209 results about "Bacterial dna" patented technology

The present invention provides systems, devices, apparatuses and methods for automated bioprocessing. Examples of protocols and bioprocessing procedures suitable for the present invention include but are not limited to: immunoprecipitation, chromatin immunoprecipitation, recombinant protein isolation, nucleic acid separation and isolation, protein labeling, separation and isolation, cell separation and isolation, food safety analysis and automatic bead based separation. In some embodiments, the invention provides automated systems, automated devices, automated cartridges and automated methods of western blot processing. Other embodiments include automated systems, automated devices, automated cartridges and automated methods for separation, preparation and purification of nucleic acids, such as DNA or RNA or fragments thereof, including plasmid DNA, genomic DNA, bacterial DNA, viral DNA and any other DNA, and for automated systems, automated devices, automated cartridges and automated methods for processing, separation and purification of proteins, peptides and the like.

The invention discloses an insect bioreactor capable of expressing multiple exogenous genes, and a construction method and application thereof. The construction method comprises the following steps: (1) introducing multicopy high-efficiency bacteria DNA (deoxyribonucleic acid) replication initiator into chitinase and cysteine proteinase genes of a baculovirus genome to obtain a baculovirus shuttle plasmid; (2) replacing virus duplicated essential gene downstream the polyhedrosis gene of the baculovirus shuttle plasmid with antibiotic gene to obtain a baculovirus plasmid DNA; and (3) replacingother virus duplicated and infected nonessential genes in the baculovirus shuttle plasmid with reverse selection marker gene to obtain the insect bioreactor. The antibiotic gene or reverse selection marker gene in the insect bioreactor which is constructed by replacing the exogenous target genes can express multiple exogenous genes in a host insect or insect cell. The insect bioreactor disclosed by the invention can efficiently expressing one or more exogenous genes in an insect body at the same time, and can produce massive recombinant proteins at low cost.

The invention relates to the generation and characterization of Archaeal DNA polymerase mutants with deficient 3′-5′ exonuclease activity and reduced base analog detection activity. The invention further provides for Archaeal DNA polymerase mutants with deficient 3′-5′ exonuclease activity and reduced base analog detection activity containing additional mutations that modulate other DNA polymerase activities including DNA polymerization or reverse transcriptase activity. The invention also discloses methods and applications of DNA polymerases with deficient 3′-5′ exonuclease activity and reduced base analog detection activity.

A portable, fully-automated, microchip including a DNA purification region fluidly integrated with a PCR-based detection region is used to detect specific DNA sequences for the rapid detection of bacterial pathogens. Using an automated detection system with integrated microprocessor, pumps, valves, thermocycler and fluorescence detection modules, the microchip is able to purify and detect bacterial DNA by real-time PCR amplification using fluorescent dye. The fully automated detection system is completely portable, making the system ideal for the detection of bacterial pathogens in the field or other point-of-care environments.

Disclosed is a method of detecting bacteria in a biological sample, especially a blood sample, without the need for extensive sub-culturing of the sample. Nucleic acid present within the sample is isolated and bacterial DNA specifically amplified using primers that uniquely prime the amplification of 16s rRNA-encoding nucleic acid. The amplicons are then digested with an endonuclease to yield a restriction fragment length profile for the biological sample. The restriction fragment length profile for the biological sample is then compare to a database of profiles made using cultures of known bacterial species. A match between the sample profile and the database quickly identifies the bacteria present in the sample.

Bis-quinazoline compounds based on the compound (3,4-Dihydro-quinazolin-2-yl)-quinazolin-2-yl-amine, and methods of use of the compounds as inhibitors of bacterial DNA polymerase holoenzymes and in the treatment of bacterial infections are described.

The invention discloses a method and a kit for extracting bacterial nucleic acid from sputa and applications thereof. The method is to use liquefaction reagent to liquefy a sputum sample and add solid particles to lyse cells to extract nucleic acid form the sputum. Overcoming the drawbacks of the prior method including complex procedures, a long period of time, complex operation and inadequate samples, the method of the invention for extracting nucleic acid samples is convenient and quick in operation, adequate in nucleic acid samples, low in cost and easy to implement. The method and kit for extracting bacterial nucleic acid can be used to identify strains of mycobacteria and to detect whether a gene locus of mycobacterium tuberculosis is of a wide type or a mutant type. With a chip for identifying strains and a chip for detecting whether the gene locus of mycobacterium tuberculosis is of a wide type or a mutant type, the method can identify the strains of mycobacteria and to detect whether a gene locus of mycobacterium tuberculosis is of a wide type or a mutant type in a quick, accurate and high-pass way.

