Bacteria with limited reproductive capacity, methods for controlling bacterial reproduction and uses thereof
By combining non-natural amino acid orthogonal translation modules, suicide modules, and rescue modules, bacteria with limited reproductive capacity were designed, solving the problems of insufficient immune response and safety risks after vaccination in existing technologies, and achieving a balance between vaccine safety and immunogenicity.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
- Filing Date
- 2025-01-06
- Publication Date
- 2026-07-07
AI Technical Summary
Existing technologies are unable to effectively control the reproductive capacity of bacteria, leading to insufficient immune response after vaccination or safety risks caused by bacterial escape, and failing to meet the balance requirements of safety and immunogenicity of live attenuated vaccines.
By combining non-natural amino acid orthogonal translation modules, suicide modules, and rescue modules, bacteria with limited reproductive capacity were designed. Limited bacterial reproduction was achieved through gene circuit optimization, and bacterial growth and reproduction were controlled by utilizing the storage and suicide mechanisms of non-natural amino acids.
This approach achieves the goal of reducing bacterial escape rate while maintaining the immunogenicity and safety of the vaccine, thereby improving the safety and immune response of the vaccine and meeting the design requirements of live attenuated vaccines.
Smart Images

Figure CN122344541A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biotechnology and cell immunotherapy, and specifically relates to a bacterium with limited reproductive capacity, a method for controlling bacterial reproduction, and its application. Background Technology
[0002] Transgenic technology is being rapidly and massively applied in bioremediation, agriculture, bioenergy, and therapeutics. To protect natural ecosystems and address public concerns, the scientific community hopes to implement robust genetic barrier mechanisms to control the growth and reproduction of organisms containing foreign genes, preventing the accidental spread of GMOs. With the development of synthetic biology, "conditional suicide" systems have emerged. These systems, through genetic modification, render vaccine strains unable to survive under specific conditions (such as the lack of certain nutrients), thus ensuring their safety within the host. However, existing "conditional suicide systems" primarily rely on strategies such as essential gene regulation, toxin switches, and engineered immunodeficiency. While these methods have improved the safety of GMOs to some extent, escape vulnerabilities remain, such as essential protein crossfeeding, gene leakage expression, and gene mutations that may jeopardize safety. Auxotrophic design, as an ideal biological control method, works by making the growth of strains dependent on substances absent in the natural environment. However, existing auxotrophic designs also have certain escape concerns. For example, toxin / antitoxin systems may be inactivated by selective pressure, and metabolic deficiencies may evade escape by clearing nearby essential metabolites or crossfeeding from established niches. It is evident that existing biological genetic barriers are still insufficient to completely control bacterial growth and prevent the escape of pathogens, and cannot fully meet the needs for safe and efficient transgenic organisms.
[0003] In the fields of public health and agriculture, the emergence and spread of infectious diseases have always been a major challenge. Vaccination, as a highly effective and widely used method, is undeniably crucial for the effective prevention and control of infectious disease transmission. Live attenuated bacterial vaccines, as a highly effective preventative measure, are considered a promising vaccine type due to their ability to provide a comprehensive antigen array, triggering broad humoral and cellular immune responses that closely resemble the natural infection process. However, the self-replication process of live attenuated vaccines within the host presents a challenge in balancing safety and immunogenicity. The high immunogenicity induced by the self-replication process of live attenuated vaccines within the host, while endowing the vaccine with strong immunostimulatory capabilities, also introduces safety risks. Over-replication of vaccine strains within the host can lead to adverse reactions, and in some cases, the vaccine strain may even regain virulence through gene mutation or horizontal gene transfer, thereby inducing disease. Furthermore, the persistent leakage risk of vaccine strains into the natural environment is also a significant concern.
[0004] To balance vaccine safety and efficacy, scientists have conducted extensive research and practice. Traditional attenuation methods primarily involve direct modification of the pathogen's genome, such as directly deleting virulence genes and increasing the expression of exogenous genes to inhibit virulence. While this reduces the virulence of vaccine strains to some extent, it may also disrupt the integrity of the antigen, affecting the vaccine's immunogenicity. Furthermore, these genetically modified pathogens carry the risk of virulence recovery due to horizontal gene transfer. Additionally, the low self-replication rate of attenuated strains within the host after vaccination is also a significant factor affecting vaccine efficacy. Although orthogonal genetic barriers designed based on non-natural amino acid orthogonal translation systems provide a safe means of controlling bacterial growth, excessive attenuation of pathogens before nutrient depletion can reduce post-vaccination immunization. Therefore, how to improve the immunogenicity of vaccines while ensuring their safety is a crucial issue in current research on live attenuated vaccines.
[0005] In summary, the key challenge of existing technologies lies in the difficulty of controlling bacterial reproduction. On the one hand, insufficient bacterial generations can lead to premature attenuation, potentially resulting in an inadequate immune response after vaccination and affecting protective efficacy. On the other hand, traditional control methods carry the risk of bacterial escape growth and gene leakage expression, as well as virulence reversion due to gene mutations caused by metabolite cross-feeding or gene mutations. Therefore, controlling bacterial reproduction to achieve limited reproduction, while ensuring vaccine safety by minimizing escape, can enhance immunogenicity and has promising applications in the design of attenuated vaccines. Summary of the Invention
[0006] Addressing the current challenges in regulating bacterial "escape rate" and "reproductive capacity," and lacking effective solutions to the insufficient immune response and virulence reversion issues arising from existing attenuated strains, as well as safety concerns caused by escape growth, this invention aims to provide bacteria with limited reproductive capacity and methods for controlling bacterial reproduction. By controlling bacterial reproduction, while maintaining the advantages of attenuated strains carrying complete antigens and the "high immunogenicity" brought about by the natural infection process, this invention reduces the escape rate and alleviates the "safety concerns" caused by excessive pathogen proliferation through gene circuit design and element optimization, providing new ideas and solutions for the development of attenuated live vaccines.
[0007] To achieve the above objectives, the present invention employs the following technical solution: In a first aspect, the present invention provides a bacterium with limited reproductive capacity, wherein the bacterial DNA comprises a non-natural amino acid orthogonal translation module, a suicide module, and a rescue module; The non-natural amino acid orthogonal translation module includes a non-natural amino acid aminoacyl-tRNA synthetase expression cassette and a non-natural amino acid-specific tRNA expression cassette. The suicide module and the rescue module are respectively a bacterial essential gene expression cassette and a reserve gene expression cassette; or the suicide module and the rescue module are respectively a toxin gene expression cassette and an antitoxin gene expression cassette. The rescue module contains a codon recognized by the non-natural amino acid-specific tRNA.
[0008] Non-natural amino acids are selected from pAzF or Cl2Y; Wherein, when the non-natural amino acid is pAzF, the non-natural amino acid aminoacyl-tRNA synthetase is MjpAzFRS, and the non-natural amino acid-specific tRNA is MjtRNA. Phe CUA ; Wherein, when the non-natural amino acid is Cl2Y, the non-natural amino acid aminoacyl-tRNA synthetase is MjTyrRS, and the non-natural amino acid-specific tRNA is MjtRNA. Tyr CUA ; Preferably, the codon recognized by the non-natural amino acid-specific tRNA is UAG; Preferably, the bacteria are selected from Escherichia coli, Pseudomonas aeruginosa, Pasteurella multocida, and Brucella.
[0009] The suicide module and the rescue module are respectively a bacterial essential gene expression cassette and a reserve gene expression cassette, wherein each of the bacterial essential gene expression cassette and the reserve gene expression cassette independently contains one or more codons recognized by the non-natural amino acid-specific tRNA; wherein the reserve gene is a bacterial non-essential gene or an exogenous non-toxic gene. Preferably, the essential bacterial gene is selected from... dnaA , murG , serS , holB, lolC, ssb, alaS, metG as well as tyrS.
[0010] The suicide module and the rescue module are respectively a toxin gene expression cassette and an antitoxin gene expression cassette, wherein the antitoxin gene expression cassette contains one or more codons recognized by the non-natural amino acid-specific tRNA; Preferably, the toxin gene-antitoxin gene is selected from... parE-parD or doc-phd.
