD recombinant fusion protein subunit vaccine as well as a preparation method and application thereof. According to the invention, the PRV gB and gD genes are selected to serially express the gBgD protein to prepare the vaccine, the gB and gD proteins which are respectively expressed are replaced, and the vaccine is high in safety and good in immunogenicity, can effectively prevent the occurrence of a pseudorabies virus virulence enhancement event when being clinically used, provides a powerful space for purification of pseudorabies, and has a wide application prospect.

This invention relates to an anti-swine pseudorabies virus (PRV) preparation and the application of Rehmannia glutinosa polysaccharide in its preparation, belonging to the field of biopharmaceutical technology. This invention provides an anti-swine pseudorabies virus (PRV) preparation comprising Rehmannia glutinosa polysaccharide. It also provides the application of Rehmannia glutinosa polysaccharide in the preparation of an anti-PRV preparation for the prevention and / or treatment of swine pseudorabies. This invention utilizes Rehmannia glutinosa polysaccharide to prevent infection by the PRV variant XJ5 by reducing intracellular oxidative stress levels; it also resists viral infection by affecting viral adsorption. Furthermore, when the concentration of Rehmannia glutinosa polysaccharide is between 50 and 400 μg / mL, it can also affect viral entry and replication, and has no cytotoxicity to PK-15 cells.

The invention discloses application of PD-L1 as a drug target for resisting pseudorabies virus infection, the invention discloses PD-L1 as a key host limiting factor for pseudorabies virus infection for the first time, and knockout of PD-L1 can significantly promote replication of pseudorabies virus and induce apoptosis and inflammatory response of host cells. And PD-L1 overexpression can effectively inhibit proliferation of the pseudorabies virus and induce apoptosis and inflammatory response of host cells. Mechanism research results show that PD-L1 can be combined with envelope proteins gB and gD of the pseudorabies virus, and the effect of resisting pseudorabies virus infection is achieved through a cGAS-STNG-IFN pathway. The further research finds that the 125th arginine (ARG125) and the 271th lysine (LYS271) of the PD-L1 protein play a key role in the anti-pseudorabies virus infection effect of the PD-L1. The invention provides a new target spot for drugs for preventing or treating pseudorabies virus infection, and has a good application prospect in the aspect of resisting pseudorabies virus.

The utility model relates to the technical field of farm disinfection, and disclose a pig pseudorabies prevention disinfection structure, including passageway frame, the upper surface fixed connection of passageway frame has the disinfection and killing main part mechanism, the output end fixed communication of disinfection and killing main part mechanism has the spray head, the outside of passageway frame is provided with non -contact disinfection mechanism, and non -contact disinfection mechanism includes two fixed frame, and the inside of every fixed frame all is provided with the shelter door pole. The pig pseudorabies prevention disinfection structure, through passageway frame, disinfection and killing main part mechanism, spray head, fixed frame, shelter door, button controller, warning light, warning device, first infrared distance sensor, second infrared distance sensor, servo motor and rotary lever, passageway frame can be installed at the pig house entrance and exit, and then when the breeding worker enters and exits passageway frame, first infrared distance sensor can monitor that personnel has stood in passageway frame, and second infrared distance sensor can monitor that there is no shelter at two shelter doors.

The present invention discloses a dual nano-PCR detection kit for porcine reproductive and respiratory syndrome virus and pseudorabies virus and its application, belonging to the technical field of molecular biology. The dual nano-PCR detection kit for porcine reproductive and respiratory syndrome virus and pseudorabies virus includes a primer set for detecting porcine reproductive and respiratory syndrome virus (PRRSV) and a primer set for detecting pseudorabies virus (PRV). The primers of the kit of the present invention have strong specificity, good repeatability and high sensitivity. Using nano-dual PCR for detection, it can detect as low as 5.17×10<supgt;2< / supgt> copies / μL and 4.46×10<supgt;2< / supgt> copies / μL, which is 100 times more sensitive than ordinary PCR; a single detection operation can simultaneously identify single infection or co-infection of the two viruses, greatly saving the detection time and reducing the detection cost, and providing technical support for disease prevention and control in pig farms.

