Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

2740 results about "Kiwi fruit" patented technology

Intelligence-reinforcing health-care dried bean curd and preparation method thereof

InactiveCN103202343AHas the function of intelligence and health careStrong fragranceCheese manufactureFood scienceBiotechnologyVitis vinifera
The invention provides intelligence-reinforcing health-care dried bean curd. The intelligence-reinforcing health-care dried bean curd is processed from raw materials of, by weight, 100 parts of black soybeans, 4-6 parts of Chinese hawthorn seeds, 1-3 parts of black sesame, 1-3 parts of walnut, 3-5 parts of loofah, 3-5 parts of kiwi fruit, 4-6 parts of longan pulp, 5-7 parts of grapes, 3-5 parts of ginseng, 4-6 parts of poria, 2-3 parts of dens draconis, 1-2 parts of polygala root, 1-2 parts of acanthopanax and 1-2 parts of sunflower discs. The intelligence-reinforcing health-care dried bean curd is prepared by boiling the intelligence-reinforcing raw materials to soup, soaking the raw beans, using mixed liquor of the nourishing soup and water as soybean milk grinding water for soybean milk grinding, filtering, boiling soybean milk, adding intelligence-reinforcing flavoring materials, pointing halide, pressing, marinating, packaging and sterilizing. The dried bean curd has nutrient of conventional dried bean curd, as well as has functions of intelligence reinforcing and health care, and is aromatic in taste.
Owner:JINCAIDI FOOD CO LTD

Picking robot and picking method for kiwi fruits

The invention discloses a picking robot and a picking method for kiwi fruits. The picking robot for the kiwi fruits comprises a machinery execution system and a control system, and is characterized in that the machinery execution system comprises a car body, a telescopic slide platform, a five freedom degree picking robot arm and a two finger type end actuator, and the control system comprises an industrial personal computer, a motion control card, a data acquisition card, an image acquisition card, a servo motor driver, a binocular video camera, an infrared sensor, a pressure sensor, an electric control cabinet and a control circuit. The picking robot and the picking method for the kiwi fruits use a building block design philosophy to integrate the two finger type end actuator, the five freedom degree picking robot arm, the telescopic slide platform and a sensor system together and integrate image acquisition and feature extraction of fruits and barriers, intelligent mobility of the telescopic slide platform, counterguard and fruit positioning of the five freedom degree picking robot arm and grab motions of the two finger type end actuator together, and therefore achieve mechanization and automation of picking of the kiwi fruits, improve labor productivity, reduce production cost, and guarantee harvest quality of the kiwi fruits.
Owner:NORTHWEST A & F UNIV

Method for preparing preserved kiwi fruit by vacuum freeze drying

A method for preparing preserved kiwi fruit by vacuum freeze drying. The method comprises steps of: peeling and slicing kiwi fruit, immersing the kiwi fruit in color protecting liquid, and then placing the kiwi fruit in a hardening liquid for hardening; after hardening, conducting an ultrasonic pretreatment in liquid glucose; and then successively carrying out vacuum sugar permeability, prefreezing, vacuum freeze drying, and packing to obtain the preserved kiwi fruit. According to the present invention, glucose lactone is added into a calcium chloride hardening liquid to coagulate protein in the fruit pieces and significantly improve hardening effect. The ultrasonic pretreatment and vacuum sugar permeability avoid a heat treatment process of rapid heating for a long time or short time, so that the kiwi fruit slices are still bright green (quite similar with an original fruit color). Vacuum freeze drying on the kiwi fruit realizes a high nutrient conservation rate.
Owner:NORTHWEST UNIV(CN)

Compiling vector of kiwi fruit gene AcPDS based on CRISPR-Cas9 as well as construction method and application thereof

ActiveCN107446924AEfficient site-directed mutagenesisBacteriaHydrolasesAgricultural scienceActinidia
The invention discloses a compiling vector of a kiwi fruit gene AcPDS based on CRISPR-Cas9 as well as a construction method and application thereof. The compiling vector of the kiwi fruit gene AcPDS based on CRISPR-Cas9 established can quickly and simply perform efficient site-specific mutagenesis on the kiwi fruit gene, so that the blank of a gene fixed point compiling technology in kiwi fruit is filled. Experimental results verify that by means of agrobacterium-mediated kiwi fruit genetic transformation, the compiling vector of the kiwi fruit gene AcPDS based on CRISPR-Cas9 performs site-specific mutagenesis on two target spots of the kiwi fruit gene AcPDS successfully, and meanwhile, an albefactedphenotype is induced.
Owner:SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI

Fermented fruit and vegetable composition containing probiotics and traditional Chinese medicine extract and preparation method of fermented fruit and vegetable composition

The invention discloses fermented fruit and vegetable composition containing probiotics and traditional Chinese medicine extract and a preparation method of the fermented fruit and vegetable composition. The fermented fruit and vegetable composition comprises fermented fruit and vegetable, fermented or non-fermented traditional Chinese medicine or the traditional Chinese medicine extract, the prebiotics, probiotics and an auxiliary, wherein the prebiotics are formed by one or more oligosaccharides and the probiotics comprise one or more of lactobacillus, bifidobacterium and streptococcus; the fruit and vegetable comprise one or combination of pumpkins, white gourds, kiwi fruits, soybeans, papayas, purple sweet potatoes, carrots, Chinese chestnuts, Chinese yam, maca fruit, pearl barley, Wolfiporia extensa, Angelica sinensis, kudzu vine roots and lotus seeds; the traditional Chinese medicine or the traditional Chinese medicine extract is one or more of Astragalus, olive leaves, grape seeds, ginger, gardenias, saw palmetto, pumpkin seeds, pomegranate seeds, pomegranate bark, raspberries, Cistanche deserticola, black cohosh, red clover or extract thereof. The fermented fruit and vegetable composition is food, a medicine or a health care product with the efficacy of regulating intestinal flora, boosting immunity, improving sleeping function and the like.
Owner:WINERGEN TECH WEIFANG

Method for planting kiwi fruits

InactiveCN103518579AThe growth cycle is pollution-freeImprove qualityCultivating equipmentsFertilizer mixturesActinidiaPollination
The invention discloses a method for planting kiwi fruits. The method includes the following steps of (1) arranging filed ridges, (2) planting the kiwi fruits and building a frame, (3) shaping the kiwi fruits, (4) clipping the kiwi fruits, (5) carrying out pollination, flower thinning and fruit thinning on kiwi fruit plants, and (6) carrying out watering, pesticide spraying and fertilizing on the kiwi fruits. By means of the method, the kiwi fruit planting method is wide in application range and harmless in growth period, reduces production cost and improves quality of the kiwi fruits.
Owner:东阳市松菊家庭农场有限公司

Nondestructive detection method of swelled kiwi fruits based on hyperspectral imaging technology

The invention discloses a nondestructive detection method of swelled kiwi fruits (kiwi fruits obtained by applying a swelling agent) based on a hyperspectral imaging technology. The method comprises the following steps: scanning a batch of intact swelled kiwi fruit samples and non-swelled kiwi fruit samples with a hyperspectral imaging system as a tool to obtain hyperspectral image information of the samples; carrying out black and white correction and masking treatment of hyperspectral images, and extracting the average spectrum of a whole fruit area; preprocessing the average spectrum; dividing to form a correction set and a prediction set; reducing dimensions of spectral data to extract characteristic wavelengths or characteristic variables reflecting the swelled kiwi fruits; and establishing a linear or non-linear model for the nondestructive identification of the swelled kiwi fruits, and examining the model. The correct recognition rate of the method to the swelled kiwi fruits is greater than 99%. The method used for detecting whether the swelling agent is applied to the kiwi fruits or not based on the hyperspectral imaging technology has the advantages of nondestructive property, high efficiency, high accuracy and reliable result.
Owner:NORTHWEST A & F UNIV