[0011] In a second aspect, the present invention provides a method for controlling bacterial reproduction, wherein a non-natural amino acid orthogonal translation module, a suicide module, and a rescue module are introduced into the bacteria to obtain bacteria with limited reproductive capacity. The non-natural amino acid orthogonal translation module includes a non-natural amino acid aminoacyl-tRNA synthetase expression cassette and a non-natural amino acid-specific tRNA expression cassette. The suicide module and the rescue module are respectively a bacterial essential gene expression cassette and a reserve gene expression cassette; or the suicide module and the rescue module are respectively a toxin gene expression cassette and an antitoxin gene expression cassette. The rescue module contains a codon recognized by the non-natural amino acid-specific tRNA.
[0012] The non-natural amino acids are selected from pAzF or Cl2Y; Wherein, when the non-natural amino acid is pAzF, the non-natural amino acid aminoacyl-tRNA synthetase is MjpAzFRS, and the non-natural amino acid-specific tRNA is MjtRNA. Phe CUA ; Wherein, when the non-natural amino acid is Cl2Y, the non-natural amino acid aminoacyl-tRNA synthetase is MjTyrRS, and the non-natural amino acid-specific tRNA is MjtRNA. Tyr CUA ; Preferably, the codon recognized by the non-natural amino acid-specific tRNA is UAG.
[0013] The suicide module and the rescue module are respectively a bacterial essential gene expression cassette and a reserve gene expression cassette, wherein each of the bacterial essential gene expression cassette and the reserve gene expression cassette independently contains one or more codons recognized by the non-natural amino acid-specific tRNA; wherein the reserve gene is a bacterial non-essential gene or an exogenous non-toxic gene. Preferably, the essential bacterial gene is selected from... dnaA , murG , serS , holB, lolC, ssb, alaS, metG as well as tyrS.
[0014] The suicide module and the rescue module are respectively a toxin gene expression cassette and an antitoxin gene expression cassette, wherein the antitoxin gene expression cassette contains one or more codons recognized by the non-natural amino acid-specific tRNA; Preferably, the toxin gene-antitoxin gene is selected from... parE-parD or doc-phd.
[0015] The bacteria are selected from Escherichia coli, Pseudomonas aeruginosa, Pasteurella multocida, or Brucella.
[0016] In a third aspect, the present invention provides the use of bacteria with limited reproductive capacity or methods for controlling bacterial reproduction in the preparation of attenuated live vaccines. Attached Figure Description
[0017] Figure 1 The diagram illustrates the design framework of the finite-generation organism of this invention. The regulatory circuitry for this finite-generation organism consists of three modular structures: an ncAA (orthogonal translation) module, a rescue module, and a suicide module. The ncAA module provides ncAA, enabling targeted insertion during translation. The ncAA rescue module stores a certain amount of ncAA supply, providing a delay when switching to "suicide" mode. The suicide module controls the self-termination of bacterial reproduction. Through the systematic combination of these three modules, the host bacteria can exhibit reproductive potential under the ncAA supply of the rescue module. When the ncAA released by the rescue module is depleted, the host strain stops growing due to the shutdown of essential gene expression or toxin accumulation, achieving precise biosafety control. The rescue module-suicide module can be a storage protein-essential gene (A) or an antitoxin-toxin (B). Figure 2 This is a schematic diagram of the plasmid for the non-natural amino acid orthogonal translation module of the present invention. The non-natural amino acid orthogonal translation module includes a non-natural amino acid aminoacyl tRNA synthetase (aaRS) expression cassette and a non-natural amino acid-specific tRNA expression cassette. Figure 3 The test results are for the orthogonal translation module of non-natural amino acids, where a is a schematic diagram of the gene circuit containing the Cl2Y orthogonal translation module and the reporter module, and b is the test results for the dehydrated tetracycline-induced expression level of the Cl2Y system. Figure 4 For the safety testing of essential gene expression systems, a is a schematic diagram of the essential gene expression cassette, and b is the escape rate test results of different essential gene systems; Figure 5 A schematic diagram of the design of elements for a limited reproductive organism based on an essential gene expression system is provided, where a represents the gene circuit design of the ncAA module, rescue module, and suicide module, and b represents the principle of limited reproduction. Figure 6 A procedure for observing and quantitatively detecting the reproductive capacity of organisms with limited reproductive capabilities; Figure 7 This invention is based on essential genes serS The limited reproduction detection plots of the expression system are shown, where a is the average reproductive capacity statistics; b is the continuous observation results of limited reproduction; and c is the distribution plot of limited reproductive capacity. Figure 8 Other essential genes for this invention ( murG and dnaA( ) Limited reproduction detection diagram of the expression system, where a represents the sequencing results of essential genes for engineering; b represents dnaA Statistical graph of average reproductive capacity of host cells after gene editing; c represents murG Statistical graph of average reproductive capacity of host cells after gene editing; d represents dnaA Distribution of host cell limited reproductive capacity after gene editing; e represents... murG Distribution of limited proliferative capacity of host cells after gene editing; Figure 9 This is a flowchart of the toxin-antitoxin system detection process of the present invention; Figure 10 This is a schematic diagram of the design of finite life form components based on the toxin-antitoxin system of the present invention, where a is a schematic diagram of the finite reproduction mode based on the toxin-antitoxin system; b is a schematic diagram of the finite reproduction principle. Figure 11 This invention is based on doc-phd The system's finite reproduction detection graph, where a is based on doc-phd a) Diagram of the system's finite reproduction pattern; b) Continuous observation results of finite reproduction; c) Statistical chart of average reproductive capacity; d) Distribution chart of finite reproductive capacity; Figure 12 This is a diagram illustrating the finite reproduction optimization design of the toxin-antitoxin system based on the present invention, where ab represents the target... parE-parD The system is designed with CD as the target. doc-phd The system is designed to enhance limited reproductive capacity; a. Based on parE-parD a. Systematic finite reproduction design optimization diagram; b. Continuous observation and quantitative statistical results of finite reproduction; c. Based on doc- phd d. System finite reproduction design optimization diagram; d. Continuous observation and quantitative statistical results of finite reproduction. Detailed Implementation
[0018] In this invention, by constructing a non-natural amino acid orthogonal translation module and designing a limited-reproduction bacterial system based on this module, a limited-reproduction bacterial system for designing safe and efficient attenuated live vaccines was finally obtained. This method proposes and verifies the concept of limited bacterial reproduction for the first time. Based on the traditional "genetic orthogonal barrier" in biocontrol development, it proposes and verifies the concept of controllable limited reproduction. Through gene circuit design and modular combination of elements, the design method for reducing escape rate and regulating limited reproduction space is optimized. Based on the traditional "essential gene control" and "toxin-antitoxin control," this method achieves a lower efficiency (10) than traditional design methods by optimizing module design. -6 The low escape rate of bacteria improves their safety. While the art has proposed inserting ncAA into essential genes (i.e., "synthetic auxotrophs") to reduce escape frequency (Mandell et al., 2015; Rovner et al., 2015), attenuated live strains based on this technology struggle to elicit sufficient immune responses in vivo due to the rapid death of the strain after ncAA supply is interrupted. This invention creatively incorporates a rescue module, introducing for the first time the concept of "non-natural amino acid storage," allowing bacteria to maintain limited reproduction using stored amino acids and cease reproduction as storage is depleted. This mimics the high immunogenicity of natural pathogen infection while avoiding the safety risks associated with unlimited reproduction. Such vaccines, combining safety and immunogenicity, are particularly important for susceptible populations. Introducing the concept of finite-generation organisms into vaccine design, compared to traditional genetic engineering methods, preserves the complete antigens of the pathogen, thereby eliciting a stronger immune response. Furthermore, the limited reproduction of these bacteria prevents them from utilizing environmental compounds to bypass biosafety control mechanisms through metabolism, thus meeting the safety standards for vaccine development.
