160 results about "Actinia" patented technology

The invention discloses a variety breeding and early-season high-yield cultivation technology for actinidia arguta. The variety breeding and early-season high-yield cultivation technology includes procedures of 1 variety selection, 2 seedling propagation, 3 field planting, 4 underground management, 5 pest control and 6 pruning. Seedling propagation carried out in a step 2 includes collecting and storing cuttings and performing root cutting on the cuttings in sunlight greenhouses, particularly, root cutting is performed on the cuttings in the nutrient pots, and greenwood cutting is performed on the cuttings. Compared with the prior art, the variety breeding and early-season high-yield cultivation technology has the advantages that seedlings are raised in the sunlight greenhouses by means of root cutting, so that the seedling growth time can be prolonged, the seedlings are healthy and are high in growth potential after being planted, and a foundation is laid for early and high yields; frame surfaces are replaced by small canopy frames, and accordingly operation and management can be facilitated.

The invention discloses a grafting method for a kiwi tree, comprising the following steps: the trunk of a kiwi tree with the tree age more than 5 years is sawn off in the period of the end of November and the middle of December of the first year, the kiwi tree grows to the middle of the second year, the trunk of the kiwi tree is sawn off to reach the height of 100-120 cm, scions from a robust kiwi tree are selected and grafted onto the kiwi tree with the sawn-off trunk, grafting incisions are bandaged, and the grafting is finished. Through the grafting method, the disadvantage that a main stem branch is poor in renewability existing in the grafting of kiwi trees with the tree age more than 5 years is solved, the replacement pace of tree spices is accelerated, the trees are quick in recovering growth vigor, the diseases are less, and the fruiting capacity of cultured branch groups is strong.

The invention provides a method of rapid breeding of kiwi fruit with large seed by tissue culture. The invention comprises steps of selecting and treating explant, inducing culture medium, root culturing and replanting, etc. The invention takes MS culture medium as basis and adds BA, NAA, GA, ZT and other external plant growth regulator to induce the growth of axillary bud of the said kiwi fruit and strengthen sprout and root. The root growth rate is as high as 100%, the average bud height is 6.28 cm and the average replanting survival rate is 91% after 35 days culture. The invention solves the technique problem of rapid breeding of said kiwi fruit and provides a method of short period, high breeding rate and low cost for the industrial production of kiwi fruit with large seed.

The invention discloses a secondary grafting method of hongyang kiwifruit. The secondary grafting method includes: cultivating first-grade grafting stock actinidia valvata; grafting actinidia valvata and a wild kiwifruit variety, and growing seedlings; grafting hongyang kiwifruit at a high position of the wild kiwifruit after growing for one year for cultivation. By adopting the method, the hongyang kiwifruit is high in adaptability and can normally grown in places different in altitude, terrain, soil and river valley and flat ground, so that kiwifruit cultivation area can be widened. The hongyang kiwifruit is high in yield, large and regular in fruit shape, orderly in size and good in taste, and the problem that actinidia valvata and the hongyang kiwifruit are low in affinity and grafting survival rate is solved.

The invention belongs to the technical field of plant tissue culture, and in particular relates to a method for establishing a kiwifruit in vitro regeneration system, which comprises: the steps of selecting and sterilizing explants, the step of inducing adventitious buds, the step of multiplying adventitious buds, the step of inducing rooting, and Seedling hardening and transplanting steps. According to the method for establishing the kiwifruit in vitro regeneration system provided by the present invention, the axillary bud induction rate reaches 100%, the leaf callus induction rate reaches 92%, the germination rate is 40%, the adventitious bud proliferation coefficient is 4.5, and the rooting rate can reach 96%. Not only can the kiwifruit reproduce rapidly, in large quantities and with high quality, but also the leaf callus induction step can provide a basis for the study of kiwifruit genetic transformation.

The invention discloses a white kiwi breeding and cultivating technology. The white kiwi breeding and cultivating technology comprises the following steps: (1) breeding a wild white kiwi nursery stock; (2) cultivating a large-fruit kiwi seedling; (3) grafting a mature wild white kiwi embryo onto the large-fruit kiwi seedling; and (4) performing technical management, including a shed building technology, a fertilizing technology, a trimming technology and a flower and fruit technology. The white kiwi breeding and cultivating technology has the advantages as follows: the quality of the wild white kiwi is ensured; and the weight of a single fruit is increased from 30g to 50-80g.