Method for planting kiwi fruits

The invention discloses a scientific and reasonable method for planting kiwi fruits. The method comprises the steps of field selection and soil preparation, seedling selection, field planting, fertilizer applying, trimming, support erecting, plant disease and insect pest prevention and treatment, picking and the like, wherein the field selection and soil preparation comprise the field selection and the soil preparation, the field selection means the selection of subacidity soil where the transportation is convenient, the underground water level is below 1 meter, the irrigation and drainage conditions are good, and the PH value is 5.5-6.5, and the area where the organic matter is rich, the soil is fertile and loose, and the depth of a soil layer reaches more than 100cm. The soil preparation means that soil deep tillage is carried out, the depth of the soil is not less than 80cm, the soil deep tillage is carried out, meanwhile, the base fertilizer is applied, the bio-organic fertilizer applied in each mu is not less than 800kg, meanwhile, in the soil preparation, hole digging (including furrows) is carried out according to the 4m width, and the depth of the furrow is not less than 80cm. The method is adopted to conduct the field selection and the soil preparation, the kiwi fruits are not limited by the planting area, and the transportation cost is reduced. Meanwhile, the yield of the kiwi fruits can be greatly improved by the adoption of the planting method.
Owner:CHONGQING SHANGAN AGRI DEV

Kiwi fruit picking end actuator

The invention discloses a kiwi fruit picking end actuator which comprises a clamping mechanism, a rotary picking mechanism, an approaching mechanism, a sensing system and a control system. The clamping mechanism comprises a scissor structure formed by front arc-face finger a rear arc-face finger and is capable of separating and reliable gripping of adjacent fruits. The rotary picking mechanism uses a reduction stepping motor to drive the clamping mechanism to rotate so as to separate stems and fruits. The approaching mechanism drives the front finger to approach the fruits. The sensing system comprises a pressure sensor, an infrared photoelectric switch, a Hall position sensor and a limit switch which are respectively used for detecting a clamping force threshold, fruit positions and mechanism reset information and controlling rotation angle of the reduction stepping motor, wherein the pressure sensor and the infrared photoelectric switch are mounted on the inner side of the front finger, the Hall position sensor and the limit switch are mounted on a frame. The control system comprises a single-chip microcomputer and a stepping motor controller and is used for controlling the whole system by the aid of the sensing system. By the actuator simple in mechanical structure, accurate positioning, separating and reliable gripping of the fruits are achieved, and lossless picking of the fruits is realized.
Owner:NORTHWEST A & F UNIV

Controlled-release and slow-release compound fertilizer specialized for kiwi fruit

InactiveCN103058771AConform to demand structureReduce dosageFertilizer mixturesActinidiaCobalt
The invention provides a controlled-release and slow-release compound fertilizer specialized for kiwi fruit, and belongs to the technical field of fertilizers. The compound fertilizer comprises 8-9 parts of urea, 16-18 parts of calcium magnesium phosphate fertilizer, 1 part of potassium sulfate, 3.5-4.5 parts of potassium chloride, 60-70 parts of fermented chicken manure fertilizer, 7-9 parts of charcoal powder, 1.8-2.2 parts of calcium superphosphate, 0.8-1.2 parts of bentonite, 1 part of a solid inoculant, and 0.1 part of boric acid. The compound fertilizer provided by the invention has the beneficial effects that urea, the calcium magnesium phosphate fertilizer, potassium sulfate and potassium chloride are prepared according to the proportions, the demand of the kiwi fruit plants on nitrogen, phosphorous and potassium is satisfied, and needed secondary elements such as calcium, magnesium, chlorine, sulfur and boron are guaranteed at the same time; besides, large amounts of organic substances are supplied to the kiwi fruit by large amounts of the fermented chicken manure fertilizer; and moreover, needed trace elements such as ferric, copper, sodium, zinc, cobalt and the like are contained in the compound fertilizer, so the elements necessary for the kiwi fruit are basically completed.
Owner:重庆润绿生物有机肥有限公司

Fruit enzyme and preparation method thereof

InactiveCN104012896AEliminate intestinal toxinsFood preparationKiwi fruitDigestion
The invention relates to fruit enzyme and a preparation method thereof. The fruit enzyme can be prepared by only washing grape, apples, guava, green papaya, hylocereus polyrhizus, green avocado, kiwi fruit, beetroot, pineapple and tomato, adding auxiliary materials, and putting into a glass vat for fermentation for 21-25 days. The enzyme disclosed by the invention is free of any additive, is good in taste, is capable of replenishing enzymes necessary for daily life of human bodies, has the functions of aid digestion and intestinal canal clearing, and can be drunk as a healthcare product for a long time.
Owner:ANHUI WEIXIAN FOOD