[0019] On the other hand, by establishing a finite-generation life framework and utilizing synthetic biology design principles to modularize components, the regulated finite-generation reproduction number can provide escape prevention and programmable growth regulation, offering greater design space for immunogenicity optimization. Furthermore, the selection of toxins, antitoxins, non-natural amino acids, and essential genes in the ncAA orthogonal translation module, rescue module, and suicide module follows the principles of biological functional conservation and widespread existence, thus possessing the potential to be extended to the design of other transgenic life forms and used for vaccine development for various pathogens. This versatility and practicality make this method highly promising for application in vaccine development, particularly in the development of live attenuated vaccines.
[0020] The term "reproductive capacity limited" as used herein refers to the fact that host bacteria do not possess the ability to reproduce indefinitely, for example, their reproductive capacity does not exceed 10 generations after initiating the expression of suicide genes or toxin genes, preferably not exceeding 4 generations on average. In contrast, naturally occurring bacteria are generally considered to have unlimited reproductive capacity under adequate nutrient conditions; while auxotrophic bacteria cease reproduction within one generation when lacking the corresponding growth factors. In this invention, organisms with limited reproductive capacity are also referred to as limited-generation organisms. Given the portability of the method of this invention, bacteria whose reproductive capacity can be controlled using the method of this invention include *Escherichia coli* (…). Escherichia coli ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa Brucella ( Brucella sp Pasteurella multocida (.), Avibacterium gallinarum (but not limited to this).
[0021] The term "non-natural amino acid (ncAA)" used in this article refers to non-protein amino acids. Non-natural amino acids are not encoded by the 64 natural genetic codons. They are functional aaRS / tRNA pairs independent of the cellular endogenous aminoacylation mechanism (specifically recognizing and binding to non-natural amino acids), ensuring that the active site of aaRS can only specifically activate the non-natural amino acid of interest, not endogenous host amino acids, and thus aminoacylate their homologous tRNAs. In existing technologies, ncAAs are incorporated into peptide chains by enabling non-natural amino acid aminoacyl-tRNA synthetase (aaRS) / non-natural amino acid-specific tRNA to recognize stop codons, rare codons, or quadruple codons, utilizing the biologically generated translation system to produce polypeptides or proteins containing ncAAs. Non-natural aaRS cannot recognize endogenous host tRNAs or amino acids, but can only aminoacylate their ligand tRNAs; on the other hand, non-natural amino acid-specific tRNAs and ncAAs cannot be recognized by endogenous aaRS. Therefore, the reaction involving non-natural amino acid aminoacyl-tRNA synthetase, natural amino acid-specific tRNAs, and non-natural amino acids is orthogonal to the host's endogenous translation module. In this invention, the module consisting of a non-natural amino acid aminoacyl-tRNA synthetase expression cassette and a non-natural amino acid-specific tRNA expression cassette is referred to as an "orthogonal translation module." By employing the ncAA orthogonal translation module, the genetic information of the vaccine strain is precisely controlled, which ensures that the vaccine maintains high genetic stability during propagation and effectively avoids the risk of mutation or reversion to pathogenicity.
[0022] In this field, amber suppression is commonly used to achieve ncAA insertion. The specific process involves: a) generating an orthogonal tRNA containing a non-natural amino acid, which decodes the amber codon UAG (TAG on DNA); the non-natural amino acid-tRNA is generated by an orthogonal aminoacyl-tRNA synthetase, whose sole function is to transfer ncAA to its corresponding orthogonal tRNA; b) delivering the non-natural amino acid-tRNA substrate to a ribosome using EF-Tu; and c) adding ncAA to the peptide chain within the ribosome. Therefore, with exogenous ncAA supply, the host cell only needs a non-natural amino acid aminoacyl-tRNA synthetase expression cassette and a non-natural amino acid-specific tRNA expression cassette to recognize the UAG codon. In this invention, the codon recognized by the non-natural amino acid-specific tRNA is preferably the amber codon UAG.
[0023] In this invention, the rescue module contains a codon recognized by the non-natural amino acid-specific tRNA. When exogenous ncAA is supplied, ncAA is incorporated into the rescue module; when the exogenous ncAA supply is stopped, ncAA is released from the rescue module due to amino acid recycling, thereby achieving ncAA-dependent growth control. The term "suicide module" refers to a module capable of switching host cell survival to death in response to a specific signal. The term "rescue module" refers to a module that controls the number of generations of host bacteria after the administration of a suicide signal. In this invention, the suicide signal is exogenous ncAA. The exogenous ncAA is orthogonal to the endogenous signal under physiological conditions, ensuring the safety of the vaccine against inactivation. After a period of time following the cessation of exogenous ncAA supply, the suicide module ensures safety by switching the host bacteria to a death mode.
[0024] In some embodiments, the suicide module and the rescue module are respectively a bacterial essential gene expression cassette and a reserve gene expression cassette. In such embodiments, each of the bacterial essential gene expression cassette and the reserve gene expression cassette independently contains one or more codons recognized by the non-natural amino acid-specific tRNA. When exogenous ncAA is supplied, ncAA is incorporated into the reserve protein and the bacterial essential protein. When the exogenous supply of ncAA is stopped, due to amino acid recycling, ncAA is supplied by the reserve protein, allowing the bacteria to continue growing / reproducing for a period of time; until the ncAA in the reserve protein is exhausted, the essential protein cannot be synthesized, leading to bacterial death, thus ensuring safety. Furthermore, the use of essential genes / reserved genes enhances the viability and stability of the vaccine strain, which is a strong guarantee for efficient vaccine preparation.
[0025] Regarding reserve proteins, any protein that does not affect the normal physiological activities of bacteria can be considered a reserve protein, such as non-essential bacterial proteins or exogenous proteins (e.g., fluorescent proteins, non-functional peptides, proteins that function in non-host organisms, etc.). Essential proteins / essential genes of bacteria are genes / proteins indispensable for the survival of the host organism. Non-essential genes / non-essential proteins of bacteria are genes / proteins whose knockout does not affect the basic physiological activities of the host organism. Many essential and non-essential genes of bacteria are known in this field. For example, a list of Escherichia coli genes can be found at https: / / shigen.nig.ac.jp / ecoli / pec / ; of which there are 302 essential genes and 4439 non-essential genes. Pseudomonas aeruginosa has 321 essential genes (https: / / doi.org / 10.1073 / pnas.1900570116). Brucella (… Brucella sp.For example, see https: / / doi.org / 10.1007 / s00438-015-1154-z for essential genes. It is known in the art that essential bacterial genes can also be determined based on homology analysis. In a preferred embodiment, essential bacterial proteins are selected from chromosome replication initiation protein DnaA, undecylene diphosphate pentapeptide-N-acetylglucosamine transferase MurG, serine-tRNA ligase SerS, HolB (involved in DNA replication), LolC (involved in lipoprotein release), DNA-binding protein Ssb, alanine tRNA synthetase AlaS (involved in translation), methionine tRNA synthetase MetG, and tyrosine tRNA synthetase TyrS. 。 In a more preferred embodiment, the bacterial essential protein is selected from chromosome replication initiation protein DnaA, undecylene diphosphate pentapeptide-N-acetylglucosamine transferase MurG, or serine-tRNA ligase SerS. 。 In *Escherichia coli*, the NCBI accession numbers for the three proteins mentioned above are, for example, ELA5789814.1, WP_000016560.1, and WP_000886683.1. In *Pseudomonas aeruginosa*, the NCBI accession numbers for the three proteins mentioned above are, for example, MFA7902971.1, HFQ2053702.1, and PPB16199.1. In *Brucella*, the NCBI accession numbers for the three proteins mentioned above are, for example, MCL7997286.1, WP_187960307.1, and WP_154169231. In *Pasteurella multocida*, the NCBI accession numbers are, for example, WP_103853849.1, WP_115261335, and WP_103852799. It is known in the art that bacterial genomes evolve rapidly; therefore, proteins substantially homologous to the proteins mentioned above can also be used. The term "fundamental homology" refers to proteins that are at least 80% or at least 90% identical at the sequence level. Homologous sequences can be functionally identical coding sequences in different species. Homologs of the genes or proteins of this invention can be readily determined by those skilled in the art.