The invention relates to an LAMP (Loop-mediated Isothermal Amplification) detection kit of pathogenic aeromonas hydrophila, having convenient use and rapid detection. The LAMP detection kit comprises a bacterium DNA extracting reagent and an LAMP reaction reagent, wherein the reaction reagent contains primers FIP with the sequence of GTTTCCCCCATCAGATCCGTGGTTTACGCCACCCAGTTTCTTG, BIP with the sequence of TCCGGCCTGTATACCTGTATCAGGTTAAACCAGGGTGTCATCGCT, F3 with the sequence of TGATGGCCACGAGACATCCA and B3 with the sequence of TGCTTGATCCCCTTGCTACT. The LAMP detection method of the pathogenic aeromonas hydrophila comprises the following steps of: (1) DNA (Deoxyribonucleic Acid) extraction; (2) LAMP amplification of the pathogenic aeromonas hydrophila; and (3) staining detection. The invention is suitable for detecting the pathogenic aeromonas hydrophila.

Disclosed is a method of detecting bacteria in a biological sample, especially a blood sample, without the need for extensive sub-culturing of the sample. Nucleic acid present within the sample is isolated and bacterial DNA specifically amplified using primers that uniquely prime the amplification of 16s rRNA-encoding nucleic acid. The amplicons are then digested with an endonuclease to yield a restriction fragment length profile for the biological sample. The restriction fragment length profile for the biological sample is then compare to a database of profiles made using cultures of known bacterial species. A match between the sample profile and the database identifies the bacteria present in the sample.

The invention relates to a cholera toxin virulence gene detection kit and a detection method thereof. The kit of the invention contains three pairs of primers which are designed by using vibrio cholera ctxA gene as target gene on the basis of the loop-mediated isothermal amplification technology, namely inner primers FIP / BIP, outer primers F3 / B3 and ring primers LF / LB and also contains Bst DNA polymerases, reaction solution, sample pretreatment solution, coloring liquid, stabilizing solution and positive control. The method for detecting the cholera toxin virulence gene comprises the following steps: extracting bacterial DNA, performing the loop-mediated isothermal amplification of the cholera toxin virulence gene and coloring for detection. The kit of the invention has high amplificationefficiency, specificity and sensitivity, low omission ratio and obvious coloring effect and is suitable for the rapid detection of toxigenic vibrio cholera.

The invention relates to a multiple PCR (polymerase chain reaction) method for identifying salmonella enteritidis, salmonella typhimurium, salmonella pullorum and salmonella gallinarum. The multi-PCR method comprises the following steps of: with the extracted DNA (deoxyribonucleic acid) of a bacterium to be detected as a template, carrying out mPCR (multiple polymerase chain reaction) amplification on five pairs of primers as shown in SEQ ID NO.1-10; and carrying out agarose gel electrophoresis on mPCR amplification products, and then determining according to electrophoresis results. According to the multiple PCR method, the synthesized primers are used for carrying out PCR amplification, a diseased material can be directly ground and amplified by adopting the established multiple PCR, different salmonella serotypes can be detected in one system, serum glass plate agglutination is completed in only about six hours compared with three days for the traditional serum glass plate agglutination after separation pure culture in clinical detection, the diagnosis time is greatly shortened, and a basis is provided for clinical diagnosis.

The present invention relates to reagent kit and process for detecting Vibrio vulnificus in circular mediate constant temperature amplification method. The reagent kit includes: circular mediate constant temperature amplification reactant liquid A with upstream inner primer tgccactcggctacgataacgtttttgagctgtcacggcagttg, downstream inner primer acgcagacaaaacgctcacagtttttgagcttatcgccttcccaat, upstream outer primer tggttcggttaacggctg and downstream outer primer gccatcaacatagcggctaa; and 1-1.5 M beetaine. The detection process includes the following steps: extracting bacterium DNA, circular mediate constant temperature amplification of Vibrio vulnificus, color developing detection, etc. The present invention has the advantages of high speed, high specificity, high sensitivity and low cost.