The invention discloses a cat and dog claw bite wound flushing device which comprises a shell, a clear water container, a professional flushing fluid container, two infusion tubes, two pistons and two driving structures. The shell is provided with two mutually separated cavities, the shell is provided with a clear water inlet, a professional flushing fluid inlet, a clear water outlet and a professional flushing fluid outlet, the clear water inlet and the clear water outlet are communicated with one cavity, the professional flushing fluid inlet and the professional flushing fluid outlet are communicated with the other cavity, the clear water inlet is communicated with a clear water container through an infusion tube, and the professional flushing fluid inlet is communicated with the other cavity. One piston is correspondingly arranged in one cavity and can move in the length direction of the cavity; and one driving structure is correspondingly in driving connection with one piston and used for driving the corresponding piston to move in the cavity, and the two driving structures are configured to alternately work. According to the technical scheme, the cat and dog claw bite wound flushing device meets the requirements of Rabies Exposure Prevention and Disposal Work Specification (2023 edition) on wound flushing.

The invention discloses a quadruple mRNA vaccine for preventing feline infectious diseases and application thereof, the quadruple mRNA vaccine can simultaneously prevent feline rabies, feline calicivirus disease, feline panleucopenia and feline rhinotracheitis through one-time immunization, and experiments show that the vaccine is relatively safe and strong in efficacy, the injection cost is reduced, and the vaccine is suitable for clinical application. The immune procedure is optimized, and the method has great significance in preventing cat infectious diseases.

This study describes the construction, identification, and application of a pseudorabies virus (PRV) triple-gene deletion vaccine strain (gI / gE / TK). Based on the JS-2012-ΔgI / gE double-gene deletion strain, the TK virulence gene was further deleted using CRISPR technology. Its pathogenicity was evaluated in KM mice and piglets, and its immunoprotective efficacy was verified in piglets. This provides theoretical support for the clinical prevention and control of pseudorabies; establishes experimental models in mice and pigs to study the immunoprotective efficacy of the triple-gene deletion strain; and prepares for the subsequent development and evaluation of vaccines using PRV strains as vectors.

The invention provides a method for reducing PRV virulence through gene insertion and application of the method in vaccine preparation, and belongs to the technical field of gene engineering. The invention provides a method for reducing the virulence of a pseudorabies virus. An EGFP (Enhanced Green Fluorescent Protein) protein expression cassette is inserted into the upstream of a UL40 gene. According to the invention, after the PRV is subjected to the genetic engineering modification, the pseudorabies virus attenuated strain EGFP-PRV can be obtained through virus rescue. Compared with a wild type PRV-DX, the pathogenicity is weakened, no pathological clinical symptom appears after a Balb / c mouse is infected with the pseudorabies virus, and the pseudorabies vaccine has the prospect of preparing the pseudorabies vaccine.

The invention belongs to the technical field of veterinary biological products, and particularly relates to a swine fever-porcine pseudorabies bivalent subunit vaccine containing a traditional Chinese medicine immunopotentiator as well as a preparation method and application of the swine fever-porcine pseudorabies bivalent subunit vaccine. The enhancer is prepared by compounding a hypericum perforatum extract and a horse chestnut seed extract, the hypericum perforatum extract and the horse chestnut seed extract are mixed with a classical swine fever virus (CSFV) E2 protein, a pseudorabies virus (PRV) gB protein, a PRV gD protein and an adjuvant to prepare a subunit vaccine, the vaccine can remarkably improve the humoral immunity level and the cellular immunity level excited by the vaccine at the same time, and the vaccine can be used for preparing the vaccine. Specifically, cell factors such as neutralizing antibodies GMT and IFN-gamma are remarkably increased, and the uniformity and stability of immune response are promoted, so that the immunogenicity of the existing swine fever-porcine pseudorabies bigeminy subunit vaccine is effectively improved, and the protection effect of the vaccine is enhanced.

The invention discloses a universal ferritin carrier vaccine subjected to engineering modification and application of the universal ferritin carrier vaccine. The invention discloses a ferritin adapter, a human ferritin heavy chain mutant, a universal ferritin carrier system, an antigen fusion protein and a ferritin carrier vaccine, nucleic acid for encoding the ferritin adapter, the human ferritin heavy chain mutant, the universal ferritin carrier system, the antigen fusion protein and the ferritin carrier vaccine, a recombinant expression vector and a transformant containing the ferritin adapter, the human ferritin heavy chain mutant and the universal ferritin carrier system. According to the invention, the fact that NCOA4 (residual 484-499) is a real binding epitope of FTH1 is determined for the first time. And the Peptide and FTH1 mutants with obviously improved affinity are designed. The rabies nanoparticle vaccine based on the general type ferritin carrier system is higher in stability and can induce wider, lasting and strong immune response. 100% of protection efficiency can be generated through two-dose immunization, and a better prevention effect is achieved compared with a commercially available standard inactivated vaccine BRP.