Uncooked food fruit and vegetable powder especially suitable for women and making method of uncooked food fruit and vegetable powder

The invention discloses a formula of novel uncooked food fruit and vegetable powder, which is made from natural grains, fruits, vegetables and partial medicine and food homologous medicinal materials in proportion. The natural grains in the formula mainly are brown rice, black soya bean, barley, buckwheat, crude sticky rice and wheat (wheat kernel); the fruits and the vegetables include mandarin orange, apple, green papaya, banana, kiwi fruit, lotus root, carrot, wild celery herb, sweet potato, pumpkin and kelp; and the medicine and food homologous medicinal materials comprise kudzu vine root powder, fructo-oligose, folium mori, pearl barley and mixed lactic acid bacteria powder. The making method of the novel uncooked food fruit and vegetable powder mainly comprises the following steps of: pretreating the fruits and the vegetables, pulping for later use, drying the grains and the medicinal materials, ultramicro-grinding for later use, mixing, freezing and drying, sub-packaging at a low temperature, and vacuum-bagging. The novel uncooked food fruit and vegetable powder formula has the characteristics of balanced nutrition matching, convenience in taking, good mouth feel and the like so as to have wide application prospect on the aspects of medicine health care and the like, is beneficial to the absorption of a human body to nutrients, is especially suitable for women, and is a low-heat food with functions of losing weight and beautifying features.
Owner:孙纪元

SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations

The invention discloses an SSR molecular marker A002 for identifying males and females of kiwi fruit hybrid populations, relating to the technical field of molecular genetic breeding. The male plant specific fragment nucleotide sequence of the molecular marker A002 is shown in SEQ.ID No.1; the female plant specific fragment nucleotide sequence is shown in SEQ.ID No.2; and the primer sequence is shown in SEQ.ID No.3 and SEQ.ID No.4. The molecular marker A002 can be used for the early identification detection of males and females of kiwi fruits so as to avoid the great waste caused by abundant male plants in the breeding and production; by utilizing a high-density genetic map, sex related molecular markers can be rapidly explored to assist the breeding and important practical experience is provided for the development of the functional markers; and being used for marker assisted selection of males and females, the molecular marker A002 is capable of greatly improving the selection efficiency of the female plants in the breeding and shortening the breeding period, and has great application potential and relatively high economic value.
Owner:WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI

Field management method of high-end kiwi fruit during fruiting period

A field management method of high-end kiwi fruit during a fruiting period relates to a cultivation management method which is applied after a kiwi fruit plant can fruit. By systematic treatment of the method comprising application of fertilizer prior to flowering, bud picking, pollination, fruit thinning, application of fruit expanding fertilizer, application of leaf surface fertilizer, pest control, bagging, core picking, drought resistance, drainage of stagnant water, base fertilizer application, winter pruning, winter orchard-clearing disinfection and the like, the kiwi fruit can fully and efficiently utilize light, temperature, water, air and fertilizer, the relations of branch and leaf growth and fruiting are adjusted in real time, distribution of plant nutrient is adjusted, the fruiting capability of the kiwi fruit can be brought into play as far as possible, single-fruit grain weight and the number of contained seeds are increased, pest and disease damage can be eliminated simultaneously, and the disease-resistant capability of plants is enhanced. Besides, the trophic structure of the soil can be adjusted, soil fertility is not reduced all the year round, high quality, high yield and stable yield of the kiwi fruit are achieved, and the age limit of fruiting is prolonged.
Owner:重庆信祥生态农业有限公司

Tobacco component additive agent for compensating aroma to low tar cigarette

The invention discloses a tobacco component additive to compensate the perfume of low-tar cigarette, which comprises the following parts: 0. 1-2kg tobacco extract, 0-10g furfural, 1-5g 5-methyl-furfural, 1-10g 3-ethyl-2-hydroxy-cyclopentene-1-ketone, 1-10g hexadecyl methyl ester, 1-10g solanestone, 0-10g kiwi fruit lactone dihydroxide, 1-10g calicotone, 1-20g hugebean alkatrientone, 0-10g pyridine, 0-10g 2-methyl-pyridine, 0-100g acetic acid, 0-10g propionic acid, 0-10g benzene carbonic acid, 0-100g benzene carbonic acid, wherein the weight of the raw materials is 1-4 times as diluent. The invention uses tobacco extract and tobacco perfume material as raw material to improve the perfume content of low-tar cigarette, which has good harmonization with tobacco under convenient preparing method and wide resource of raw material.
Owner:ZHENGZHOU TOBACCO RES INST OF CNTC