The invention belongs to the technical field of plant tissue culture and the field of forest propagation, and in particular relates to a method for quickly in-vitro actinidia kolomikta propagating. The method is mainly and technically characterized by comprising the following steps of: medium preparation; explant selection and disinfection; induction culture; subculture and rooting culture; and tissue culture seedling transplantation and acclimatization. The method has the beneficial effects that the adopted leaf blade is an explant which is convenient and easy to obtain, and the industrialized production throughout the year can be realized through only using a small amount of test materials; the production period is short, 53-65 days are only spent from inoculation to tissue culture seedling, the blade inductivity can reach 93%, the multiplication times can reach 12-15, and the transplanting rooting ratio can reach 92%; the provided method does not need to root in a bottle but adopts root dipping outside the bottle, not only can the time for rooting in the bottle be saved, but also the seedling cost is lowered; and by utilizing the provided method, the rooting ratio is increased during seedling culture in winter, the transplanting survival rate is increased and can reach 95%, and simultaneously the seedling culture cost is lowered.

The invention provides a method for preparing radix actinidia chinensis polysaccharide extract. The method comprises: heating dried radix actinidia chinensis with water for reflux extraction; centrifuging extract liquid; passing supernatant through a microporous filter membrane; ultra-filtering filtrate; concentrating the obtained product till the content of crude medicinal material is 0.1 to 5 g / mL; adding concentrated solution to 85 to 95 percent ethanol till the volume concentration of ethanol is 50 to 90 percent; standing the obtained product for alcohol precipitation; performing centrifugation; washing precipitate; drying the washed precipitate under vacuum at 60 to 80 DEG C; obtaining crude radix actinidia chinensis polysaccharide; and obtaining refined radix actinidia chinensis polysaccharide through further purification. The method has the main advantages that: (1) the method adopted for preparing radix actinidia chinensis polysaccharide achieves maximum separation and purification effects, ensures high purity of radix actinidia chinensis polysaccharide and high extraction rate, enriches effective components, and improves efficacy; (2) the method greatly reduces ethanol consumption and lowers cost; and (3) the method greatly reduces ethanol consumption and does not need to use ether, thereby improving production safety.

The invention belongs to the fields of artificial cultivation and molecular biology of A. arguta, and particularly relates to a molecular marker for early identification of sex of A. arguta young seedlings and an application of the molecular marker. Most of A. arguta belongs to dioecious plants, the economic value of female plants is apparently higher than that of male plants, in the breeding course, the juvenile stage of tree seedlings is excessively long, and male plants and female plants can be distinguished out by naked eyes after 5-7 years, so that if the sex of the young seedlings can beidentified at the early stage, massive breeding cost can be saved. The invention provides the molecular marker for early sex identification of tree seedlings of the A. arguta, and based on the molecular marker, a reagent kit for auxiliary breeding for the sex of the A. arguta and an early identification method for the sex of the A. arguta are established. Through detection on 95 A. arguta singleplants of which the sex is known, the testing accuracy rate can reach 95.7%. The molecular marker and the method disclosed by the invention are good in generality, simple to operate, good in stabilityand good in application prospects.

The invention discloses lotus young-keeping noodles, which are prepared from the following raw materials in part by weight: 100 to 150 parts of flour, 5 to 8 parts of buckwheat, 4 to 8 parts of konjac flour, 3 to 5 parts of lotus pollen, 5 to 8 parts of needle mushroom powder, 3 to 5 parts of acerola cherry freeze-dried powder, 5 to 8 parts of kiwi fruit freeze-dried powder, 1 to 2 parts of roselle calyx, 3 to 5 parts of cassia seed, 1 to 2 parts of osmanthus fragrans, 3 to 5 parts of Lecai, 2 to 4 parts of Chinese wolfberry, 2 to 4 parts of Chinese angelica, 5 to 7 parts of common lophatherum herb, 3 to 5 parts of lotus leaf, 2 to 4 parts of lotus, 1 to 3 parts of salt and 0.1 to 0.3 part of grape seed oil. The lotus young-keeping noodles are good in mouthfeel, delicious and rich in nutrition and simultaneously have dietetic and health-care effects of maintaining beauty and keeping young.