[0026] In such implementations, the non-natural amino acid orthogonal translation module and the rescue module (containing reserve genes) may exist in the same or different plasmids; the suicide module (containing essential genes) exists in the host cell genome.
[0027] In some embodiments, the suicide module and the rescue module are respectively a toxin gene expression cassette and an antitoxin gene expression cassette. In such embodiments, the antitoxin gene contains one or more codons recognized by the non-natural amino acid-specific tRNA. When exogenous ncAA is supplied, the ncAA is incorporated into the antitoxin protein by the ncAA orthogonal translation module, allowing the antitoxin protein to fold normally and antagonize the toxin protein; when exogenous ncAA supply is stopped, a certain amount of antitoxin protein has accumulated due to its long half-life; the antitoxin protein is consumed during continuous cell division. When the antitoxin is insufficient to neutralize the toxicity of the toxin protein, bacterial reproduction ceases. Commonly used toxin gene-antitoxin gene pairs in the art include... doc-phd (Castro-Roa et al., 2013), parE-parD (Hallez et al., 2010; RuanS, 2024), Kid-Kis (Ruiz-Echevarría et al., 1991), Zeta-Epsilon (Mutschler and Meinhart, 2011), ccdB-ccdA (Critchlow et al., 1997) etc. Among them, doc-phd Doc (a toxin protein found in various pathogens) d eath o n c Phosphorylation of translation elongation factor EF-Tu by uring inhibits the translation process, and antitoxin protein PhD ( p revents h ost d ParE can neutralize Doc. The toxin protein ParE inhibits DNA twisting enzymes, and ParD relieves ParE's effect on DNA replication by binding to ParE. Kid-Kis , Zeta-Epsilon as well as ccdB-ccdA These methods involve interfering with DnaB to block DNA replication, inhibiting cell wall synthesis, and blocking transcription. In this invention, the toxin gene-antitoxin gene pair is preferably... doc-phd or parE-parD.The NCBI accession numbers for Doc, PhD, ParE, and ParD proteins are, for example, WP_001216045.1, WP_225312251.1, WP_011205808.1, and WP_011205807.1. Proteins that are essentially homologous to the above proteins can also be used. The toxin-antitoxin system enables conditional control over the reproductive capacity of vaccine strains, allowing for precise regulation of toxin and antitoxin expression levels. This allows for control over the number of generations of vaccine strain reproduction, ensuring that the vaccine achieves its intended effect without causing unnecessary harm to the human body.
[0028] In such embodiments, the non-natural amino acid orthogonal translation module, the suicide module (containing a toxin gene), and the rescue module (containing an antitoxin gene) can reside in the same plasmid, making transformation operations more convenient. In some embodiments, the non-natural amino acid orthogonal translation module, the suicide module, and the rescue module reside in the host bacterial genome, resulting in more stable immunogenicity. In some embodiments, the non-natural amino acid orthogonal translation module and the rescue module reside in the first plasmid, while the suicide module resides in the second plasmid, thereby facilitating the adjustment of the transcription / translation intensity ratio of the suicide module and the rescue module.
[0029] The term "expression cassette" refers to a DNA segment consisting of one or more genes and sequences that control the expression of those genes, enabling the protein encoded by those genes to be expressed in a desired host cell. In prokaryotic cells, the sequences controlling gene expression may optionally include a promoter and a terminator. The term "promoter" refers to a DNA region that drives the expression or transcription of a nucleic acid sequence, located upstream of the synonymous strand of the transcription start site of the gene. A promoter generally contains a transcriptional regulatory region (inducible promoter), an RNA polymerase recognition region, and a transcription start site. The term "minimal promoter" refers to a minimal transcriptional control unit capable of initiating transcription, such as a promoter core region containing only an RNA polymerase recognition region and a transcription start site. As illustrated in the embodiments of the present invention, by combining different core promoter sequences with ribosome binding sites (RBS), the strength of the promoter can be modulated, thereby regulating the transcriptional strength of the rescue module and the suicide module. This allows control of bacterial generations, thereby altering the immunogenicity of finite-generation bacteria. Furthermore, the number of inserted ncAAs can be adjusted by controlling the number of specific codons contained in the expression cassette, thereby controlling the bacterial generations.
[0030] In some preferred embodiments, the non-natural amino acid is 3,5-dichlorotyrosine (Cl2Y), where Cl2Y is a tyrosine analog. In such embodiments, the non-natural amino acid aminoacyl-tRNA synthetase is MjTyrRS, and the non-natural amino acid-specific tRNA is a tyrosine succinate repressor tRNA, MjtRNA, derived from methanogenic cocci. Tyr CUA MjtRNA Tyr CUA The / MjTyrRS pair together constitutes a non-natural amino acid orthogonal translation system that can specifically recognize and transport Cl2Y to the specific codon UAG position. MjTyrRS, along with tRNA and MjtRNA, form the system. Tyr CUA The NCBI login number is MW879731.1.
[0031] In some preferred embodiments, the non-natural amino acid is p-azido-phenylalanyl (pAzF), where pAzF is a phenylalanine analog. In such embodiments, the non-natural amino acid aminoacyl-tRNA synthetase is MjpAzFRS, and the non-natural amino acid-specific tRNA is MjtRNA, a phenylalanine succinate repressor tRNA derived from methanogens. Phe CUA MjtRNA Phe CUA The / MjpAzFRS pair together constitutes a non-natural amino acid orthogonal translation system that can specifically recognize and transport pAzF to the specific codon UAG position. MjpAzFRS and MjtRNA are also involved. Phe CUA The NCBI login number is MF996913.1.
[0032] The Escherichia coli strain used in this invention is C321.ΔA (Science. 2013 Oct 18;342(6156):357-60. doi: 10.1126 / science.1241459.), which replaces all known UAG stop codons in Escherichia coli MG1655 with synonymous UAA codons and knocks out release factor 1 (RF1) to redistribute the translation function of UAG codons.
[0033] This invention provides two genetic pathways for finite reproduction ( Figure 1This allows for the dynamic regulation of the safe control and reproductive capacity of a limited number of bacteria, providing regulatory direction and optimization space for achieving a balance between vaccine "safety" and "immunogenicity". Addressing concerns about "safety" caused by bacterial escape growth, an orthogonal transcriptional barrier based on an essential gene expression system was developed, enabling bacteria to rely on ncAA for survival and achieving a level of less than 10 after editing a single essential gene. -6 Escape rate level; Regarding the "immunogenicity" requirements of live attenuated vaccines, the concept of ncAA storage was introduced to design and achieve limited bacterial reproduction to elicit a more comprehensive immune response. Building upon the achievement of limited reproduction using essential gene systems, a new limited reproduction design platform based on the toxon-antitoxin (TA) system was developed. This platform significantly improved the ability to limit reproduction (from approximately 1-2 generations to around 4 generations) by modularly designing the expression level of antitoxin.
[0034] Example 1 Selection and Detection of Orthogonal Translation Modules for Non-Natural Amino Acids in Escherichia coli C321 ΔA (a) Design concept of non-natural amino acid system Non-natural amino acid systems have been reported to be used in transgenic organism design to regulate organism growth, engineered protein synthesis to improve protein structure and function, and attenuated live vaccine design, among other fields. A non-natural amino acid system consists of four parts: 1. Non-natural amino acid codons: These exist in DNA and can be tetrad codons, rare codons, stop codons, etc.
[0035] 2. Non-natural amino acid aminoacyl-tRNA synthetase (aaRS): One of the components in the non-natural amino acid orthogonal translation module, responsible for linking non-natural amino acids to tRNA. It cannot recognize endogenous host tRNA or amino acids, but can only aminoacylate their ligand tRNA.
[0036] 3. Non-natural amino acid-specific tRNA: One of the components in the non-natural amino acid orthogonal translation module, non-natural amino acid-specific tRNA.
[0037] 4. Non-natural amino acid small molecules, added exogenously.