Green high-yield kiwi fruit planting method

The invention discloses a green high-yield kiwi fruit planting method. The green high-yield kiwi fruit planting method comprises the steps of seedling raising and grafting, cultivation management, soil management, water and fertilizer management and harvesting management. Therefore, by means of green and environmental planting techniques and planting materials, the green high-yield kiwi fruit planting method guarantees the flavor of kiwi fruits and meanwhile improves the eating safety of the kiwi fruit, thereby being more beneficial to people usage.
Owner:太仓市泗洲农场专业合作社

Molecular marker primers for identification of Moshan series of male cultivars of kiwi fruits and application thereof

The invention belongs to the technical field of molecular biology and genetic breeding and specifically relates to molecular marker primers for identification of a Moshan series of male cultivars of kiwi fruits and an application thereof. The molecular marker primers provided by the invention are Geo15-115-F: CGAAGAAACAGGAAAGAGAATCG and Geo15-115-R: GGCACGGTGTACACCAGGAG. The primers can accurately distinguish and identify Moshan series of male cultivars of kiwi fruits and distinguish other species, have the universality of identification and are suitable for large-scale promotion.
Owner:WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI

Preparation method of preserved low-sugar kiwi fruit

The invention relates to a preparation method of a preserved low-sugar kiwi fruit, belonging to the field of agriculture product processing. The preserved low-sugar kiwi fruit is prepared from the following components in parts by weight: 30-60 parts of kiwi fruits, 20-50 parts of white granulated sugar, 0.1-1 part of citric acid, 0.1-0.5 part of sodium ascorbate, 0.01-0.1 part of table salt and 0.01-0.05 part of calcium chloride. The preparation method comprises the steps of selecting raw materials; cleaning; peeling; slicing; soaking for protecting the color; hardening; precooking; carrying out microwave sugar infusion; carrying out constant-temperature drying; packaging and the like to obtain a finished preserved low-sugar kiwi fruit. The preserved low-sugar kiwi fruit is pale brown, attractive in appearance, moderate in sweetness and sourness and extremely good in taste.
Owner:李文斌

Methods for Using Rebaudioside C as a Flavor Enhancer

InactiveUS20120157553A1Increase sweetnessDecreasing the amount of a flavoring in a consumableMilk preparationBiocideThaumatinKiwi fruit
The present invention is directed to the use of one or more rebaudioside C polymorphs, or stereoisomers thereof, to enhance the sweet taste of a flavoring, such as glucosylated steviol glycoside, rebaudioside A, ammoniated glycyrrhizin, neohespherdin dihydrochalcone or thaumatin.
Owner:INTERNATIONAL FLAVORS & FRAGRANCES

Passion fruit-kiwi fruit composite juice and preparation method thereof

ActiveCN102613623APure flavorNatural and long-lasting fragranceFood preparationPectinaseFruit juice
The present invention relates to a passion fruit-kiwi fruit composite juice and a preparation method thereof. The juice comprises 20-30% of a fruit-kiwi fruit juice, 10-15% of a kiwi fruit juice, 3-5% of honey, and the balance of water. The preparation method comprises: cleaning and cutting the passion fruit; taking the flesh with seeds; carrying out juicing on the flesh with seeds; cleaning the kiwi fruit; removing peel and carrying out juicing on the flesh of the kiwi fruit; uniformly mixing the resulting two juices; heating to a temperature of 20-60 DEG C; adding pectinase and amylase to carry out an enzymolysis treatment; adding water and honey to the filtered juice to adjust the taste; adopting a bacteria removal filtration membrane to remove partial bacteria; carrying out homogenizing and degassing on the bacteria-removed juice; carrying out vacuum packaging; and carrying out hyperpressure sterilization to perform an enzyme inactivation treatment to obtain the composite juice. With the preparation method of the present invention, the unique flavor of the passion fruit and the kiwi fruit fragrance can be maintained, the produced juice has characteristics of original juice remaining, original taste remaining, natural and persistent fragrance, and pure flavor, the juice quality is improved, and the pursuit of the majority of consumers on the natural juice is met.
Owner:HEPING WEIKANG AGRI TECH CO LTD