The invention discloses a tissue culture and rapid propagation method for actinidia chinensis, and relates to the tissue culture and rapid propagation method for actinidia chinensis seedlings. According to the method, young leaves of the current year serve as explants and are inoculated on a medium MS+0.3mg / LZT+0.05mg / LNAA subjected to callus induction and cluster bud differentiation. The invention also provides an improved MS; after cluster buds are differentiated, the cluster buds are sub-cultured in an improved MS+2mg / LZT proliferation culture medium, and are transferred into an improved MS+0.015mg / LTDZ thickening culture medium according to seedling height; small seedlings which are in accordance with rooting are transferred into 1 / 2 of improved MS+0.7mg / LIBA+0.1g / LAC rooting culture medium; the small seedlings are transplanted and are domesticated after roots grow. By the method, the callus induction rate reaches 96.4 percent; the height of cluster bud reaches 1.67cm; the proliferation coefficient of cluster buds reaches 3.67; the rooting rate reaches 98.12 percent; moreover, the culture medium is low in cost and short in propagation period, and industrial production can be realized.

The invention discloses a kiwi fruit extract. The kiwi fruit extract is obtained by the steps of juicing, enzymolysis, enzyme deactivation, filtering and concentrating; in the pretreatment process of kiwi fruits, a complex enzyme hydrolysis process is adopted, and pectinase is added to decompose colloid, so that the clarity of a solution is improved; protease is added to decompose nitrogen-containing compounds so as to improve the availability of the extract in cigarettes; vacuum decompression concentration is adopted during concentrating at the temperature of 60-80 DEG C, and the rapid and low-temperature concentration is realized, so that the aroma component of the extract is kept as far as possible, and energy sources are saved. According to the invention, the kiwi fruit extract is creatively applied to cigarettes as well as food and beverages and serves as a new raw material for cigarette production and food flavoring.

The invention relates to the field of plant pollen preservation and in-vitro culture vitality detection and particularly relates to a preservation and in-vitro culture vitality detection method for pollen of Actinidia arguta. The method comprises the steps: picking flower buds of the Actinidia arguta at a big bud stage and taking out anthers; drying the anthers, and carrying out screening, so as to collect pollen; sealing the collected pollen, and carrying out cryopreservation at the temperature of -85 DEG C to -75 DEG C; taking out the cryo-preserved pollen, and rewarming the cryo-preserved pollen at room temperature; uniformly spreading the rewarmed pollen onto a solid culture medium, carrying out culturing, and then, carrying out microscopy under a microscope, and counting the germinating rate of the pollen. According to the preservation method, the vitality of the pollen is still preserved good after the pollen is preserved for a long time, so that the pollen in-vitro culture detection method can be applied to the vitality detection on the pollen of the Actinidia arguta and is simple, rapid and accurate.

The invention discloses a real-time fluorescence PCR method for quantitatively detecting Pseudomonas syringae pv. Actinidiae. The method comprises the following steps: extracting an Actinidia chinensis sample genome DNA; electrophoretically detecting the band size and purity of the Actinidia chinensis sample genome DNA; carrying out fluorescent quantitative detection on a PSA pathogen; carrying out specific primer-based fluorescent quantitative amplification, and preliminarily determining whether the PSA pathogen is contained or not according to an amplification curve; purifying a PCR product with an obvious amplification peak, and sequencing the purified PCR product; and comparing a sequence obtained after the sequencing by Internet to further determine the PSA pathogen. The method allows a fluorescent quantitative PCR-based rapid detection method of the pathogen to be established, realizes rapid identification of the Pseudomonas syringae pv. Actinidiae infected sample, has the characteristics of simplicity in operation, high sensitivity, high specificity, and accurate and objective detection result, and is of great significance to improve the detection efficiency and the detection sensitivity of the Pseudomonas syringae pv. Actinidiae infected sample.

The invention discloses a method of cultivating Actinidia arguta, comprising the steps of selecting a variety, constructing a yard, improving soil, pruning, managing fertilizer and moisture, controlling disease and pest damage and the like; the method has the advantages that seedling cost is decreased, management cost is decreased, fertilizer utilization rate is increased, and the yield and quality of Actinidia arguta are significantly increased.

