Subunit vaccine of porcine pseudorabies virus and preparation method

a subunit vaccine and pseudorabies technology, applied in the field of veterinary biological products, can solve the problems of high death rate of piglets, stillborn or mummified fetuses, neurological signs, etc., and achieve the effects of reducing the cost of immunization, preventing pseudorabies, and significantly increasing the expression level of prepared gb protein fragments

Active Publication Date: 2018-09-13
PU LIKE BIO ENG
View PDF2 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0004]For the very first time, the present disclosure achieves preparation of subunit vaccine by fusion-expression of a fragment obtained from gB protein of porcine pseudorabies virus, the subunit vaccine provides a better protection effect against pseudorabies caused by the porcine pseudorabies virus. Unexpectedly, it is found that the expression level of the prepared gB protein fragment is significantly increased and cost of immunization is greatly reduced.

Problems solved by technology

Pseudorabies in swine is found nationwide in China causing severe damages, and is one of the major diseases limiting the large-scale production of pig farms.
Infection can result in abortion, stillborn or mummified fetuses in pregnant sows, and neurological signs, paralysis and a high death rate in piglets.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Subunit vaccine of porcine pseudorabies virus and preparation method
  • Subunit vaccine of porcine pseudorabies virus and preparation method
  • Subunit vaccine of porcine pseudorabies virus and preparation method

Examples

Experimental program
Comparison scheme
Effect test

example 1

Example Preparation of a gB Protein Fragment of Porcine Pseudorabies Virus

[0103]1. Gene Amplification of gB Protein Fragment of Porcine Pseudorabies Virus

[0104]The PRV HN1201 virus was inoculated on the well-grown PK15 cells and 200 μL of the harvested virus solution was taken. The PRV genomic DNA was extracted according to the instruction of Geneaid Inc.'s viral nucleic acid extraction kit II. gB gene 62-148aa was amplified by using primers gBF1 and gBR1, gB gene 546-700aa was amplified by using primers gBF2 and gBR2, then these two were amplified into one by Overlapping PCR and with GGSG link amino acids added therebetween through design of primers. Primers are shown in Table 1, PCR system is shown in Table 2, and PCR reaction conditions are shown in Table 3.

TABLE 1Gene amplification primers for gB protein fragmentgenePrimer sequence (5′-3′)gB genegBF1: AGGAATTC AG ACGCGGGCCGCCTCGGCCTC62-148 aaGCgBR1:gttACCAGAACCACCCGAGTACTCGGGGCAGGCCTGCgB genegBF2:546-700 aatcgGGTGGTTCTGGTAACGACA...

example 2

Preparation of gB Protein of Porcine Pseudorabies Virus

[0115]1. Gene Amplification of gB Gene of Porcine Pseudorabies Virus

[0116]Using the PRV genomic DNA extracted in Example 1 as a template, the HNgB gene 62-752aa was amplified by using primers gBF and gBR. Primers are shown in Table 4, PCR system is shown in Table 2, and reaction conditions are shown in. Table 3.

TABLE 4Amplification primer for gB genegenePrimer sequence (5′-3′)gB genegBF: AGGAATTC AG ACGCGGGCCGCCTCGGCCTCGC62-752 aagBR:CCAAGCTTCTACTTGATGGTGATGGTGATGGTGATGGTTGTGGTCCACCTTGACCACGC

[0117]2. Construction of Donor Plasmid

[0118]Referring to the method for constructing the donor plasmid in Example 1, the PCR product amplified in step 1 was recovered to construct a donor plasmid, and the correct plasmid after identification was named pFastBac-HNgB.

[0119]3. Construction of Recombinant Bacmid

[0120]Referring to the construction method of recombinant Bacmid in Example 1, the donor plasmid obtained in step 2 was transformed into...

example 3

Comparison of Expression Quantity of gB Protein Fragment and gB Protein of Porcine Pseudorabies Virus

[0125]By comparing the expression data of the two proteins in Example 1 and Example 2, it was found that the expression quantity of gB protein fragments was double that of the gB protein under the same culture environment and conditions, indicating that the gB protein fragment selected in the present disclosure is easier to express, and thus it can effectively reduce the cost of immunization, and facilitate to large-scale industrial application.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
weightaaaaaaaaaa
body temperatureaaaaaaaaaa
sizeaaaaaaaaaa
Login to view more

Abstract

The present disclosure provides a PRV gB protein fragment, or a conservative variant or active fragment thereof, the gB protein fragment has a high level of expression, the subunit vaccine antigen prepared from the gB protein fragment has a better immune effect than a subunit vaccine antigen prepared from gB protein. The invention also provides a preparation method of a subunit vaccine by using the gB protein fragment alone, or the gB protein fragment together with gD protein. This vaccine has a simple preparation method and provides excellent protection against disease caused by the porcine pseudorabies virus.

Description

FIELD OF THE INVENTION[0001]This invention relates to a field of veterinary biological products, specifically relates to a subunit vaccine of porcine pseudorabies virus and preparation method thereof, and use in preparing composition for preventing and / or treating diseases associated with porcine pseudorabies virus and infection caused by the porcine pseudorabies virus.BACKGROUND OF THE INVENTION[0002]Pseudorabies, also called Aujeszky's disease, is an acute infectious disease caused by Suid herpesvirus 1 (SuHV1) belonging to the Alphaherpesvirinae subfamily for many kinds of livestock such as swine, cattle and sheep, as well as poultry and wild animals, with the main symptoms of fever, intense itching (except swine) and encephalomyelitis. Pseudorabies in swine is found nationwide in China causing severe damages, and is one of the major diseases limiting the large-scale production of pig farms. Infection can result in abortion, stillborn or mummified fetuses in pregnant sows, and ne...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(United States)
IPC IPC(8): A61K39/245A61P31/22A61K39/39
CPCA61K39/245A61P31/22A61K39/39A61K2039/552A61K2039/525A61K2039/70A61K39/12C07K14/005C12N2710/16722C12N2710/16734A61K2039/545C07K2319/00
Inventor TIAN, KEGONGWANG, TONGYANSUN, JINZHONGZHANG, XUKE
Owner PU LIKE BIO ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap