Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

32 results about "Codling moth" patented technology

The codling moth (Cydia pomonella) is a member of the Lepidopteran family Tortricidae. They are major pests to agricultural crops, mainly fruits such as apples and pears. Because the larvae are not able to feed on leaves, they are highly dependent on fruits as a food source and thus have a significant impact on crops. The caterpillars bore into fruit and stop it from growing, which leads to premature ripening. Various means of control, including chemical, biological, and preventative, have been implemented. This moth has a widespread distribution, being found on six continents. Adaptive behavior such as diapause and multiple generations per breeding season have allowed this moth to persist even during years of bad climatic conditions.

Broad-spectrum and highly effective new Bacillus thuringiensis strain, its bacterial agent and application

Belonging to the field of biological control of pests, the invention discloses a Bacillus thuringiensis strain that has a broad spectrum and is highly effective on lepidoptera pests, preparation of its wettable powder and application. The Bacillus thuringiensis YX-1 strain involved in the invention is preserved in China General Microbiological Culture Collection Center, and the preservation number is CGMCC No. 5256. Containing a plurality of insecticidal genes, the strain has a highly effective lethal effect on Cydia molesta, cotton bollworm, fall webworms, Adoxophyes orana Fisher von Roslerstamm, Phalera flavescens Bremer et Grey, carpocapsa pomonella, prodenia litura, plutella xylostella, beet armyworm and other lepidoptera pests. The invention also discloses a method for preparation of wettable powder through the YX-1 strain. The Bacillus thuringiensis YX-1 strain and its wettable powder provided in the invention are mainly used for prevention and treatment of lepidoptera pests on various fruit trees and vegetables, also can be used for prevention and treatment of lepidoptera pests on field crops and garden plants, and have the characteristics of broad spectrum, high efficiency, safety to people, livestock as well as animals and plants, and no environmental pollution, etc.
Owner:HEBEI AGRICULTURAL UNIV.

Mating disruption agent for controlling codling moths and oriental fruit moths

InactiveCN102187863AReduce in quantityReduce insect population densityBiocidePest attractantsAntioxidantSilurodiscoides
The invention relates to a mating disruption agent. The invention discloses a mating disruption agent for controlling codling moths and oriental fruit moths, wherein the codling moth mating disruption agent comprises trans-8, trans-10- dodecadienoic-1-alcohol, lauryl alcohol, tetradecyl alcohol, cetyl alcohol and an antioxidant in a weight ratio of (1-100):(5-100):(5-100):(1-50):(1-20); and the oriental fruit moth mating disruption agent comprises (Z)-8-dodecanyl acetate, trans-8-dodecanyl acetate, (Z)-8-dodecanyl-1-alcohol, lauryl alcohol, tetradecyl alcohol, cetyl alcohol and an antioxidant in a weight ratio of (1-100):(1-20):(1-20):(5-100):(5-100):(1-50):(1-20). All components of the mating disruption agent are uniformly mixed and loaded in a sustained-release vector. The mating disruption agent has the advantages of environmental friendlessness, safety to natural enemies, convenience of operation and low cost; moreover, when the mating disruption agent is used for controlling the codling moths and the oriental fruit moths in a large area, higher economical and social benefits are created.
Owner:崔艮中

Ginkgo Derived Compositions And Their Use To Prevent Fruit Infestation by Codling Moth

Codling moth, Cydia pomonella, (L.), is a cosmopolitan pest of the apple, potentially causing damage to circa 80% of the fruit. Disclosed here are use of extract of Ginkgo biloba, or its synthetic metabolites for preventing or treating apple feeding and infestation by neonate larvae of codling moth.
Owner:MISSOURI STATE UNIVERSITY

Codling moth identification primer, identification method and application

The invention relates to a codling moth identification primer, which comprises a primer 1F: 5'-ATTACCCCCATCTATTATACTT-3' and a primer 1R: 5'-TGGTAATGATAAAAGAAGTAAAAGAGC-3'. A method for identifying codling moths by use of the primer comprises the following steps: (1) extracting a DNA template of an identification sample; (2) using the codling moth identification primer in right claim 1 to perform PCR amplification on template DNA; and (3) detecting the existence of 289bp band through electrophoresis. The codling moth identification primer provided by the invention has good amplification effect on target fragments of codling moths, can identify samples only according to the existence of the 289bp band when the primer is used for identification, and has the advantages of quickness, convenience, clear results and accuracy.
Owner:NORTHWEST A & F UNIV