The invention is a method of extracting proteinase of kiwi fruit, adopting the salt to make salting-out precipitation process on kiwi fruit juice, and using isoelectric precipitation process, by solid-liquid separation, obtaining a wet proteinase of kiwi fruit, drying and crushing to obtain the dry powder of the proteinase of kiwi fruit. It has advantages of simple process, low equipment cost and fast benefits. It can make industrialized production. It overcomes the defects in ammonium sulphate process and be applied to foods and medicines. And the whole process meets the requirements for green and clean production. The produced proteinase meets hygienic quality standard of foods additive by inspection. By the invention, it can deeply process the kiwi fruit, and increasing the add-on value of kiwi fruit and able to produce the product proteinase of kiwi fruit.

The invention belongs to the technical fields of molecular biology and genetic breeding, and specifically relates to molecular marker Geo101 primers for kiwifruit Moshan series male variety identification and application. The molecular marker primers are Geo101-F: AGCATCGACAGTTCAGTTGG and Geo101-R: GCAGTTGAATCTTGCCATCA. By utilizing the primers, kiwifruit Moshan series male varieties can be accurately distinguished and identified, and other varieties besides the Moshan series male varieties can also be distinguished, so that the primers are universal for identification and suitable for large-scale popularization.

The invention discloses a method for recognizing the contribution proportion of kiwi fruit hybrid patients on a filial generation genome. The method comprises the following steps of performing genome low-depth sequence testing on hybrid parents and filial generations and distant hybrid outgroup; performing sequence testing data reference genome comparison, and obtaining single basic group variation information; performing single basic group variation-based genome window division and log probability estimation; performing sub window maximum possible gene tree building and confidence interval estimation; performing gene tree level and filial generation genetic relationship statistics and genome contribution ratio prediction on the hybrid parents. The whole genome variation information is used for analyzing the evolution genetic relationship of the hybrid patients and the hybrid filial generation, so that the prediction of the hybrid filial generation characteristic properties realizes high accuracy; meanwhile, by using the method, the magnitude and the direction of the possibly existing phenotypic characteristic variation are predicted in the baby period of the hybrid filial generation formation; the early stage screening of the hybrid strains can be greatly promoted; the labor and material cost can be reduced; the resource mining and utilization efficiency can be greatly improved.

The invention discloses a wisteria and kiwi fruit noodle. The wisteria and kiwi fruit noodle is prepared from the following raw materials in parts by weight: 120-130 parts of flour, 20-30 parts of glutinous rice flour, 22-34 parts of millet flour, 13-25 parts of purple sweet potatoes, 4-5 parts of pumpkins, 4-6 parts of potatoes, 10-12 parts of duck skin, 5-8 parts of pineapple flesh, 1-2 parts of tremella, 1-2 parts of wisteria, 1-2 parts of radix polygonati officinalis, 2-4 parts of pear roots, 2-3 parts of rehmannia leaves, 1-2 parts of platycodon grandiflorum, 1-2 parts of fructus alpiniae oxyphyllae, 1-2 parts of lotus leaves, 8-15 parts of kiwi fruits, 2-3 parts of salt, 0.3-0.5 part of sodium carbonate and a suitable amount of water. The wisteria and kiwi fruit noodle disclosed by the invention is abundant in nutrition and delicious in mouth feel, and has a certain dietary therapy and health-maintenance health-care effect; the duck skin is immersed by rice wine to remove oil and then is agitated with the pineapple flesh all the time; pineapple protease in an pineapple flesh can be used for decomposing collagen in the duck skin. The pear roots have the functions of removing heat from the lung to relieve cough and regulating qi to alleviate pains. The wisteria has the effect of inducing urination, seeds have an anti-corrosion effect, and wisteria tumors and stems have an anti-cancer function.

The invention discloses a culture medium for subculture multiplication of tissue cultured seedlings of red-flesh kiwifruits. On the basis of MS culture medium, through adjusting the types and concentrations of major elements and optimizing the concentration of hormone regulation agar and the like, balanced and reasonable nutritional requirement is provided to the subculture multiplication of the tissue cultured seedlings of the red-flesh kiwifruits, the rapid, efficient and strong growth of the red-flesh kiwifruits is ensured, the inter-node growth is effectively promoted and the multiplication coefficient is improved.

