Check patentability & draft patents in minutes with Patsnap Eureka AI!

Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof

A molecular marker and white-backed planthopper technology, applied in the field of agricultural biotechnology engineering, can solve the problems of difficult practical application and difficult selection of markers, and achieve the effect of strong resistance to brown planthopper and strong resistance

Active Publication Date: 2012-07-18
CHINA NAT RICE RES INST
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

McCouch was the first to carry out molecular mapping research on rice white-backed planthopper resistance. He first used the TN1 (Taichung Local No. 1) / IR36 near-isogenic line to map Wbph1 between two RFLP markers RG146 and RG445, but due to the RFLP The marker is a multi-copy marker, and it is difficult to be used as a selection marker; since then, Wbph2 and Wbph6(t) have also been mapped successively, but their genetic distances are 25.6cM and 21.2cM, respectively, and practical application is still very difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof
  • Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof
  • Molecular marker interlocked with rice Sogatella furcifera resisting gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1. Using SSR molecular markers to obtain the molecular marker RM401 linked to the rice resistance to white-backed planthopper gene:

[0053] The specific method is: the parent of the insect-resistant gene donor is from the japonica rice variety Chunjiang 06 (CJ06) of the China Rice Research Institute, and is crossed with the common indica rice variety Taichung Local No. 1 (TN1) which is susceptible to insects. Eighty-five recessive individuals (that is, individuals exhibiting susceptibility) were identified from the offspring of the population for linkage analysis.

[0054] 1. DNA extraction

[0055] 1) Prepare DNA extraction buffer:

[0056] Add 1 volume of DNA extraction solution (0.35M sorbitol; 0.1M Tris, pH8.2; 0.005MEDTA; the rest is water), 1 volume of nuclear lysis solution (0.2M Tris, pH7.5; 0.05M EDTA; 2M NaCl; 0.055MCTAB; the rest is water) and 0.4 volume of 5% (mass concentration) sarkosyl solution (i.e. the aqueous solution of sodium lauryl-N-meth...

Embodiment 2

[0082] Embodiment 2: Obtain the molecular marker Wbsca1 linked with the rice anti-white-backed planthopper gene with STS molecular markers, the plant material is the same as in Example 1, and the specific method is as follows:

[0083] 1. DNA extraction

[0084] 1), first prepare the DNA extraction buffer:

[0085] With the step 1) of embodiment 1.

[0086] 2), each kind of paddy rice leaf is carried out as follows processing respectively:

[0087] With the step 2) of embodiment 1.

[0088] 2. STS analysis:

[0089] Design of STS primers According to the results of Nipponbare and 93-11 sequence alignment, suitable primers were designed for polymorphism screening of CJ06 and TN1, and Shanghai Shenneng Gaming Company was commissioned to synthesize and design 2 pairs of STS primers, as shown in Table 2:

[0090] Table 2. Sequences of 2 pairs of STS primers synthesized

[0091]

[0092] 1. PCR amplification

[0093] (1), the reaction system is:

[0094] Rice genomic DNA 20...

Embodiment 3

[0103] Example 3, identification of rice white-backed planthopper-resistant varieties using RM401

[0104] The specific method is: select 5 rice materials with known resistance to white-backed planthopper from the germplasm resource bank of the China Rice Research Institute. The insect-resistant materials are: Jiahua 1, Xiushui 04, Nonghu 6, Fu 709 , Shan 209; Insect-susceptible materials are: Zhenshan 97B, Nongken 58, IR26, Lingfeng, Jinnanfeng, using SSR primer RM401 to identify their resistance to white-backed planthopper.

[0105] 1. DNA extraction

[0106] 1), first prepare the DNA extraction buffer:

[0107] With embodiment 1.

[0108] 2), each kind of paddy rice leaf is carried out as follows processing respectively:

[0109] With embodiment 1.

[0110] 2. SSR analysis

[0111] 1. PCR amplification

[0112] With embodiment 1.

[0113] 2. Electrophoresis detection

[0114] With embodiment 1.

[0115] 3. SSR molecular marker RM401 and resistance to white-backed p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker interlocked with a rice Sogatella furcifera resisting gene. Rice is used as a species, and molecular marker primers are selected from any of the following primer pairs, wherein the nucleotide sequence is from 5' to 3': RM401 forward: TGGAACAGATAGGGTGTAAGGG, reverse: CCGTTCACAACA CTATACAAGC; Wbsca1 forward: CAATGTTAGTATCGATCTGCTCAT, reverse: TCCTTTGACAGAATGAAACACC. RM401 is located on the rice chromosome 4, and Wbsca1 is located on the rice chromosome 4. The invention also discloses a method for developing the molecular marker. The molecular marker is used for identifying rice Sogatella furcifera resisting varieties and assisting selective breeding of rice Sogatella furcifera resisting offsprings.

Description

technical field [0001] The invention belongs to agricultural biotechnology engineering, and particularly relates to a molecular marker linked with a rice white-backed planthopper resistance gene and an obtaining method thereof. Background technique [0002] Rice white-backed planthopper (Sogatella furcifera, Horváth) is one of the main pests in rice-producing areas of my country and Southeast Asia. Planthoppers have become the main pests of rice. According to the Chinese Agricultural Yearbook, in the year when the rice planthopper reappears, the affected area exceeds 50% of the total rice area in my country. In 1991, the large-scale rice planthopper damage occurred in my country caused a loss of nearly 1.6 billion kilograms of rice, and the damaged area reached 29.33 million hm2; Lice damage amounted to more than 260 million mu times. Therefore, the prevention and control of white-backed planthopper has become an important content to ensure food production. [0003] The ma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 曾大力李家洋钱前胡江张光恒郭龙彪董国军刘坚高振宇朱丽颜美仙胡兴民
Owner CHINA NAT RICE RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More