Planting method for high-yield kiwi fruit

The invention discloses a planting method for high-yield kiwi fruit. The planting method includes the following steps of 1 garden plot planning, 2 field planting preparing, 3 shed frame building, 4 kiwi fruit field planting, 5 kiwi fruit pollinating, 6 kiwi fruit clipping, 7 water and fertilizer managing on the kiwi fruit and 8 kiwi fruit managing. The planting method is beneficial for increasing the planting yield of the kiwi fruit, improving the quality of the kiwi fruit and increasing economic benefits.
Owner:TAICANG AGRI TECH EXTENSION CENT

Method for improving quality of kiwi fruit and special high-quality fruit comprehensive agents

The invention provides a method for improving quality of kiwi fruit and special high-quality fruit comprehensive agents. According to the method, a high-quality fruit agent No.1 capable of increasing color, sugar, hardness and yield and preventing diseases is used after fruit picking, before and after blooming an during base fertilizer application; a high-quality fruit agent No.2 capable of thickening cell walls and increasing cell density is used in a fruit swelling period, a fruit strengthening period and a fertilizer application period, wherein weight ration of the high-quality fruit agents No.1 and No.2 to water is 1:400-600, the high-quality fruit agent No.1 can be sprayed on leaves or applied to soil once after fruit picking, before and after blooming an during base fertilizer application, the high-quality fruit agent No.2 can be applied twice, once every a half month, in the fruit swelling period, the fruit strengthening period and the fertilizer application period. Through adoption of the method and the special high-quality fruit comprehensive agents, the internal quality and external fruit shape, color, storability and freeze injury resistance of kiwi fruit can be improved, the use is convenient, the cost is reduced, kiwi fruit trees become strong and can bloom and bear fruits easily, the quality of fruits is improved greatly, the disease resistance is enhanced and yellows can be prevented and controlled.
Owner:建宁县富农果蔬专业合作社

Dealcoholic enzyme and production process thereof

The invention discloses a dealcoholic enzyme and a production process thereof. The dealcoholic enzyme is formed by mixing and fermenting raw materials of honey, flower fruits and mineral water and added saccharomycetes, acetobacter and lactobacillus, wherein the flower fruits comprise flos puerariae, kudzuvine root and hovenia acerba as well as one or several of green papaya, banana, kiwi fruit and lemon, wherein the mass ratio of the honey to the flower fruits to the mineral water is 1.4:4:10; the flower fruits comprise the following raw materials in percentage by weight: 15-20 percent of flos puerariae, 10-25 percent of kudzuvine root and 30 percent of hovenia acerba as well as one or the combination of several of the green papaya, the banana, the kiwi fruit and the lemon. The dealcoholic enzyme disclosed by the invention has good mouth feeling, abundant nutrition and health-care action, and can be used for dispeling the effects of alcohol and daily heath care and health preservation.
Owner:甘林林

Tissue-culturing rapid propagation method of Actinidia macrosperma

The invention provides a method of rapid breeding of kiwi fruit with large seed by tissue culture. The invention comprises steps of selecting and treating explant, inducing culture medium, root culturing and replanting, etc. The invention takes MS culture medium as basis and adds BA, NAA, GA, ZT and other external plant growth regulator to induce the growth of axillary bud of the said kiwi fruit and strengthen sprout and root. The root growth rate is as high as 100%, the average bud height is 6.28 cm and the average replanting survival rate is 91% after 35 days culture. The invention solves the technique problem of rapid breeding of said kiwi fruit and provides a method of short period, high breeding rate and low cost for the industrial production of kiwi fruit with large seed.
Owner:ZHEJIANG UNIV