PCR primer for identifying codling moth cell line and identifying method of codling moth cell line

InactiveCN105255883ASimple Enzyme Digestion Identification MethodStable Enzyme Digestion Identification MethodMicrobiological testing/measurementDNA/RNA fragmentationForward primerAgricultural science
The invention provides a PCR primer for identifying a codling moth cell line and an identifying method of the codling moth cell line. A PCR primer pair for amplifying the mitochondria COI gene segments of the codling moth and other insect cell lines provided by the invention has a forward primer sequence as shown in SEQ ID NO:1 and has a reverse primer sequence as shown in SEQ ID NO: 2. The forward primer sequence after optimization is SEQ ID NO:3 and the reverse primer sequence is SEQ ID NO: 4. The invention also provides an identifying method for the codling moth cell line. According to the invention, the difference between the mitochondria COI gene segments of the codling moth and other insect cell lines is researched at the molecular level and the identifying method for the cell lines such as the codling moth, the dark holotricha parallela, the asparagus caterpillar, the cabbage looper is established.
Owner:QINGDAO AGRI UNIV

Oriental fruit moth fluorescent light PCR (Polymerase Chain Reaction) detection method and application

The invention discloses an oriental fruit moth fluorescence PCR (Polymerase Chain Reaction) detection method. The oriental fruit moth fluorescence PCR detection method comprises the following steps of (1) extracting DNA (Deoxyribose Nucleic Acid) of a to-be-authenticated sample genome; (2) arranging a real-time fluorescence quantification PCR amplification system and performing real-time fluorescence PCR detection through a specific primer and a probe with the DNA of the genome serving as an amplification template; (3) analyzing and judging an amplification result. The probe is 5'-(FAM) CGAAATCTTAATACTTCATTTTTTGACCCTG (TAMRA)-3'. THE oriental fruit moth fluorescence PCR detection method can effectively district an oriental fruit moth from fruit boring pests (comprising the oriental fruit moth, codling moth, euzophera pyriella yang and the like).
Owner:中华人民共和国库尔勒出入境检验检疫局

Indoor artificial breeding method for codling moths

PendingCN108207809ASimple farming operationBreeding environment is easy to controlAnimal husbandryCodling mothCorrelational study
The invention discloses an indoor artificial breeding method for codling moths. The growth process of the codling moths is 'eggs-larvas-pupas-imagoes', the imagoes mate to lay the eggs, and populationbreeding is achieved. The indoor artificial breeding method comprises the steps that indoor space suitable for the growth of the codling moths with controllable temperature, humidity, illumination and other environments is established; apples with worms are collected from the wild to acquire pest sources of the codling moths, the worms are taken back for breeding to form subcultured indoor codling moth population. According to the indoor artificial breeding method for the codling moths, the breeding operation method is simple, the breeding environment is controlled easily, the long-term breeding can establish the stable indoor codling moth population, provide adequate pest source worms for the subsequent correlational studies on the codling moths, and provides conditions for the prevention and cure research of the codling moths.
Owner:GANSU AGRI UNIV

Insecticide composite containing metaflumizone and flubendiamide

The invention discloses an insecticide composite containing metaflumizone and flubendiamide. The composite is mainly characterized by comprising metaflumizone and flubendiamide as active ingredients, and the balance of auxiliaries, wherein the weight ratio of two active ingredients, namely the metaflumizone and flubendiamide is (1:80)-(80:1). The composite can be prepared into wettable powder, a water dispersible granule, a suspending agent, a suspoemulsion, an emulsion in water and a microemulsion. The composite can prevent and treat various injurious insects, has obvious synergism effects, expands the insecticidal spectrum, and has relatively high activity on rice leaf folder, Chilo suppressalis, tryporyza incertulas, cabbage caterpillar, asparagus caterpillar, prodenia litura, cotton bollworm, pink bollworm, fall webworm, codling moth and the like of rice, vegetables, cotton and fruit trees; and in the insecticide composite, pesticide dosage is reduced, the residual quantity of the pesticide is reduced, and the environmental pollution is lightened; the insecticide composite is safe to people and livestock and has good environment compatibility, and the injurious insect has small possibility of generating resistance to drugs.
Owner:SHAANXI MEIBANG PHARMA GRP CO LTD