The invention relates to the technical field of microorganisms and particularly relates to a pseudomonas strain for preventing and treating kiwifruit canker and application of the pseudomonas strain. The Pseudomonas (pseudomonas sp.) strain provided by the invention has a preservation number of CCTCC NO: M2016556. The pseudomonas is obtained by separating and purifying collected kiwifruit twigs, a separation and screening method is simple, and the strain has very strong inhibition effect to pathogenic bacteria of kiwifruit bacterial canker and is capable of obviously inhibiting the growth of the pathogenic bacteria of the kiwifruit bacterial canker. The strain is separated from healthy plant tissues and is inoculated to the kiwifruit twigs, leaves are not abnormal, and a generated active metabolite has no obvious toxic effect to the plant tissues; the strain has stable property and remarkable effects on treating and preventing the kiwifruit canker and is easily wetted through spraying and beneficial to the environmental protection, and an environment-friendly, simple and effectively way is provided for the control and treatment of the kiwifruit canker.

The present invention discloses a method for cultivating a high-yield disease-resistant kiwi fruit variety. The method comprises the following steps of: using an age-old wild kiwi fruit tree as a stock tree, taking branches of a red kiwi fruit tree as scions, and grafting the scions to branches of the stock tree; cultivating seedlings cultivated by the grafted stock tree, taking branches of the grown seedlings, and grafting the branches to the red kiwi fruit tree; cultivating multi-strain seedlings by using the successfully grafted red kiwi fruit tree; and cultivating and managing the seedlings, analyzing fruit quality and comparing branch growth and development and agronomic characters after the seedlings fruit, selecting a high-quality single plant for expanding propagation according to analysis and comparison results, and cultivating a new variety. The new variety kiwi fruit is high-yield, disease-resistant, crack-resistant and cold-resistant.

By means of constituting Anthopleura sp tentacle cDNA library and DNA sequencing and designing degenerate primer based on the end conservative amino acid sequences of actinia neurotoxin protein, one new kind of actinia polypeptide neurotoxin gene, named su, is separated via RT-PCR process. The new gene has length of 141 bp and encodes 47 amino acid mature peptides. The expressed protein has ioelectric point of 7.9 and molecular weight of 4800 dalton. Cloning su in the trxA gene 3' end of thioredoxin gene fusion expression vector pETTRX, fusion gene is constituted and the fusion gene exists incolibacillus in intracellar soluble form with expression amount up to 100-120 mg / L. Through Ni-Chelating affinity chromatographic analysis, proteinase 3C cutting and gel filtering, recombinant actinia neurotoxin protein with purity over 95% is obtained with the yield of 10-50 mg / L.

The invention discloses a strong seedling rooting culture medium for kiwi fruits. The strong seedling rooting culture medium is characterized by comprising 1 / 2 improved MS, 0.5-1.0mg / L of BA, 0.3-0.7mg / L of NAA, 3-5g / L of agar and 20g / L of sucrose; the pH value is 5.8. According to the strong seedling rooting culture medium for the kiwi fruits, components and contents are improved and culture conditions are adjusted so that the transplanting survival rate of the kiwi fruits can be more than 90%; sprouts grow healthily; the output and the quality of the kiwi fruits can be effectively improved and the economic values are enhanced.

The invention provides a kiwi fruit tree grafting method. The method comprises the following steps that a trunk of a red-centred kiwi fruit tree with the tree age larger than four is sawn off, when the tree grows to the middle of the second year, the trunk is sawn to reach the height of 100-120 cm, a scion is selected from a robust wild actinidia eriantha tree for grafting, and a cut is bound finally; the cut of the red-centred kiwi fruit tree serving as a stock is treated with repairing liquid, and a scion branch is soaked in a plant growth regulator. According to the method, the grafting survival rate is high, grafted kiwi fruits are enlarged, and the character is stable.