Blending oil containing corn oil and preparation method of blending oil

The invention belongs to the technical field of edible oil, particularly relates to blending oil containing corn oil, and further relates to a preparation method of the blending oil. The blending oil comprises maize germ oil, sesame oil, walnut oil, olive oil, peony seed oil, sunflower seed oil, rapeseed oil, lard oil, apple seed oil, grape seed oil, pomegranate seed oil, camellia oil, peanut oil, wheat germ oil, kiwi fruit seed oil, linseed oil and pine nut oil. The blending oil containing the corn oil has the beneficial effects that the source of nutrients is wide and the safety is high; a processing process is simple and the production cost is low; the blending oil is convenient to eat and the stability of the blending oil is higher than that of single oil; various types of edible oil beneficial to human health are blended to change the composition of fatty acids, so that the blending oil does not generate bad influences on the body and has the active effects of inhibiting and preventing cardiovascular and cerebrovascular diseases including hypertension, hyperlipidemia, atherosclerosis and the like, reducing serum cholesterol and triglyceride, eliminating in-vivo lipid hyperoxide and moistening skins.
Owner:SHANDONG SANXING CORN IND SCI CO LTD

High-quality and high-yield kiwi fruit planting method

The invention discloses a high-quality and high-yield kiwi fruit planting method. The method includes the steps of 1), for site selection and soil preparation, selecting an area with fertile and loosening soil and good drainage for construction of field, building windbreak on the periphery, evenly mixing and applying 50-100kg of farmyard manure when planting pits are backfilled with topsoil, and building ridges higher than the ground level; 2), for seed collection and seedling raising, collecting fully ripe fruit, loading the fruit into a gauze bag for kneading, repeatedly washing with clear water and placing seeds indoors for drying in the shade; 3), for grafting cultivation, when the diameter of a sapling is greater than 1cm, cutting off scions 5-10cm away from the ground level on the sapling, retaining 2-4 buds, selecting a vigorous stock, and grafting the scions to the stock with the planting density of 2m*4m; 4), performing cultivation management including soil management, fertilizing management and water management; 5), for harvest storage, storing kiwi fruit by means of constant-temperature storage, low-temperature storage and air-conditioned storage. With the method, yield of the kiwi fruit is increased, and quality of the kiwi fruit is improved.
Owner:CHONGQING RUIYUE AGRI DEV

Preservation method of fresh kiwi fruits

The invention relates to a high-efficiency and low-cost preservation method of kiwi fruits, and in particular relates to a preservation method capable of combining microporous preservative films, 1-methylcyclopropene and a low-temperature storage technology of the kiwi fruits, belonging to the technical field of agricultural food science. Aiming at the characteristics of being easily softened and rotten in the storage process of the kiwi fruits, the aim of preservation can be achieved by methods such as modified atmosphere packaging, post-harvest physiological accommodation, control of pathogenic bacteria and low-temperature storage. The method comprises the steps of sorting the fresh kiwi fruits, putting the sorted fresh kiwi fruits into microporous freshness protection packages, fumigating by the 1-methylcyclopropene, fumigating by a preservation smoke agent, precooling, sealing the packages, and storing in a fresh-keeping storehouse with the temperature of 0+ / -1 DEG C and the humidity of more than or equal to 80%; after 90 days, fumigating by the preservation smoke agent once every 30 days, and therefore, the kiwi fruits can be effectively stored for 180 days, and have the hardness of more than or equal to 4kg / m<2> and the edible rate of more than or equal to 90%.
Owner:GUIYANG UNIV

