Subunit vaccine of porcine pseudorabies virus and preparation method
a subunit vaccine and pseudorabies technology, applied in the field of veterinary biological products, can solve the problems of high death rate of piglets, stillborn or mummified fetuses, neurological signs, etc., and achieve the effects of reducing the cost of immunization, preventing pseudorabies, and significantly increasing the expression level of prepared gb protein fragments
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Example Preparation of a gB Protein Fragment of Porcine Pseudorabies Virus
[0103]1. Gene Amplification of gB Protein Fragment of Porcine Pseudorabies Virus
[0104]The PRV HN1201 virus was inoculated on the well-grown PK15 cells and 200 μL of the harvested virus solution was taken. The PRV genomic DNA was extracted according to the instruction of Geneaid Inc.'s viral nucleic acid extraction kit II. gB gene 62-148aa was amplified by using primers gBF1 and gBR1, gB gene 546-700aa was amplified by using primers gBF2 and gBR2, then these two were amplified into one by Overlapping PCR and with GGSG link amino acids added therebetween through design of primers. Primers are shown in Table 1, PCR system is shown in Table 2, and PCR reaction conditions are shown in Table 3.
TABLE 1Gene amplification primers for gB protein fragmentgenePrimer sequence (5′-3′)gB genegBF1: AGGAATTC AG ACGCGGGCCGCCTCGGCCTC62-148 aaGCgBR1:gttACCAGAACCACCCGAGTACTCGGGGCAGGCCTGCgB genegBF2:546-700 aatcgGGTGGTTCTGGTAACGACA...
example 2
Preparation of gB Protein of Porcine Pseudorabies Virus
[0115]1. Gene Amplification of gB Gene of Porcine Pseudorabies Virus
[0116]Using the PRV genomic DNA extracted in Example 1 as a template, the HNgB gene 62-752aa was amplified by using primers gBF and gBR. Primers are shown in Table 4, PCR system is shown in Table 2, and reaction conditions are shown in. Table 3.
TABLE 4Amplification primer for gB genegenePrimer sequence (5′-3′)gB genegBF: AGGAATTC AG ACGCGGGCCGCCTCGGCCTCGC62-752 aagBR:CCAAGCTTCTACTTGATGGTGATGGTGATGGTGATGGTTGTGGTCCACCTTGACCACGC
[0117]2. Construction of Donor Plasmid
[0118]Referring to the method for constructing the donor plasmid in Example 1, the PCR product amplified in step 1 was recovered to construct a donor plasmid, and the correct plasmid after identification was named pFastBac-HNgB.
[0119]3. Construction of Recombinant Bacmid
[0120]Referring to the construction method of recombinant Bacmid in Example 1, the donor plasmid obtained in step 2 was transformed into...
example 3
Comparison of Expression Quantity of gB Protein Fragment and gB Protein of Porcine Pseudorabies Virus
[0125]By comparing the expression data of the two proteins in Example 1 and Example 2, it was found that the expression quantity of gB protein fragments was double that of the gB protein under the same culture environment and conditions, indicating that the gB protein fragment selected in the present disclosure is easier to express, and thus it can effectively reduce the cost of immunization, and facilitate to large-scale industrial application.
PUM
| Property | Measurement | Unit |
|---|---|---|
| weight | aaaaa | aaaaa |
| body temperature | aaaaa | aaaaa |
| size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 