Feeding deterrence in agricultural pests such as hemiptera, lepidoptera and coleoptera

ActiveUS20150051276A1Low mammalian toxicityOptimal control methodBiocideHydroxy compound active ingredientsOrder LepidopteraOrder Hemiptera
Compounds are used as agents that deter feeding of crops by agricultural pests such as hemiptera, lepidoptera and coleoptera, including, but not limited to, stink bugs, codling moth larvae and granary weevils. Feeding deterrence is obtained by contact of the insects with at least one of the compounds of the structure (I) wherein R is —OH, ═O, —OC(O)R4, —OR6, or —(OR6)2, wherein each R6, is independently an alkyl group containing from 1 to 4 carbon atoms and R4 is a branched or straight chain, saturated or unsaturated, hydrocarbyl group with zero to two double bonds and from 1 to 15 carbon atoms; X is O or CH2 with the proviso that when X is O R can only be ═O; each Z is independently (CH) or (CH2); y is a numeral selected from 1 and 2; R1 is H or a branched or straight chain, saturated or unsaturated hydrocarbyl group with zero to two double bonds and from 1 to 15 carbon atoms; R2 is H or a branched or straight chain, saturated or unsaturated hydrocarbyl group with zero to three double bonds and from 1 to 15 carbon atoms; R3 is selected from H, a branched or straight chain, saturated or unsaturated hydrocarbyl group with zero to three double bonds and from 1 to 15 carbon atoms, —(CH2)nOH, —C(O)OR5, —CH2C(O)OR7, —CH2C(O)R8, —C(O)NR9R10, and —CH2C(O)NR11R12 where each of R5, R7, R8, R9, R10, R11 and R12 is independently selected from H and a branched or straight chain, saturated or unsaturated hydrocarbyl group with zero to three double bonds and from 1 to 15 carbon atoms and n is an integer of from 1 to 12; the bond between the 2 and 3 positions in the ring structure may be a single or a double bond; and wherein the compounds of structure (I) contain from 9 to 20 total carbon atoms in the compounds.
Owner:BEDOUKIAN RES

Codling moth sex attractant and lure

The invention relates to the technical field of insect sex attractants, in particular to a codling moth sex attractant and a lure. The codling moth sex attractant comprises sex attractant effective components, and the sex attractant effective components comprise cis-3-tetradecenol acetate, trans-3-tetradecenol acetate and cis-5-dodecenol acetate. The codling moth sex attractant is used for forecasting insect conditions, directly catching and killing and preventing and controlling the codling moths by an interference mating method, the natural enemies of the codling moths can be protected, benefits are brought into play, harm is eliminated, the power for preventing and treating the codling moths is brought into full play, the effect of preventing and treating the codling moths is improved,chemical agricultural chemicals can be prevented from being applied, pollution is reduced, the environment is protected, and the social benefits and the ecological benefits are remarkable.
Owner:BEIJING FORESTRY UNIVERSITY +1

Green muscardine fungus strain with high pathogenicity to codling moth and application thereof

InactiveCN106591153AStrong infection and pathogenicityNo pollution in the processBiocideFungiBiotechnologyMicroorganism
The invention discloses a strain of beauveria bassiana with high pathogenicity to scarabaeform larvas and application thereof. The provided beauveria bassiana strain is named after Beauveria bassiana BbQLU1 and is preserved at China General Microbiological Culture Collection Center, CGMCC in November 30 2015, and the preservation number is CGMCC NO.11618. By morphology and DNA-ITS sequence determination to the fungus strain, the fungus strain is determined as Beauveria bassiana. The fungus strain is fast in growth speed and strong in sporulation capacity, meanwhile can prevent and treat the scarabaeform larvas well, and has good development potential and production value.
Owner:QILU UNIV OF TECH