A nucleic acid amplification disk apparatus using a temperature sensitive polymer synthesis and the analysis method using the same, and more specifically, and the nucleic acid amplification device, and the analysis method using the nucleic acid amplification disk unit and the nucleic acid amplification disk for amplifying the Bacterial DNA or RNA, and the driving control section for controlling the nucleic acid amplification disk.

The invention relates to a preparation and using method of a yersinia genus rapid detection kit. The kit includes loop-mediated isothermal amplification reaction liquid A, BstDNA polymerase B and chromogenic reagent C. The reaction liquid A contains reaction buffer, dNTP, sulfate magnesium, upstream internal primer 5- CCGGTTTGATCGGTTTCGCCCACTTACAAGATGGGTGTGCC-3, downstream internal primer 5- GTGCGTTTCTGGCCGAGCTTGCAGACGTTTTGCCAGGATT-3, upstream external primer 5- CGCCGTGAAGGTAAAGTTCA-3, downstream external primer 5-CAGAGTTCAGGAACGACAGC-3 and betaine. The method for detecting the yersinia genus includes the DNA extraction of a sample to be detected or bacteria, the loop-mediated isothermal amplification and the chromogenic detection of the yersinia genus. The invention has the advantages of rapid property, strong specificity, high sensitivity and low cost.

The invention relates to a rapid detection reagent kit for Enterobacter sakazaii by using a loop-mediated isothermal amplification technology and a detection method thereof. A loop-mediated isothermal amplification reaction liquid, Bst DNA polymerase and a chromogenic reagent are placed in the reagent kit; and the reaction liquid contains a reaction buffer liquid, dNTP, magnesium sulfate, an upstream inner primer 5- TATGCGGGATCGAACCGCAGA-GGCTATAGCTCAGCTGGGA-3, a downstream inner primer 5- GCTCCACCATCACTTCGGAGTG-TTCAGCTTGTTCCGGATTGT-3, an upstream outer primer 5- TCCGCAGGAGTTGAAGAGG-3, a downstream outer primer 5-CAGCAGCGTGTCTGTTTCA-3 and lycine. The method for detecting the Enterobacter sakazaii comprises the extraction of bacterial DNA, the loop-mediated isothermal amplification of the Enterobacter sakazaii, and chromogenic detection. The rapid detection reagent kit and the detection method have the advantages of quickness, strong specificity, high sensitivity and low cost.

The invention relates to a method for quickly detecting bacterial DNA. The sample containing bacterial DNA is provided and treated according to a PCR method. The DNA copies which are multiplied by means of PCR are detected.

The invention relates to a rapid detection reagent kit for Enterobacter sakazaii by using a loop-mediated isothermal amplification technology and a detection method thereof. A loop-mediated isothermal amplification reaction liquid, Bst DNA polymerase and a chromogenic reagent are placed in the reagent kit; and the reaction liquid contains a reaction buffer liquid, dNTP, magnesium sulfate, an upstream inner primer 5- TATGCGGGATCGAACCGCAGA-GGCTATAGCTCAGCTGGGA-3, a downstream inner primer 5- GCTCCACCATCACTTCGGAGTG-TTCAGCTTGTTCCGGATTGT-3, an upstream outer primer 5- TCCGCAGGAGTTGAAGAGG-3, a downstream outer primer 5-CAGCAGCGTGTCTGTTTCA-3 and lycine. The method for detecting the Enterobacter sakazaii comprises the extraction of bacterial DNA, the loop-mediated isothermal amplification of the Enterobacter sakazaii, and chromogenic detection. The rapid detection reagent kit and the detection method have the advantages of quickness, strong specificity, high sensitivity and low cost.

The virulence of bacterial strains and in particular pathogenic bacteria which infect human is reduced by an agent which alters the bacteria's native level or activity of DNA methyltransferase (Dam). The agent causes an alteration in the bacteria's native level of methylation of adenine in a GATC tetranucleotide which inhibits virulence of the bacteria. Thus, compounds and formulations thereof which reduce bacterial virulence inhibit proliferation of bacteria and are useful in treating bacterial infections, particularly in humans.