[0038] Through literature review, the inventors compiled a list of commonly used systems in prokaryotic and eukaryotic systems, such as bipA, pAzF, pIF, PyL, and Cl2Y. The pAzF and Cl2Y systems were selected for testing. In the following text, the orthogonal translation modules based on pAzF and Cl2Y will be referred to as the pAzF orthogonal translation module and the Cl2Y orthogonal translation module, respectively.
[0039] p-Az-phenylalanyl (pAzF) is a phenylalanine analogue, and its corresponding non-natural amino acid aminoacyl-tRNA synthetase is MjpAzFRS; the non-natural amino acid-specific tRNA is derived from methanogenic cocci (…). Methanococcus jannaschii ) Phenylalanine succinate inhibitor tRNA MjtRNA Phe CUA MjpAzFRS and MjtRNA Phe CUA The NCBI accession number is MF996913.1. MjpAzFRS can catalyze the generation of pAzF-tRNA and MjtRNA. Phe CUA During the extension process, pAzF-tRNA and MjtRNA... Phe CUA It recognizes the UAG codon in mRNA (TAG on DNA) and adds pAzF to the peptide chain.
[0040] 3,5-Dichlorotyrosine (Cl2Y) is a tyrosine analogue, and its corresponding non-natural amino acid aminoacyl-tRNA synthetase is MjTyrRS; the non-natural amino acid-specific tRNA is derived from methanogenic cocci (…). Methanococcus jannaschii ) Tyrosine succinate inhibitor tRNA MjtRNA Tyr CUA MjTyrRS and tRNA MjtRNA Tyr CUA The NCBI accession number is MW879731.1. MjTyrRS can catalyze the generation of Cl2Y-tRNA and MjtRNA. Tyr CUA During the elongation process, Cl2Y-tRNAMjtRNA Tyr CUA It recognizes the UAG codon in mRNA (TAG on DNA) and adds Cl2Y to the peptide chain.
[0041] (ii) Orthogonal translation module test of non-natural amino acids 1. Plasmid construction Figure 2 This is a schematic diagram of a plasmid for a non-natural amino acid orthogonal translation module (ncAA module). The ncAA module contains an aminoacyl-tRNA synthetase (aaRS) expression cassette and a tRNA expression cassette. An inducible promoter is attached to the 5' end of the aaRS coding sequence, and a terminator UAA is attached to the 3' end; a constitutive promoter (specifically using P) is attached to the 5' end of the tRNA coding sequence. proKThe sequence is aggcattttgctattaagggattgacgagggcgtatctgcgcagtaagatgcgccccgcatt (as shown in SEQ ID NO. 5), with a terminator UAA attached to the 3' end. The tested inducible promoters include P... tet and P Bad (The promoter sequence of this invention can be found in Chinese patent application 202010706100.1). The inducers are anhydrous tetracycline (aTc), arabinose, and IPTG, respectively. The constitutive promoter ensures constant tRNA expression. The sequences of aaRS and tRNA in the pAzF and Cl2Y orthogonal translation modules are as described above.
[0042] To test the ncAA insertion effect of the non-natural amino acid orthogonal translation module, a reporter plasmid containing a GFP expression cassette was constructed. In the GFP expression cassette, a promoter P is attached to the 5' end of the GFP coding sequence. tac The 3' end is connected to the terminator TAA; in addition, two TAGs are inserted after the start codon ATG. Under normal circumstances, the TAGs would be recognized as a termination signal, but in orthogonal translation systems, they are recognized by specific aaRS and tRNAs and translated into non-natural amino acids. Figure 3 a is a schematic diagram of the gene circuit containing the Cl2Y orthogonal translation module and the reporter module.
[0043] The aaRS and tRNA gene expression cassettes were cloned into vectors containing p15A replicons to construct non-natural amino acid orthogonal translation module plasmids, which were used to transfect cells together with fluorescent reporter plasmids to achieve orthogonal translation of non-natural amino acids.
[0044] 2. Fluorescence expression level test After constructing the plasmid for the non-natural amino acid orthogonal translation module, the fluorescence expression level was tested. The expression level was tested using the steady-state method (Zhang, HM, et al., Measurements of Gene Expression at Steady State Improve the Predictability of Part Assembly. ACSSynth Biol, 2016. 5(3): p. 269-73) constructed by Lou Chunbo's group. Flow cytometry was used to quantify and statistically analyze the fluorescence level of bacteria after induction, and to analyze the background level before induction and the orthogonal translation level after induction in different systems.
[0045] like Figure 3As shown in b, before induction, the background fluorescence levels of different systems were low. The Cl2Y system had a low background fluorescence level, meaning that it hardly produced fluorescence in the absence of an inducer, indicating minimal background noise interference. After adding the inducer, the Cl2Y system exhibited a high translation level, indicating that the non-natural amino acids were correctly inserted into the fluorescent reporter protein, resulting in a strong fluorescence signal. (The last sentence appears to be incomplete and possibly refers to a different system.) tet Replace with P Bad or P tac The results were similar, indicating a high degree of modularity in the system. In this test, the positive control (PC) was the level of GFP induced by the intact fluorescent protein without the inserted ncAA codon. The negative control (NC) was a blank cell control.
[0046] In addition, the PazF orthogonal translation module and reporting module were tested. Although the PazF system also showed a high level of translation after induction and was able to implement PazF insertion, its background expression was higher than that of the Cl2Y system. Therefore, the Cl2Y system was used for further testing and optimization.
[0047] Example 2: Required Gene Testing Building upon Example 1, a limited-reproduction bacteria was designed by combining a non-natural amino acid orthogonal translation module with an essential gene system. By precisely editing essential genes and inserting specific non-natural amino acid codons (such as UAG), efficient control over bacterial growth was achieved.
[0048] 1. Selection of essential genes To achieve a low escape rate, the essential genes and editing sites to be edited are selected. The selection of essential genes must meet the following requirements.
[0049] (1) It plays an important role in the cell to ensure that the edited bacteria cannot grow when there is a lack of specific non-natural amino acids.
[0050] (2) The function of the candidate protein is not easily replaced by other proteins, so as to avoid escape caused by compensation by other proteins.
[0051] (3) Considering that there may be homologous sequences on the genome, the essential protein genes should be distributed in a dispersed manner on the genome to avoid potential lateral gene transfer.
[0052] (4) The functions of essential proteins are highly conserved and can be extended to the regulation of the reproductive capacity of other bacteria. After comprehensive consideration, the chromosome replication initiation protein gene was selected. dnaA Undecyl diphosphate pentapeptide-N-acetylglucosamine transferase gene murG and serine-tRNA ligase gene serSThe protein sequences of DnaA, MurG, and SerS were found to be ELA5789814.1, WP_000016560.1, and WP_000886683.1, respectively, and they are involved in DNA replication, cell wall synthesis, and protein translation, respectively.
[0053] 2. Insertion of non-natural amino acid codons - TAGs on DNA The insertion site requirements for non-natural amino acid codons (TAGs) are as follows: Correct translation and folding must still be possible after insertion to ensure the biological function of the non-natural amino acid-protein. Specific requirements are as follows: (1) Structural tolerance: The site where the TAG codon is inserted should have high tolerance in the protein structure to ensure that the insertion does not affect the protein’s biological function.
[0054] (2) Core functional sites: The TAG codon should be inserted into the core functional sites of the protein to achieve efficient control of bacterial growth.
[0055] Referring to the work of Farren J. Isaacs (Rovner AJ, Haimovich AD, Katz SR, Li Z, Grome MW, Gassaway BM, Amiram M, Patel JR, Gallagher RR, Rinehart J, Isaacs FJ. Recoded organisms engineered to depend on synthetic amino acids. Nature. 2015 Feb 5;518(7537):89-93), we designed the TAG codon insertion sites at DnaA.W6, MurG.F243, and SerS.F213, inserting two TAGs at each of these positions. Figure 4 a). We also examined other essential genes, such as those involved in DNA replication. holB lipoprotein release lolC DNA-binding proteins ssb and alanine tRNA synthetase involved in translation alaS Methionine tRNA synthetase metG Tyrosine tRNA synthetase tyrS Computer modeling can be used to design codon positions to predict how protein stability changes after the insertion of non-natural amino acids.
