Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker Geo101 primers for kiwifruit Moshan series male variety identification and application

A variety identification and molecular marker technology, applied in the fields of molecular biology and genetics and breeding, can solve the problem that the molecular marker identification research of kiwifruit male series varieties has not been carried out, and achieve the effect of simple and intuitive morphological markers, poor polymorphism and small quantity.

Active Publication Date: 2017-11-10
WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI
View PDF5 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, research on molecular marker identification of male kiwifruit serial varieties has not yet been carried out

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker Geo101 primers for kiwifruit Moshan series male variety identification and application
  • Molecular marker Geo101 primers for kiwifruit Moshan series male variety identification and application
  • Molecular marker Geo101 primers for kiwifruit Moshan series male variety identification and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Acquisition of molecular marker Geo101 primers for identification of kiwifruit Moshan series male varieties:

[0019] The applicant downloaded the complete gene sequence of 'Hongyang' kiwifruit from the Kiwifruit Genome Sequence website (http: / / bioinfo.bti.cornell.edu / kiwi). Mining the SSR sites of different repeating units in the whole genome, comparing the gene structure annotation results, and selecting the SSR sites in the gene interval to design amplification primers. Using the designed and synthesized primers, the kiwifruit 'Moshan' series varieties were amplified by PCR, and the molecular marker Geo101 was obtained by screening. The primers designed for it were Geo101-F:AGCATCGACAGTTCAGTTGG and Geo101-R:GCAGTTGAATCTTGCCATCA.

Embodiment 2

[0021] The application of molecular marker Geo101 primers for the identification of kiwifruit Moshan series male varieties in the identification of kiwifruit Moshan varieties:

[0022] (1) According to the CTAB method, the DNA samples of 'Moshanxiong 1', 'Moshanxiong 2', 'Moshanxiong 3', 'Moshanxiong 4' and 'Moshanxiong 5' were extracted respectively .

[0023] (2) Pipette the mixture of 990ul HIDI and 10ul ROX500 or LIZ500 into a 96-well reaction plate, 10ul per well.

[0024] (3) Place the 96-well plate in a flat centrifuge, centrifuge at 500g and stop immediately.

[0025] (4) In the corresponding wells of the 96-well plate, 5 DNA samples from the Mo Shanxiong series were added, 50pg for each sample.

[0026] (5) Add the corresponding reagents to the 96-well plate according to the following PCR reaction system, seal the 96-well plate with a plate sealing film, shake, place the 96-well plate in a plate centrifuge, and stop centrifuging at 500g. The PCR reaction was perfor...

Embodiment 3

[0039] The application of molecular marker Geo101 primers for the identification of kiwifruit male Moshan varieties in the identification of kiwifruit varieties:

[0040] Extract 'Moshanxiong No.1', 'Moshanxiong No.2', 'Moshanxiong No.3', 'Moshanxiong No.4', 'Moshanxiong No.5', 'Huaguang No.2', 'Xixuan For DNA samples of No. 1' or 'Huayou' kiwifruit, use the method in Example 2, using Geo101-F: AGCATCGACAGTTCAGTTGG and Geo101-R: GCAGTTGAATCTTGCCATCA. Molecular markers were identified for the above varieties.

[0041]Using the marker Geo101 to amplify the varieties of Moshan series, it can specifically distinguish 'Moshanxiong 1', 'Moshanxiong 2', 'Moshanxiong 3', 'Moshan 4', 'Moshanxiong 5 No.', 'Huaguang No.2', 'Xixuan No.1' or 'Huayou' kiwi fruit. The results showed that 'Moshanxiong 1' could not amplify a band; 'Moshanxiong 2' amplified a band of 274bp; 'Moshanxiong 3' amplified three bands, respectively 264bp, 268bp and 270bp; 'Moshan 4' amplified 2 bands, 274bp and 278...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical fields of molecular biology and genetic breeding, and specifically relates to molecular marker Geo101 primers for kiwifruit Moshan series male variety identification and application. The molecular marker primers are Geo101-F: AGCATCGACAGTTCAGTTGG and Geo101-R: GCAGTTGAATCTTGCCATCA. By utilizing the primers, kiwifruit Moshan series male varieties can be accurately distinguished and identified, and other varieties besides the Moshan series male varieties can also be distinguished, so that the primers are universal for identification and suitable for large-scale popularization.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and genetic breeding, and more specifically relates to molecular marker Geo101 primers for identification of kiwifruit Moshan series male varieties and its application. Background technique [0002] In recent years, my country's kiwifruit industry has steadily expanded. As of 2016, the national cultivation area reached 2.2 million mu, with an output of 2.6 million tons and an output value of more than 20 billion yuan. Kiwifruit belongs to the dioecious type, that is, the pollen in the female flower is aborted, while the ovary is not fully developed and the ovule is aborted in the male flower. Therefore, in kiwifruit breeding and commercial orchard cultivation, it is usually necessary to select pollen from excellent male plants for cross-pollination to achieve kiwifruit fruiting. [0003] In recent years, the 'Moshan' male series of kiwifruit varieties selected and bred by the Wuhan Bota...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 黄宏文张琼钟彩虹刘小莉
Owner WUHAN BOTANICAL GARDEN CHINESE ACAD OF SCI