The present invention discloses a rabies inactivated vaccine diluent and its preparation method and application, belonging to the technical field of vaccine diluents. The invention provides an inactivated vaccine diluent to solve the technical problems of low antibody titer, long production time and short antibody maintenance time after animal inactivated vaccine immunization. The invention provides a rabies inactivated vaccine diluent, which is composed of the following components: phosphate buffer, MONTANIDE TM GEL 02 PR adjuvant, canine interferon, and ricin B chain protein. This diluent can significantly increase the rabies neutralizing antibody titer after rabies inactivated vaccine administration.

The invention relates to the technical field of biological medicines, and aims to provide application of glutamic acid in preparation of a medicine for treating pseudorabies virus infection. Particularly, glutamic acid is applied to preparation of drugs for treating pseudorabies virus infection. The medicine takes glutamic acid as an active component, and comprises an effective amount of glutamic acid and pharmaceutically acceptable auxiliary materials. It is proved for the first time that glutamic acid can remarkably inhibit PRV replication in PK-15 cells, the effectiveness of glutamic acid in the aspects of inhibiting virus replication and improving infection symptoms and the remarkable effect of glutamic acid in the aspects of improving the survival rate and weight change of infected mice are verified, and a new scientific basis and practical support are provided for prevention and control of PRV infection. The traditional Chinese medicine composition has the characteristics of high safety and small toxic and side effects, and is low in price, easy to obtain and suitable for being popularized and used in farms. A novel treatment method is provided for coping with prevalence of porcine pseudorabies, virus transmission in pig farms is expected to be prevented, and economic losses are reduced.

The invention belongs to the technical field of animal pathogen molecular biology, and particularly relates to a dual quantitative fluorescent primer probe composition, a kit and an identification method for identifying hog cholera virus. Aiming at the current popular strains covering 3 genotypes, 11 gene subtypes and the like of the hog cholera gene, the invention selects 5UTR and NS3 gene sequences of hog cholera virus to design and synthesize specific primers and probes aiming at the two fragments; the specific primer has no non-specific amplification on African swine fever virus, pseudorabies virus, porcine reproductive and respiratory syndrome virus, porcine circovirus type II, porcine epidemic diarrhea and bovine viral diarrhea. The invention establishes a method for identifying the classical swine fever virus wild strain and the vaccine strain and develops a kit convenient for diagnosis, and the kit and the identification method can simultaneously identify the classical swine fever virus wild strain and the vaccine strain, have the characteristics of high sensitivity, strong specificity, good repeatability and good stability, and have extremely strong application prospects.

This invention relates to the field of biomedical technology, specifically to a stably expressed porcine pseudorabies virus gD recombinant protein, a vaccine composition, its preparation method, and its applications. The invention provides a stably expressed porcine pseudorabies virus gD recombinant protein, the amino acid sequence of which is shown in SEQ ID NO:7. The porcine pseudorabies virus gD recombinant protein is stably expressed in monoclonal cells, exhibiting stable expression levels after 48 consecutive passages. This lays a solid foundation for its subsequent applications in the preparation of stable porcine pseudorabies subunit vaccine compositions or in porcine pseudorabies virus vaccine efficacy testing formulations.

The present invention provides vaccine compositions, methods and uses thereof, the vaccine compositions are immunogenic compositions of secreted fusion proteins, wherein the secreted fusion proteins comprise a rabies or soluble influenza virus antigen linked by in-frame fusion to a collagen C-terminal portion capable of self-trimerization to form a disulfide-linked trimeric fusion protein. The present invention also provides uses of the immunogenic compositions for generating an immune response against rabies or influenza infection and for use in vaccine compositions. The present invention also provides methods of producing recombinant peptides and proteins, methods of prevention, treatment and / or diagnosis and related kits.

The application provides a construction and application of a recombinant pseudorabies virus strain stably and efficiently expressing green fluorescent protein, in the research, a green fluorescent protein gene (EGFP) is inserted into different positions of a double gene deletion vaccine strain (JS-2012-△gE / gI) of a pseudorabies virus mutant strain by using a homologous recombination method. Finally, it is proved that the recombinant virus JS-2012-△gE / gI-VP1 / 2-EGFP has good genetic stability, and the EGFP gene can also be stably and efficiently expressed, and the growth rate on cells is also comparable to that of the parent virus, so that the VP1 / 2 gene is the best exogenous gene insertion site. Subsequently, the classical swine fever virus E2 gene, the parvovirus VP2 gene, the cap gene of the circovirus type 2 and the VP1 gene of the foot-and-mouth disease virus can be replaced or inserted into the EGFP expression frame in a single or combined manner to construct different types of multi-vaccines, and the multi-vaccines have extremely high research value and platform significance.