[0056] 3. Safety control based on essential gene expression systems (1) Essential gene editing Using the λ-Red recombinase method (Jiang, Y., et al., Multigene Editing in the Escherichia coli Genome via the CRISPR-Cas9 System. Applied and Environmental Microbiology, 2015. 81(7): p. 2506-2514), the TAG codon was precisely knocked into the necessary genes in the Escherichia coli genome, as follows: Using *Escherichia coli* C321.ΔA as the background strain, supercompetent cells containing pCas were prepared for electroporation. 10 mM arabinose was added to the culture medium to induce λ-Red recombinase expression. For electroporation, 100 μL of cells were mixed with 100 ng of pTargetT series DNA and electroporated using a 2.5 kV Gene Pulser II electroporator (BIO-RAD). The electroporation products were immediately resuspended in 1 mL of ice-cold LB medium (when donor DNA was provided as a PCR fragment, 100 ng of pTargetF series DNA and 400 ng of donor DNA were co-electroplated), and cells were recovered at 30°C for at least 1 hour. Cells were then plated on LB agar containing kanamycin (50 mg / mL) and spectinomycin (50 mg / mL) and incubated overnight at 30°C. Positive transformants were identified by colony PCR and DNA sequencing.
[0057] The edited E. coli genome contains the essential genes for mutation and is transformed with the ncAA orthogonal system.
[0058] (2) Escape rate test The escape rate test reference (Mandell, DJ, et al., Biocontainment of genetically modified organisms by synthetic protein design. Nature, 2015. 518(7537): p.55-60), the specific steps are as follows: All strains were grown under permissive conditions (exogenous Cl2Y supply on LB medium) and harvested in the late exponential phase; then washed twice and resuspended in LB; the CFU of viable colonies were calculated based on the average and standard error (SEM) of three technique replicates at 10-fold serial dilutions on permissive medium; the three techniques were replicated and plated on medium without Cl2Y supply, and the number of escaped colonies was counted after 7 days; the escape rate (f) was calculated as: number of escaped colonies / total number of viable colonies.
[0059] Depend on Figure 4 Data b shows that the TAG codon was inserted into the edited essential genes. This codon can be correctly translated in a culture medium containing specific non-natural amino acids (such as Cl2Y), thus maintaining bacterial growth. However, in a culture medium lacking non-natural amino acids, the bacteria cannot grow because the TAG codon cannot be translated normally, thus achieving highly efficient control over bacterial growth. For the three essential genes mentioned above, single-gene modification can achieve an escape rate significantly lower than other control systems (<10). -6 ).
[0060] 4. Design of finite reproduction systems based on essential gene expression systems See appendix Figures 5-8 The following is a schematic diagram of the design of elements for finite-reproductive organisms based on essential gene expression systems: (1) Dependent reproduction design Two induction systems were used to modulate the expression of the ncAA module and the rescue module. Specifically: The rescue module is a storage protein RFP expression cassette. Eight tags are inserted after the RFP start codon ATG for specific recognition or binding processes. RFP serves as a reserve protein, storing non-natural amino acids and releasing the non-natural amino acid Cl2Y when exogenous supply is interrupted. The RFP expression cassette contains P... tac Promoter.
[0061] Non-natural amino acid module: composed of the non-natural amino acid aminoacyl-tRNA synthetase MjTyrRS expression cassette and the non-natural amino acid-specific tRNA MjtRNA. Tyr CUA Composition. The MjTyrRS expression cassette contains P tet Promoter (aTc induced); tRNA MjtRNA Tyr CUA The expression box contains a constitutive promoter.
[0062] Suicide module: a mutant SerS expression cassette. Within the SerS expression cassette... serS The coding sequence of SerS.F213 has two tags added at position F213. Its translation product is SerS.F213, meaning two Cl2Y tags are inserted at position F213. Translation is interrupted at F213 when non-natural amino acids are depleted in the culture medium, leading to bacterial growth arrest or death. The coding sequence of SerS.F213 is as follows: Figure 8 As shown in a. The mutation is located in the genome.
[0063] This design achieves the storage, release, and translation regulation of non-natural amino acids required in a finite reproduction design: Without the ncAA rescue module, bacteria suffer from the termination of essential gene expression due to the interruption of exogenous ncAA supply, leading to growth arrest and death; with the ncAA rescue module present, essential genes are expressed normally and bacteria grow normally when there is a sufficient supply of exogenous ncAA. When the exogenous ncAA supply is interrupted, the storage protein expressed by the rescue module continuously degrades and releases ncAA, which can continue to supply the expression of essential genes, allowing bacteria to grow normally. As the storage protein releases and consumes ncAA, it becomes unable to maintain essential gene expression, bacterial reproduction ceases, and finite reproduction is achieved.
[0064] (2) Determined reproductive capacity test Limited reproductive capacity testing; see attached document for testing procedure. Figure 6 As shown, bacteria with the essential gene-editing group were cultured overnight at 37°C for 16 h in LB medium containing 1 mM Cl2Y and a suitable selectively labeled antibiotic. Then, 1 mM IPTG and 100 ng / mL tetracycline were added to induce the expression of storage proteins and Cl2Y aaRS. The bacteria were then transferred to LB medium containing 100 ng / mL tetracycline without non-natural amino acids and cultured further to induce the expression of the non-natural amino acid system for essential gene expression.
[0065] To obtain bacteria in the logarithmic growth phase, the culture medium was exchanged with fresh LB medium containing Cl2Y, and the bacteria were cultured for another 1.5 h. The bacteria were then washed twice with fresh LB medium, and the washed bacterial suspension was diluted 10⁵ times in 15 mL of LB solid medium free of non-natural amino acids. The diluted bacterial suspension was incubated overnight on solid medium, and the bacterial growth was observed and photographed using an optical microscope (Nikon inverted research microscope ECLIPSE Ti₂-E / Ti₂-E / B). Figure 7 b) ImageJ software was used to process the images to detect the quantity and distribution of bacterial species, compare the differences in bacterial reproductive capacity under different conditions, and based on the experimental results, [the results were then appended to the image]. Figure 7 and attached Figure 8 To assess the limited reproductive capacity of bacteria that require gene editing.
[0066] (3) Detection of limited reproductive capacity based on essential gene systems From the appendix Figure 7 and attached Figure 8 Statistical results from limited reproductive generations show that, through continuous observation and statistical analysis, essential genes based on non-natural amino acid dependence have been identified. dnaA, murG and serSThe defective finite life form, after the supply of exogenous Cl2Y was removed, successfully achieved different levels of finite reproduction under the rescue module, with the release of stored non-natural amino acids to supply the expression of essential genes, thus initially verifying the concept of finite reproductive life forms.
[0067] Through continuous observation and statistical analysis, it was found that all three different systems exhibited limited reproductive capabilities. The limited reproductive capacity varied among different genes, which is related to the biological function and expression level of the genes. Among them, the SerS.F213 system had the strongest reproductive capacity, achieving 3-4 generations (8-16 bacteria); while the MurG.F243 and DnaA.W6 systems had lower limited reproductive capabilities, achieving only 1-2 generations.
[0068] Example 3 Toxin-Antidote System In this embodiment, the suicide module and the rescue module are respectively a toxin gene expression cassette and an antitoxin gene expression cassette. By inserting a TAG into the antitoxin gene, the expression of the antitoxin becomes dependent on non-natural amino acids. In the early stages, the expression of the antitoxin is induced, enabling it to antagonize the toxin, allowing for normal bacterial reproduction and growth, and accumulating a certain amount of antitoxin protein within the bacteria. Then, once the exogenous supply of non-natural amino acids is cut off, the expression of the antitoxin protein storing non-natural amino acids ceases, and the previously accumulated antitoxin antagonizes the toxin, maintaining bacterial reproduction. However, the antitoxin is gradually consumed during bacterial division; when the antitoxin is insufficient to neutralize the toxicity of the toxin protein, bacterial reproduction stops.