The invention relates to a biological detection reagent, in particular to a primer, a kit and a detection method which are used for the fast detection of the loop-mediated isothermal amplification technology of an enterobacter sakazaii. The primer used for the fast detection of the loop-mediated isothermal amplification technology of the enterobacter sakazaii is a set of character primer group of the enterobacter sakazaii; one set of primers consists of two pairs of primers; one pair of primers refers to outer primers and the other pair refers to inner primers; the invention has six sets of primers. The kit comprises a set of primers, a reaction liquid, BstDNA polymerase, a sample pre-processing liquid, a visualization reagent, a masculine contrast liquid; the detection method includes extracting the DNA of the strain, the loop-mediated isothermal amplification reaction and coloration detection. The method has the advantages of fast speed, strong specificity, high sensitivity and low cost. The enterobacter sakazaii in the sample can be fast detected by using the kit to carry out simple processing on the sample; thus having the advantages of high sensitivity, strong specificity, simple operation, and the like; besides, the result can be judged by sight.

The invention relates to a method for extracting microbes from Daqu liquor, in particular to a method for extracting DNAs of fungi and bacteria in Maotai-flavor Daqu liquor and the use of the method in liquor identification.

This invention provides an aquatic dung bacteria DNA distilling kit and its method. In this invention, the dung is disposed by ethanol and TritonX-100 to increase sensitivity of the bacteria to cracking liquid. Then cell is cracked by cracking liquid with SDS, the liquid also has PVP that with absorption to PCR restrictor. Then a high concentration GuSCN, low pH environment is provided for further denaturation of protein in the solution, and the water solubility is reinforced, and the DNA can be binding on silica gel column. Finally, DNA is eluted from the column in low concentration buffer solution or water. The goal of the maximum diversities information, high quality and higher output DNA of aquatic dung bacteria community can be reached by using this kit and its distilling method. The DNA got can be used to molecular ecology, system evolution and other researches.

The invention relates to a mycoplasma pneumoniae rapid detection kit and a use method thereof, wherein the kit holds a loop-mediated isothermal amplification reaction tube and BstDNA polymerase; the reaction tube holds reaction buffer, dNTP, magnesium sulfate, a primer 1:5-ACCAATGCCATCAACCCG-3, a primer 2:5-TACCGGCGTAACGCAAAG-3, a primer 3:5-ATTTTCACCCGTGAGGGGGAGTTTTCGCTTAACCCCGTGAACG-3, a primer4:5-ACAGCGCTAAGGGCATCACTGTTTTTCAAAGCCGCTTCGGTTC-3, lycine, manganese chloride and calcein. The method for detecting mycoplasma pneumoniae comprises the following steps: extraction of a sample to be detected or bacterium DNA to be detected, loop-mediated isothermal amplification reaction of mycoplasma pneumoniae and colour development detection. The invention has the characteristics of accurate detection, high sensitivity, strong specificity, simpleness, convenience and rapidness.

The invention relates to a method for fast detecting bacteria specimen by loop mediate disothermal amplification technology (LAMP), particularly to a method for preparing a reagent kit for fast detecting salmonella typhosa and a method for detecting Salmonella typhosa. The reagent kit contains loop mediate disothermal amplification reaction liquid, Bst DNA polymerase and developer; the loop mediate disothermal amplification reaction liquid includes reaction buffer liquid, dNTP, bitter salt, upstream inner primer 5- TTACGTCACCAACGAC ACGGGACGTATTGGGCAATGACTGG-3, downstream inner primer 5- CGGTAAATACCATCCCCACGGCT AACGCAGCGAGAATGGC -3, upstream outer primer 5- GTCGCGTACTTTACGCCAT-3, downstream outer primer 5- ACCCTGACCATCCACCAG -3 and lycine; the method for detecting Salmonella typhosa comprises the steps of extracting bacterial DNA, loop mediate disothermal amplifying of the salmonella typhosa, and development detecting. The invention has the following advantages, including high speed, strong specificity, high sensitivity and low cost.