Insecticidal composition containing methoxyfenozide and pyriproxyfen

The invention relates to an insecticidal composition containing methoxyfenozide and pyriproxyfen. The insecticidal composition comprises the effective ingredients methoxyfenozide and pyriproxyfen in binary distribution, wherein the mass ratio of the methoxyfenozide to the pyriproxyfen is (1-40):(40-1); the total quality of the effective ingredients, namely methoxyfenozide and pyriproxyfen in the preparation is 1-80% of the entire preparation; the other ingredients are auxiliary ingredients which are permitted and accepted in pesticide; the dosage form of the insecticidal composition is missible oil, a suspending agent, wettable powder, water dispersible granule, emulsion in water, microemulsion, granule and a microcapsule. The insecticidal composition is mainly used for preventing and treating rice-stem borer, codling moth, plutella xylostella, asparagus caterpillar, prodenia litura, bemisia tabaci, scale insect, pear psyllid and thrips.
Owner:QINGDAO AUDIS BIO TECH CO LTD

Feeding deterrence in agricultural pests such as hemiptera, lepidoptera and coleoptera

Compounds are used as agents that deter feeding on crops by agricultural pests, such as hemiptera, lepidoptera and coleoptera, including, but not limited to, stink bugs, codling moth larvae and granary weevils. Feeding deterrence is obtained by contact of the insects with at least one of the compounds of the structure (I)whereinR is —OH, ═O, —OC(O)R4, —OR6 or —(OR6)2, wherein each R6 is independently an alkyl group containing from 1 to 4 carbon atoms and R4 is a branched or straight chain, saturated or unsaturated, hydrocarbyl group with zero to two double bonds and from 1 to 15 carbon atoms;X is O or CH2 with the proviso that when X is O, R can only be ═O;each Z is independently (CH) or (CH2);y is a numeral selected from 1 and 2;R1 is H or a branched or straight chain, saturated or unsaturated hydrocarbyl group with zero to two double bonds and from 1 to 15 carbon atoms;R2 is H or a branched or straight chain, saturated or unsaturated hydrocarbyl group with zero to three double bonds and from 1 to 15 carbon atoms;R3 is selected from H, a branched or straight chain, saturated or unsaturated hydrocarbyl group with zero to three double bonds and from 1 to 15 carbon atoms, —(CH2)nOH, —C(O)OR5, —CH2C(O)OR7, —CH2C(O)R8, —C(O)NR9R10, and —CH2C(O)NR11R12 where each of R5, R7, R8, R9, R10, R11 and R12 is independently selected from H and a branched or straight chain, saturated or unsaturated hydrocarbyl group with zero to three double bonds and from 1 to 15 carbon atoms and n is an integer of from 1 to 12;the bond between the 2 and 3 positions in the ring structure may be a single or a double bond; and wherein the compounds of structure (I) contain from 9 to 20 total carbon atoms in the compounds.
Owner:BEDOUKIAN RES

Insecticidal composition containing emamectin benzoate and methoxyfenozide

The invention relates to an insecticidal composition containing emamectin benzoate and methoxyfenozide. The insecticidal composition contains active components namely emamectin benzoate and methoxyfenozide which are binarily compounded, wherein the mass ratio of emamectin benzoate to methoxyfenozide is (1-50): (50-1); and the preparation comprises the following ingredients by weigh percent: 1-80% of the active components namely emamectin benzoate and methoxyfenozide and the balance of auxiliary components which are permitted and acceptable in pesticide. The dose form of the insecticidal composition is missible oil, a suspending agent, wettable powder, a water dispersible granule, emulsion in water and microemulsion, and is mainly used for controlling lepidoptera and diptera pests, such as argyrotaenia veltinana, heliothis virescens, cotton bollworm, tobacco hornworm, plutella armyworm, asparagus caterpillar, spodoptera frugiperda, trichoplusia ni, cabbage looper, imported cabbageworm, hellula undalis, cabbage borer, tomato hawkmoth, potato beetle, epilachna, rice-stem borer and codling moth.
Owner:HAILIR PESTICIDES & CHEM GRP

Agents for control of codling moth in fruit orchards

The invention provides a method for identifying volatile insect repellents and / or attractants released from their non-volatile glycosides by the action of -glucosidase on plant tissue extracts. By this method, geraniol was identified as codling moth repellent and methyl salicylate, (2R,5R)-theaspirane, and (2S,5R)-theaspirane, and to a lesser extent linalool and benzyl alcohol as codling moth attractants. The invention provides compositions comprising said repellent and attractants and methods for control of codling moth in fruit, preferably apple, orchards.
Owner:YISSUM RES DEV CO OF THE HEBREWUNIVERSITY OF JERUSALEM LTD +1