[0069] To achieve the goal of limited reproduction, the following screening criteria were developed based on different toxin-antitoxin systems, combined with non-natural amino acid systems and toxin-antitoxin systems, through literature review.
[0070] 1. Screening criteria (1) Derived from type II toxin-antitoxin system: The reasons are as follows: 1. The type II family was first discovered in P1 bacteriophage and later detected in the genome sequence of Escherichia coli. It is also the most widely studied type at present, with a large number of mature TA (toxin-antitoxin) combinations to choose from (the toxin-antitoxin database TADB 2.0 includes 10). 5 For type II TA gene pairs supported by experimental data, an online prediction tool, TA finder, is also provided (Xie et al., 2018). Both type II TA toxins and antitoxins are proteins, and the toxins can directly form complexes with the antitoxins to control programmed cell death in bacteria. Compared to stable toxins, antitoxins contain less ordered structures, are more sensitive to proteolytic enzymes, and are more easily degraded (Pasotti et al., 2011).
[0071] (2) The combination is unique, that is, the two genes are co-transcribed and co-translated, the toxin and antitoxin are combined, the toxin cannot act, and the cell grows normally; under stress conditions, after the antitoxin is degraded by the protease, the toxic protein is released and the toxic effect is initiated (Schuster and Bertram, 2013).
[0072] (3) Biological functions are highly conserved and can be extended to different chassis organisms, such as the development of attenuated live vaccines against different pathogens or even viruses, and the selection of toxin-antitoxin pairs that have similar functions in different organisms.
[0073] Based on the above three criteria, five toxin-antitoxin combinations were initially selected for further screening tests. Alternatively, new toxin-antitoxin pairs can be selected for further design based on the aforementioned three screening principles.
[0074] 2. Screening and identification of TA systems for efficiently halting and rescuing bacterial growth See attached document Figure 9 The experimental procedure was followed to screen for toxin-antitoxin pairs that could efficiently halt bacterial growth after inducing toxin expression and efficiently restore bacterial growth after expressing the corresponding antitoxin. These pairs were then used in the design of determinate reproduction systems. The specific steps are as follows: (1) Construct expression plasmids for toxins and antitoxins; (2) Induce toxin expression and observe bacterial growth arrest.
[0075] (3) Induce antitoxin expression and observe the recovery of bacterial growth.
[0076] (4) Based on the experimental results, select the toxin-antitoxin pairs that meet the requirements.
[0077] Finally after the attached Figure 9 The filtering process shown successfully selected products that meet the design requirements. doc-phd and parE- parD The gene sequence for (highly effective growth arrest due to toxins, and growth recovery due to antitoxins) is as follows: Table 1: Toxin-Antidote Sequences and Functions
[0078] For the other three toxin proteins, Kid, Zeta, and CcdB, their ability to inhibit bacterial growth is limited. In fact, a more suitable toxin-antitoxin balance can be achieved by regulating toxin expression levels through methods such as changing promoters and enhancing induction.
[0079] 3. Design of a finite reproduction system based on a toxin-antitoxin system (1) Dependent reproduction design See appendix Figure 10 A schematic diagram of a finite life form component design based on a toxin-antitoxin system.
[0080] System composition: It consists of two plasmids, namely a suicide module and a non-natural amino acid orthogonal translation module carried by the p15A replicon backbone; and a storage module carried by the CoE1 replicon backbone.
[0081] Working principle: When Cl2Y small molecules are added exogenously and the expression of the orthogonal translation module and rescue module of non-natural amino acids are induced, the bacteria grow normally; after Cl2Y is removed, toxin expression is induced, resulting in limited bacterial reproduction.
[0082] (2) Determined reproductive capacity test The detection procedure was consistent with the essential gene system procedure in Example 2. Bacteria in the toxin-antitoxin group were cultured for 16 hours in LB medium containing 1 mM Cl2Y and a suitable selectively labeled antibiotic. Simultaneously, 1 mM IPTG and 100 ng / ml ahydrotetracycline were added to induce antitoxin and Cl2Y aaR expression. The overnight cultured strains were then transferred to a medium without Cl2Y and supplemented with 10 mM arabinose to induce toxin expression. After overnight culture, the bacteria were observed and photographed under an optical microscope (Nikon inverted research microscope ECLIPSE Ti2-E / Ti2-E / B). ImageJ was used to detect the number and distribution of bacterial species. Specific results are shown in the appendix. Figure 11 As shown.
[0083] From the appendix Figure 11 It can be seen that when the supply of exogenous Cl2Y is removed, the expression of the toxin doc is induced, and 1-2 generations of limited reproduction are successfully achieved. doc-phd-1 The reproductive capacity of the strains was assessed within 12 hours. The results showed that most bacteria in the system had a consistent limitation on their reproductive potential. Most bacteria stopped reproducing after 2 generations, and only about 20% of the strains achieved limited reproduction for 3 generations or more, which preliminarily verified the concept of finite life forms.
[0084] Example 4 Modular design allows for regulation of antitoxin storage and limited reproduction. In previous work, the inventors successfully constructed limited-generation bacteria. Based on these designs, transgenic organisms can be used for the rapid production of safe and highly immunogenic live bacterial vaccine candidates. By adjusting the expression levels of toxins and antitoxins, limited reproduction capacity can be programmably designed to broaden the regulatory space for the number of generations of limited-generation bacteria, enhance the immunogenicity of live bacterial vaccine strains, and provide design space for the development of attenuated live vaccines against different pathogens.
[0085] (a) RBS calculator design toxin and antitoxin expression levels The RBS calculator is a design method for predicting and controlling bacterial translation initiation and protein expression. This method can predict the translation initiation rate for each start codon in mRNA transcripts and optimize synthesized RBS sequences to achieve a target translation initiation rate. Using the RBS calculator, by inputting the target gene, promoter and other relevant element sequences, and the target RBS strength, the calculator system can output multiple target-level RBS sequences, allowing the translation rate of a protein-coding sequence to be reasonably controlled within a range of over 100,000-fold.
[0086] (II) Construction of plasmids with RBS replacement and non-natural amino acid codon number alteration (1) Construction of RBS plasmid replacement Template preparation: Select original plasmids containing toxin and antitoxin genes as templates.
[0087] Loop PCR: Loop PCR is performed using specific primers to introduce new RBS sequences.
[0088] Ligation and cloning: T4 ligase was used to ligate PCR products with vectors to construct new plasmids.
[0089] Validation and Sequencing: The successful construction of the plasmid was verified by methods such as enzyme digestion and PCR, and the sequence was confirmed to be correct by sequencing. The RBS sequence used is as follows.
[0090] Table 2: RBS sequences used in this invention
[0091] (2) Cl2Y codon number adjustment Primer design: Based on the number of target TAG codons, design specific primers for PCR amplification, with the TAG codons inserted after the start codon ATG.
[0092] PCR amplification: Using the original plasmid as a template, PCR amplification is performed using specific primers.
[0093] Ligation and cloning: Ligating PCR products with vectors to construct new plasmids.
[0094] Verification and sequencing: The successful construction of the plasmid was verified by methods such as enzyme digestion and PCR, and the sequence was confirmed to be correct by sequencing.
[0095] Studies have found that increasing antitoxin expression levels leads to leaky antitoxin expression and uncontrolled proliferation in some groups. To reduce this leakage, the number of TAG codons needs to be increased to control antitoxin protein translation. These plasmids were constructed using circular PCR followed by T4 ligase ligation for cloning.
[0096] (3) Determined reproductive capacity test Bacterial culture and induced expression: The constructed plasmid was transferred into host Escherichia coli, cultured, and the expression of toxins and antitoxins was induced.
[0097] Observation and recording: Observe the growth of bacteria under a microscope and record the number of generations.
[0098] Quantitative analysis: ImageJ and other software were used to perform quantitative analysis of bacterial count and distribution.
[0099] Statistical analysis: Multiple parallel experiments were conducted, and the significance of differences between groups was assessed using the Student's t-test.