Three-dimensional planting method of kiwi fruit trees and tea trees

The invention provides a three-dimensional planting method of kiwi fruit trees and tea trees. The method comprises the following steps of: (1) scarifying the soil and forming fixed planting ditches in July to August, wherein the fixed planting ditches are 80 cm wide and 60cm deep, the central distance between fixed planting ditches is 2.5m, and the surface soil and the bottom soil when dug are piled on two sides respectively; (2) forming fixed planting furrow surfaces into fixed planting strips which are about 20 to 30cm deep and 1.0m wide; and (3) forming a furrow which is 20 to 30cm high and 1.0m wide between two rows of kiwi fruit trees, wherein the row and strain spacing of kiwi fruit trees is 5m*4m, namely the row spacing is 5m and the strain spacing is 4m, 33 kiwi fruit trees are planted in 1 mu (667 square meters), and the distances from the furrow to the kiwi fruit tree strips are equal, and planting the tea trees on the furrow surfaces, wherein the tea trees are planted on each furrow surfaces in two rows, the row spacing of the tea trees on the furrow surfaces is 40 to 50cm, the strain spacing of the tea trees is 20 to 25cm, each group of strain seedlings has two strains, and every mu has 4,500 to 5,000 tea tree seedlings. Through the three-dimensional planting method of the kiwi fruit trees and tea trees, the utilization rate of solar energy and biological energy isimproved; under the common action of the factors, the nutrition constituents of tea leaves are increased; the throughput of the tea leaves is higher than that of the tea leaves planted in a pure tea garden; the comprehensive benefit of kiwi fruits and the tea leaves is improved; and high quality, high yield and high benefit of the kiwi fruits and the tea leaves are achieved.
Owner:INST OF FRUIT & TEA HUBEI ACAD OF AGRI SCI

Method for quickly improving outplanting rate of culture of kiwi fruit seedlings

The invention discloses a method for quickly improving the outplanting rate of culture of kiwi fruit seedlings. The method has the technical characteristics that seeds of delicious kiwi fruits (i.e. the hairy variety) are adopted. The method comprises the steps of: sterilizing soil of a seedbed five to seven days before sowing, and soaking the seeds in water with the temperature of 50-60 DEG C for two to three hours before sowing; sowing in the middle ten days and the last ten days of January, transplanting at the appropriate time of the last ten days of March and the first ten days of April when young seedlings have four to five leaves, extirpating one to two knots at the tips of rootstocks in the first ten days of June, removing coppice shoots 5-10cm at the base parts of seedling trunks in time to guarantee smoothness of the parts of the seedlings to be grafted, grafting single-bud branches at the venter of the rootstocks in the first ten days and the middle ten days of June to the first ten days and the middle ten days of July, breaking the rootstocks off in the last ten days of July and the middle ten days of August, reserving four to five knots above engrafting buds, and breaking off the rootstocks with only barks remained; shearing the rootstocks in the first ten days of September, reserving 4-5cm stumps during stock shearing, removing buds of the rootstocks in time after stock shearing, removing the buds and shearing the coppice shoots as soon as the buds and coppice shoots are come out, and promoting the grafting buds to grow vigorously in combination with the supply of fertilizers and water; and making the kiwi fruit seedlings reach the standard of outplanting at the end of the same year, wherein the rate of outplanting in the same year reaches 80 percent to 90 percent.
Owner:INST OF FRUIT & TEA HUBEI ACAD OF AGRI SCI

Nutritive and healthcare rice containing five beans and production method thereof

The invention discloses nutritive and healthcare rice containing five beans and a production method of the nutritive and healthcare rice. The nutritive and healthcare rice is produced from the following raw materials in parts by weight: 450-550 parts of broad beans, 50-80 parts of white hyacinth beans, 50-80 parts of lotus seeds, 50-100 parts of corns, 50-60 parts of Chinese yam starch, 20-30 parts of tremella, 40-50 parts of malt, 5-10 parts of mint, 3-4 parts of pine needle, 5-10 parts of honeysuckle, 50-60 parts of passion fruit, 40-50 parts of rock candy, 50-60 parts of pigskin jelly, 50-60 parts of kiwi fruit, 2-3 parts of bamboo shavings, 1-3 parts of folium eriobotryae, 2-3 parts of magnolia officinalis, 1-2 parts of oldenlandia diffusa, 1-2 parts of folia perillae acutae and 2-3 parts of pericarpium citri reticulatae. According to the nutritive and healthcare rice, the five beans added into the formula are full of nutriments and have functions of protecting five internal organs, meanwhile, the added pseudo-ginseng powder has the effects of reducing blood fat and blood sugar, improving body immunity functions and the like, the added radix astragali has the effects of strengthening the spleen and stomach, adjusting the vital energy and nourishing the blood, and the added radix puerariae has the effects of reducing blood glucose and lipid and improving intelligence; the nutritive and healthcare rice is suitable for all kinds of people to eat and is beneficial for health.
Owner:JINCAIDI FOOD CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More