The present invention discloses the application of JH-RE-06 in the preparation of a drug for inhibiting the DNA synthesis of pseudorabies virus. The translesion DNA synthesis pathway inhibitor JH-RE-06 has the characteristics of a REV1 inhibitor and can induce the dimerization of REV1. The REV1-mediated TLS pathway is essential for the DNA synthesis of porcine pseudorabies virus. Therefore, JH-RE-06 can inhibit the proliferation of porcine pseudorabies virus. The present invention discovers for the first time the mechanism of action of JH-RE-06 in inhibiting the proliferation of pseudorabies virus and uses this drug for antiviral purposes for the first time.

This invention discloses monoclonal antibodies that recognize linear B-cell epitopes in the conserved extracellular domain of pseudorabies virus (PRV) gE protein and their applications. Using recombinant PRV gE protein extracellular domain protein as an immunogen, hybridoma cell lines were prepared. Combining dot blot and peptide scanning techniques, two monoclonal antibodies, 4E5D7 and 8F6B2, were screened to recognize the 69-93aa region of the conserved extracellular domain of the PRV gE protein. Both antibodies achieved a titer of 1:2048000 and specifically recognized the native PRV wild-type gE protein, showing no cross-reactivity with gE gene-deleted vaccines. The monoclonal antibodies of this invention fill the gap in detection reagents targeting the precise epitopes of the 69-81aa and 79-93aa extracellular domains of the PRV gE protein, thus improving the linear B-cell epitope map of the PRV gE protein. These monoclonal antibodies can be used for research on the pathogenesis of PRV and the development of specific detection reagents for PRV wild-type strains, possessing significant application value and translational prospects in basic scientific research, veterinary clinical testing, and animal disease prevention and control.

The present invention provides an aerosol protective agent for a porcine pseudorabies live vaccine, and relates to the field of animal vaccines. The aerosol protective agent is an aqueous solution containing the following ingredients: 3-24 g / L trehalose, 3-24 g / L L-arginine, 3-24 g / L proline and 1-10% glycerol, with a pH value of 7.0-7.8. The present invention also provides a method for preparing a porcine pseudorabies live vaccine aerosol, comprising: preparing a solution of a commercially available porcine pseudorabies live vaccine freeze-dried product with an aerosol protective agent, and preparing the aerosol live vaccine by ultrasonic atomization; the aerodynamic mass median particle size of the aerosol live vaccine is 1-10 μm, and after being retained in the air for 30 minutes, it still has a high titer, a high immune protection rate, simple preparation, and low cost.

The invention discloses a gene modification system capable of being used for knocking out a pig TRIM29 gene, a TRIM29 gene modified cell strain prepared by adopting the system, and application of the system in preparation of a TRIM29 gene modified pig or preparation of a PRV (pseudorabies virus) resistant pig or cultivation of a new anti-PRV pig variety. By means of the system, the TRIM29 gene modified cell strain capable of being stably inherited can be efficiently screened out, the TRIM29 gene in the cell strain has a biisometric displacement mutation genotype behind a GACCTCAGCTACTCTAAGCA sequence site, and the genotype can be stably inherited. A TRIM29 gene modified pig can be prepared by utilizing the gene modification system or the TRIM29 gene modified cell strain, the gene modified pig has improved I-type interferon level, has relatively strong disease resistance to PRV (porcine reproductive and respiratory syndrome), also has disease resistance to various I-type IFN sensitive viruses, is a broad-spectrum disease-resistant pig, and has good application prospects. Good market competitiveness and application prospects are realized.

This invention relates to the field of veterinary vaccines, specifically to a porcine pseudorabies virus antigen, a porcine pseudorabies subunit vaccine, its preparation method, and its application. The porcine pseudorabies virus antigen of this invention is the porcine pseudorabies virus gD protein, and the amino acid sequence of the porcine pseudorabies virus gD protein is shown in SEQ ID NO:1. The porcine pseudorabies subunit vaccine prepared using the porcine pseudorabies virus antigen has a simple preparation method, high neutralizing antibody value, and strong antigenic immunogenicity. It can effectively activate the body's immune response and provide excellent immunoprotection against porcine pseudorabies.