The invention discloses a kiwi fruit foliar fertilizer with a sustained release effect and a preparation method of the kiwi fruit foliar fertilizer. The kiwi fruit foliar fertilizer consists of the following components in parts by weight: 40-60 parts of urea, 10-20 parts of starch, 10-30 parts of formaldehyde, 1-5 parts of aspartic acid, 1-5 parts of glycine, 1-5 parts of methionine, 20-30 parts of humic acid, 3-8 parts of monopotassium phosphate, 20-50 parts of potassium chloride, 1-5 parts of borax, 5-10 parts of ferrous sulfate, 10-15 parts of zinc sulfate, 5-10 parts of ammonium molybdate, 2-15 parts of calcium sulfate, 2-5 parts of trichoderma, 2-5 parts of gibberellins and 2-5 parts of a curing agent. The kiwi fruit foliar fertilizer with the sustained release effect disclosed by the invention is not only sufficient and balanced in nutrition, but also has the sustained release function so as to slowly release various elements of the fertilizer in stages to supply growth nutrient elements for the kiwi fruits. By applying the fertilizer, fruit setting is induced and the fruit setting rate of the kiwi fruits is increased to as high as 89.78%.

The invention discloses a kiwifruit grafting method. The kiwifruit grafting method comprises the following steps that S1, annual seedlings of a robust plant which has a strong root system and free of diseases and insect pests, has the stem thickness of 0.4-0.8 cm, and is smooth in stem body and upright in growth are selected, a pot with good drainage is chosen, activated carbon and gravel are placed at the bottom of the pot, then sand soil is put in the pot, then the stock is planted in the pot, and an annual spring shoot branch which is pure in variety, robust in growth, sufficient and plump in bud and free of diseases and insect pests is chosen, scions used in spring are generally collected through the combination of winter pruning, the pruned branches are chosen, tags are hung, the 50-100 branches are bound into one bundle, wet sand storage is conducted, and scions for bud grafting are used in summer and autumn; S2, spring grafting is conducted from the last 10 days in January to the first 10 days and middle 10 days in February, and summer grafting is conducted from the middle 10 days in June to the first 10 days in July. The kiwifruit grafting method is novel in conception, unique in measures, simple in technology and easy to implement, does not need to invest infrastructures, and is less in investment and obvious in effect, and can be worthy of vigorous application and popularization.

The invention relates to a preparation method of fruit vinegar fermented from Lucid Ganoderma. The preparation method comprises the following steps: 1, selecting 70% of Lucid Ganoderma (wall broken Lucid Ganoderma) and 30% of millet, fermenting by a traditional fermentation process, extracting a fermentation broth; 2, mixing 20% of a Pyrus serotina juice, 20% of an apple juice, 20% of a sea buckthorn juice, 20% of an Actinidia chinensis juice and 20% of a tomato juice to obtain a mixed juice; 3, taking 500kg of purified water, adding 4% of the fermentation broth, 4% of the mixed juice and uniformly stirring according to a preparation proportion of 92%; and 4, adding relevant accessories, uniformly mixing, sterilizing, canning, sealing, cooling, and packaging. So the fruit vinegar is obtained.

The invention discloses a banana actinidia japonica rice jam. The jam is prepared from the following raw materials in parts by weight: 190-220 parts of bananas, 60-70 parts of actinidia, 70-80 parts of japonica rice, 14-18 parts of apple flowers, 8-10 parts of endothelium corneum, 2-3 parts of alpinia officinarum hance, 4-6 parts of mesona blume, 5-8 parts of mosla chinensis maxim, 3-4 parts of chaenomeles pip, 4-5 parts of Chinese chestnut leaves, 52-56 parts of white granulated sugar, 22-26 parts of konjaku flour, 2-4 parts of green tea powders, 10-13 parts of sesame oil, 26-30 parts of Chinese date honey and appropriate amount of purified water. The japonica rice with a health care effect is added in the preparation process of the jam disclosed by the invention; the mesona blume can stop bleeding by astringency, stop dysentery, and kill worm; the endothelium corneum can disperse accumulation and stagnation, and strengthen the spleen and the stomach; the alpinia officinarum hance can warm the stomach for dispelling cold, help digestion and kill pain; the chaenomeles pip can get rid of pathogenic fire; the mosla chinensis maxim can induce perspiration, relieve summer heat, promote water circulation, disperse moisture, warm the stomach and regulate middle energizer; and the jam is bright and beautiful in color, moderate in sweet and sour, delicate and soft in taste, and high in nutrition and health care value, and has unique fruit aroma and japonica rice aroma and wide market prospect.