[0100] Referring to Example 2, the method for detecting the limited reproductive capacity of the toxin-antitoxin system was used to observe and quantitatively analyze bacterial reproduction, and to assess the changes in limited reproductive capacity after adjusting the expression level of toxin or antitoxin.
[0101] (III) Experimental Results and Analysis RBS calculator design results: Multiple target-level RBS sequences were successfully obtained, providing a foundation for subsequent plasmid construction.
[0102] Plasmid construction results: The plasmid with RBS replacement and Cl2Y codon number regulation was successfully constructed by the circular PCR + T4 ligase ligation method, and the sequence correctness was confirmed by verification and sequencing.
[0103] Results of the limited reproductive capacity test are attached. Figure 12 Significant changes in the expression levels of toxins and antitoxins were observed under different RBS intensities. Adjusting the number of TAG codons effectively reduced the leakage expression of antitoxins and prevented unlimited proliferation. Quantitative analysis revealed that the reproductive capacity changed significantly after adjusting the expression level of toxins or antitoxins. Statistical analysis showed that the differences between different experimental groups were statistically significant (P<0.05 or lower).
[0104] In relation to the above doc-phd In similar designs, ParD's antagonism against ParE is too strong; however, when using RBScalculator to reduce the antitoxin... parD When the RBS strength of the gene decreased from 66 to 1.01, the leakage expression of the antitoxin was suppressed. Figure 12(b) After 12 hours of continuous observation, it was found that the optimized strain could achieve approximately 4 generations of limited reproduction, meaning that one bacterium could divide into 8-16 bacteria and then stop dividing. The distribution of the reproductive capacity of this strain over 12 hours was then evaluated. The results showed that most bacteria in the system had a consistent limitation on their reproductive potential, with most bacteria ceasing to reproduce within 3-4 generations. A small percentage (less than 20%) could reproduce for 4 generations or more. No unlimited reproduction of bacteria escaping growth was observed under a microscope.
[0105] For those who have already achieved limited reproduction doc-phd System, see appendix Figure 12 As shown, when using RBScalculator to administer antitoxin phd Increasing the strength of the ribosome binding site (RBS) from 1450 to 4165, while simultaneously increasing the number of TAGs within the antitoxin gene from 2 to 3, resulted in an increase in the number of generations the bacteria could reproduce before ceasing growth, from 2 to 5 generations. This indicates that RBS strength has a direct impact on the control of bacterial reproductive capacity in a delimited reproduction system. An assessment of the reproductive capacity of this doc-phd-2 strain over 12 hours revealed that most bacteria in the system exhibited a consistent limitation on their reproductive potential, with most ceasing reproduction after 3 to 5 generations, and a small percentage (over 30%) reproducing for 5 generations or more.
[0106] This embodiment successfully achieved precise control of antitoxin storage by adjusting the expression levels of toxins and antitoxins through modular design. This achievement provides a new approach to expanding the regulatory space for the reproductive capacity of finite-reproducing organisms and also provides a new design strategy for the development of live attenuated vaccines for different pathogens.
[0107] The above content is only for illustrating the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications made to the technical solution based on the technical concept proposed in this invention shall fall within the scope of protection of the claims of this invention.
Claims
1. A bacterium with limited reproductive capacity, characterized in that, The bacterial DNA contains a non-natural amino acid orthogonal translation module, a suicide module, and a rescue module; The non-natural amino acid orthogonal translation module includes a non-natural amino acid aminoacyl-tRNA synthetase expression cassette and a non-natural amino acid-specific tRNA expression cassette. The suicide module and the rescue module are respectively a bacterial essential gene expression cassette and a reserve gene expression cassette; or the suicide module and the rescue module are respectively a toxin gene expression cassette and an antitoxin gene expression cassette. The rescue module contains a codon recognized by the non-natural amino acid-specific tRNA.
2. The bacteria according to claim 1, characterized in that, Non-natural amino acids are selected from pAzF or Cl2Y; Wherein, when the non-natural amino acid is pAzF, the non-natural amino acid aminoacyl-tRNA synthetase is MjpAzFRS, and the non-natural amino acid-specific tRNA is MjtRNA. Phe CUA ; Wherein, when the non-natural amino acid is Cl2Y, the non-natural amino acid aminoacyl-tRNA synthetase is MjTyrRS, and the non-natural amino acid-specific tRNA is MjtRNA. Tyr CUA ; Preferably, the codon recognized by the non-natural amino acid-specific tRNA is UAG; Preferably, the bacteria are selected from Escherichia coli, Pseudomonas aeruginosa, Pasteurella multocida, and Brucella.
3. The bacteria according to claim 1, characterized in that, The suicide module and the rescue module are respectively a bacterial essential gene expression cassette and a reserve gene expression cassette, wherein each of the bacterial essential gene expression cassette and the reserve gene expression cassette independently contains one or more codons recognized by the non-natural amino acid-specific tRNA; wherein the reserve gene is a bacterial non-essential gene or an exogenous non-toxic gene. Preferably, the essential bacterial gene is selected from... dnaA , murG , serS , holB, lolC, ssb, alaS, metG as well as tyrS .
4. The bacteria according to claim 1, characterized in that, The suicide module and the rescue module are respectively a toxin gene expression cassette and an antitoxin gene expression cassette, wherein the antitoxin gene expression cassette contains one or more codons recognized by the non-natural amino acid-specific tRNA; Preferably, the toxin gene-antitoxin gene is selected from... parE-parD or doc-phd .
5. A method for controlling bacterial reproduction, characterized in that, The non-natural amino acid orthogonal translation module, the suicide module, and the rescue module were introduced into the bacteria. The non-natural amino acid orthogonal translation module includes a non-natural amino acid aminoacyl-tRNA synthetase expression cassette and a non-natural amino acid-specific tRNA expression cassette. The suicide module and the rescue module are respectively a bacterial essential gene expression cassette and a reserve gene expression cassette; or the suicide module and the rescue module are respectively a toxin gene expression cassette and an antitoxin gene expression cassette. The rescue module contains a codon recognized by the non-natural amino acid-specific tRNA.
6. The method according to claim 5, characterized in that, The non-natural amino acids are selected from pAzF or Cl2Y; Wherein, when the non-natural amino acid is pAzF, the non-natural amino acid aminoacyl-tRNA synthetase is MjpAzFRS, and the non-natural amino acid-specific tRNA is MjtRNA. Phe CUA ; Wherein, when the non-natural amino acid is Cl2Y, the non-natural amino acid aminoacyl-tRNA synthetase is MjTyrRS, and the non-natural amino acid-specific tRNA is MjtRNA. Tyr CUA ; Preferably, the codon recognized by the non-natural amino acid-specific tRNA is UAG.
7. The method according to claim 5, characterized in that, The suicide module and the rescue module are respectively a bacterial essential gene expression cassette and a reserve gene expression cassette, wherein each of the bacterial essential gene expression cassette and the reserve gene expression cassette independently contains one or more codons recognized by the non-natural amino acid-specific tRNA; wherein the reserve gene is a bacterial non-essential gene or an exogenous non-toxic gene. Preferably, the essential bacterial gene is selected from... dnaA , murG , serS , holB, lolC, ssb, alaS, metG as well as tyrS .
8. The method according to claim 5, characterized in that, The suicide module and the rescue module are respectively a toxin gene expression cassette and an antitoxin gene expression cassette, wherein the antitoxin gene expression cassette contains one or more codons recognized by the non-natural amino acid-specific tRNA; Preferably, the toxin gene-antitoxin gene is selected from... parE-parD or doc-phd .
9. The method according to claim 5, characterized in that, The bacteria are selected from Escherichia coli, Pseudomonas aeruginosa, Pasteurella multocida, or Brucella.
10. Use of the bacteria of any one of claims 1-4 or the method of any one of claims 5-9 in the preparation of a live attenuated vaccine.
Citation Information
Patent Citations
Artificial design and application of intercellular communication system
CN113957088A
Autoamtic spraying-sucking beverage bottle cap with straw tube
CN2461872Y