The application relates to the technical field of dimethicone content detection, and specifically discloses an ATR detection method for the migration amount of dimethicone on the surface of a medicinal halogenated butyl rubber plug in a human rabies vaccine. The method comprises the following steps: S1, taking a human rabies vaccine aqueous solution, adding ethanol and an extractant, extracting, leaving an oleophilic phase, and discarding an aqueous phase; wherein the volume ratio of the human rabies vaccine aqueous solution to the ethanol is 1:1-2.5, and the volume ratio of the human rabies vaccine aqueous solution to the extractant is 1:0.5-0.8; the extractant is selected from any one of ethyl ether, toluene, n-hexane and chloroform; S2, after removing the extractant in the oleophilic phase, a crude product is obtained, chloroform is added to the crude product for redissolution, a sample injection sample is obtained, and the sample injection sample is detected by using the ATR method. The detection method can improve the accuracy of detecting the migration amount of dimethicone on the surface of the halogenated butyl rubber plug in the human rabies vaccine.

This application relates to the technical field of pseudorabies virus detection, specifically to a primer combination for pseudorabies virus detection, its application, and a reagent kit. Specifically, the amplification primers in this application exhibit good specificity and amplification efficiency when used for pseudorabies virus detection, and demonstrate good linear regression performance, enabling more accurate and precise quantitative detection of pseudorabies virus.

The invention discloses a primer probe combination and a kit for fluorescent quantitative PCR (Polymerase Chain Reaction) detection of African swine fever virus and application of the primer probe combination and the kit. The primer probe combination is a specific primer probe combination 1 or a specific primer probe combination 2. The nucleotide sequence of the specific primer probe combination 1 is as shown in SEQ ID NO.1-3, and the nucleotide sequence of the specific primer probe combination 2 is as shown in SEQ ID NO.4-6. The qPCR detection method with strong specificity and high sensitivity is established, the lower detection limit can reach 0.87 copies / L, the sensitivity of the qPCR detection method is equivalent to that of a WOAH recommendation method, and the detection rate of weak positive samples is higher; the kit has no cross reaction with common swine pathogens such as hog cholera virus and pseudorabies virus, and has good specificity. The method provides reliable technical support for early diagnosis and precise prevention and control of African swine fever.

The present invention provides a variant pseudorabies virus (PRV) gC-gD epitope concatemer and its application. The amino acid sequence of the variant pseudorabies virus gC-gD expression concatemer is shown in SEQ ID NO.1, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.2. The present invention uses the variant pseudorabies virus gC-gD epitope concatemer to establish an indirect ELISA detection method for PRV neutralizing antibodies with strong specificity, high sensitivity and good repeatability. The method can fully meet the serological diagnosis requirements of pig herds in pig farms where PRV wild virus is prevalent and pig farms where PRV wild virus has been purified, laying a certain foundation for the development of a new PRV polypeptide vaccine.

The invention relates to an antigen construct for rapid immune detection, in particular to an antigen molecule for realizing dimerization or trimerization through foldon or a variant thereof. The antigen construct can enhance the conformation stability and improve the antibody binding efficiency, so that the sensitivity and shelf life stability in colloidal gold, fluorescent microspheres, ELISA (enzyme-linked immuno sorbent assay) and other in-vitro diagnosis methods in immunochromatography are remarkably improved. The construct is suitable for antibody detection of rabies, influenza, coronavirus, Brucella, tuberculosis and the like in zoonosis and HIV, HBV, HCV, syphilis and the like in human infectious diseases, and can be widely applied to clinical screening, animal quarantine, family self-test and public health emergency monitoring.

The invention discloses an application of an RAD51 inhibitor in preparation of an anti-pseudorabies virus drug, belongs to the technical field of biological medicines, and particularly discloses a novel application of a small molecule compound RAD51 inhibitor B02 and DIDS in preparation of the anti-pseudorabies virus drug. The small molecule compounds provided by the scheme have anti-pseudorabies virus activity, the small molecule compounds can reduce the replication of PRV in A549 cells, and meanwhile, one of the small molecule compounds B02 can also significantly inhibit the replication of PRV in PK-15 cells; the compound can provide a theoretical basis and an innovative direction for screening and developing anti-PRV (pseudorabies virus) drugs, and has important scientific significance and potential application value in the field of research and development of anti-PRV drugs.