Molecular marker Geo101 primers for kiwifruit Moshan series male variety identification and application
A variety identification and molecular marker technology, applied in the fields of molecular biology and genetics and breeding, can solve the problem that the molecular marker identification research of kiwifruit male series varieties has not been carried out, and achieve the effect of simple and intuitive morphological markers, poor polymorphism and small quantity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Acquisition of molecular marker Geo101 primers for identification of kiwifruit Moshan series male varieties:
[0019] The applicant downloaded the complete gene sequence of 'Hongyang' kiwifruit from the Kiwifruit Genome Sequence website (http: / / bioinfo.bti.cornell.edu / kiwi). Mining the SSR sites of different repeating units in the whole genome, comparing the gene structure annotation results, and selecting the SSR sites in the gene interval to design amplification primers. Using the designed and synthesized primers, the kiwifruit 'Moshan' series varieties were amplified by PCR, and the molecular marker Geo101 was obtained by screening. The primers designed for it were Geo101-F:AGCATCGACAGTTCAGTTGG and Geo101-R:GCAGTTGAATCTTGCCATCA.
Embodiment 2
[0021] The application of molecular marker Geo101 primers for the identification of kiwifruit Moshan series male varieties in the identification of kiwifruit Moshan varieties:
[0022] (1) According to the CTAB method, the DNA samples of 'Moshanxiong 1', 'Moshanxiong 2', 'Moshanxiong 3', 'Moshanxiong 4' and 'Moshanxiong 5' were extracted respectively .
[0023] (2) Pipette the mixture of 990ul HIDI and 10ul ROX500 or LIZ500 into a 96-well reaction plate, 10ul per well.
[0024] (3) Place the 96-well plate in a flat centrifuge, centrifuge at 500g and stop immediately.
[0025] (4) In the corresponding wells of the 96-well plate, 5 DNA samples from the Mo Shanxiong series were added, 50pg for each sample.
[0026] (5) Add the corresponding reagents to the 96-well plate according to the following PCR reaction system, seal the 96-well plate with a plate sealing film, shake, place the 96-well plate in a plate centrifuge, and stop centrifuging at 500g. The PCR reaction was perfor...
Embodiment 3
[0039] The application of molecular marker Geo101 primers for the identification of kiwifruit male Moshan varieties in the identification of kiwifruit varieties:
[0040] Extract 'Moshanxiong No.1', 'Moshanxiong No.2', 'Moshanxiong No.3', 'Moshanxiong No.4', 'Moshanxiong No.5', 'Huaguang No.2', 'Xixuan For DNA samples of No. 1' or 'Huayou' kiwifruit, use the method in Example 2, using Geo101-F: AGCATCGACAGTTCAGTTGG and Geo101-R: GCAGTTGAATCTTGCCATCA. Molecular markers were identified for the above varieties.
[0041]Using the marker Geo101 to amplify the varieties of Moshan series, it can specifically distinguish 'Moshanxiong 1', 'Moshanxiong 2', 'Moshanxiong 3', 'Moshan 4', 'Moshanxiong 5 No.', 'Huaguang No.2', 'Xixuan No.1' or 'Huayou' kiwi fruit. The results showed that 'Moshanxiong 1' could not amplify a band; 'Moshanxiong 2' amplified a band of 274bp; 'Moshanxiong 3' amplified three bands, respectively 264bp, 268bp and 270bp; 'Moshan 4' amplified 2 bands, 274bp and 278...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