The present invention provides systems, devices, apparatuses and methods for automated bioprocessing. Examples of protocols and bioprocessing procedures suitable for the present invention include but are not limited to: immunoprecipitation, chromatin immunoprecipitation, recombinant protein isolation, nucleic acid separation and isolation, protein labeling, separation and isolation, cell separation and isolation, food safety analysis and automatic bead based separation. In some embodiments, the invention provides automated systems, automated devices, automated cartridges and automated methods of western blot processing. Other embodiments include automated systems, automated devices, automated cartridges and automated methods for separation, preparation and purification of nucleic acids, such as DNA or RNA or fragments thereof, including plasmid DNA, genomic DNA, bacterial DNA, viral DNA and any other DNA, and for automated systems, automated devices, automated cartridges and automated methods for processing, separation and purification of proteins, peptides and the like.

The invention discloses a primer and probe combination for quickly detecting candidatus Liberibacter asiaticus and a detection method. A primer pair for detecting candidatus Liberibacter asiaticus provided by the invention is composed of a) or b): a) a primer pair composed of two single-stranded DNA molecules shown in sequence 1 and sequence 2; and b) a prime pair which is composed of two single-stranded DNA molecules shown in sequences 1 and 2 substituted by one or more nucleotides and / or deleted and / or added and is as same as the primer pair in function. The probe provided by the invention is as follows from 5' end to 3' end: sequence 3-(dT-fluorophore)-tetrahydrofuran residual radical-(dT-quenching radical)-sequence 4; modification is performed on the 3' end of the probe. The whole detection process is within 1h, and the primer and probe combination which has the characteristics of being quick, specific and sensitive can meet quick primary inspection of field and forestry citrus samples and quick identification of bacterial DNA.

The invention discloses a nutritional food for improving intestinal dysfunction. The nutritional food for improving intestinal dysfunction is characterized by being prepared from wheat oligopeptide, glutamine, dietary fiber, oligosaccharide, maltodextrin and rice meal. Compared with the prior art, the nutritional food for improving intestinal dysfunction is beneficial to improving the intestinal dysfunction of patients comprehensively, can reduce bacterial translocation well, can reduce peripheral blood bacterium DNA (deoxyribonucleic acid) detection rate obviously, and can shorten much time in hospital, thereby reducing infective complications as well as lowering the burden of patients of families, the society and the country; and the nutritional food for improving intestinal dysfunction has no side effect, and has a favorable market prospect.

The invention relates to a loop-mediated isothermal amplification method for rapid detection of cholera toxin vibrio cholera. A reagent comprises a loop-mediated isothermal amplification reaction liquid, Bst DNA polymerase, and a chromogenic reagent, wherein the reaction liquid contains a reaction buffer liquid, dNTP, magnesium sulfate, an upstream inner primer 5-TGAATCCACGGCTCTTCCCT-TGGTTATGGATTGGCAGG-3, a downstream inner primer 5-GGTTGTGGGAATGCTCCAAG-ACTTTGGGTTTTTTCATCGC-3, an upstream outer primer 5- GATATTGCTCCAGCAGCA-3, a downstream outer primer 5-CGTCAAGGAATTTTACACCTAG-3, and betaine. The method for detecting the cholera toxin vibrio cholera comprises the steps of the extraction of bacterial DNA, the loop-mediated isothermal amplification of the cholera toxin vibrio cholera, and chromogenic detection. The method has the advantages of rapidness, strong specificity, high sensitivity, and low cost.

The invention relates to an alicyclic amine type naphthalimide metronidazole derivative and a preparation method and application thereof. A structure is shown in a formula I or a formula II. The alicyclic amine type naphthalimide metronidazole derivative has the advantages that the certain inhibiting activity on gram positive bacteria, gram negative bacteria and fungi is realized; after jointly using with clinical medicines, the antibacterial activity is greatly improved; the sterilizing speed is high, the development of medicine resistance is slow, and the derivative can be used for preparing anti-bacteria and / or anti-fungi medicines, and can be used as a bacterial DNA (deoxyribonucleic acid) embedding agent; the commercial degree of preparation raw materials is high, the cost is low, the obtaining is easy, the preparation route is short, and the method is simple and convenient. The formula I or formula II is shown in the attached figure.