A kind of sex attractant and lure core

The invention relates to the technical field of insect lures, in particular to a sex lure and a lure core for the small-horned wood beetle moth. The sex lure of the small horn beetle moth includes the active ingredient of the sex attractant, and the active ingredient of the sex attractant includes cis-3-tetradecenyl acetate, trans-3-tetradecenyl acetic acid esters and cis-5-dodecenyl acetate. The sexual attractant for T. chinensis provided by the present invention is beneficial to the protection of T. sclerosus no matter whether it is used for insect situation forecasting, direct hunting by trapping method, or interfering mating method to prevent and control T. The natural enemies of moths, benefit and eliminate pests, give full play to the power of preventing and controlling wood beetle moths, improve the effect of preventing and controlling wood beetle moths, and can also avoid the use of chemical pesticides, reduce pollution, protect the environment, and its social benefits and Significant ecological benefits.
Owner:BEIJING FORESTRY UNIVERSITY +1

A special feed for artificial breeding of coffee wood beetle larvae and artificial breeding method thereof

ActiveCN109198308BImprove feeding effectGood for feeding larvaeFodderBiotechnologyBenzoic acid
The invention discloses a special feed for artificial feeding of coffee wood beetle larvae and an artificial feeding method thereof. The feed is composed of the following components: 50 g of hickory sawdust, 0-30 g of soybean powder, and 0-30 g of corn flour , agar powder 5.0g, yeast extract 0~2.0g, acetylcholine chloride 0.2g, cholesterol 0~0.3g, ascorbic acid 0~0.5g, glucose 0~2.5g, riboflavin 0~0.4g, casein 0~ 0.4g, 0-0.8g sorbic acid, 0-0.6g methyl p-hydroxybenzoate, 100mL distilled water, wherein 0g is different for soybean flour and corn flour. The pupation rate of coffee wood beetle larvae fed with feed B in the present invention is 73.3%, and the eclosion rate is 66.7%. It can be seen that feed B is a special feed suitable for the growth and development of larvae. The rearing experiment proved that feeding larvae with Feed B was the best at 24°C and in the dark, and putting the pupae under the condition of L:D=12:12 could shorten the pupae period.
Owner:NANJING FORESTRY UNIV

Insecticidal composition containing indoxacarb and cycloxaprid

The invention relates to the pesticide field, and specifically discloses an insecticidal composition containing indoxacarb and cycloxaprid; indoxacarb and cycloxaprid are used as effective components, and the insecticidal composition has an optional dosage form of one of a suspending agent, a microemulsion, an aqueous emulsion, missible oil, a wettable powder and granules. The insecticidal composition is used for prevention and control of beet armyworm, plutella xylostella, cabbage caterpillar, spodoptera litura, cabbage moth, cotton bollworm, oriental tobacco budworm, leaf roller moth, codling moth, leafhoppers, earias, colorado potato beetle and other injurious insects in wild cabbage, broccoli and other crops, has high efficiency on all rice brown planthopper, whitebacked planthopper and small brown planthopper, has good control effect on cabbage aphids and cucumber aphids, also has better assistant prevention effect on rice leaf folder, has the characteristics of high efficiency, low toxicity, low residues, wide insecticidal spectrum, significant synergy, use cost reduction and the like, particularly high efficiency, low toxicity and low residues, and is especially beneficial for production of green foods.
Owner:JINGBO AGROCHEM TECH CO LTD

Artificial feed for codling moth and preparation method thereof

The invention relates to an artificial feed for codling moths and a preparation method of the artificial feed, and belongs to the technical field of insect feeding, wherein the artificial feed for codling moths is characterized by being prepared from the following components in percent by weight: 2-10 percent of bean pulp, 6-10 percent of whole meal, 1-3 percent of saccharose, 2-5 percent of yeast, 4-8 percent of wheat germ, 1-2 percent of agar, 0-0.5 percent of a sour agent, 68-80 percent of water, 0.3-0.6 percent of ascorbic acid, 0.1-0.5 percent of preservative and 1.5-3 percent of ethyl alcohol. The codling moths fed by using the feed provided by the invention can develop well, and can be continuously fed; an insect source guarantee is provided for indoor research and a technical support is provided for large-scale feeding.
Owner:NORTHWEST A & F UNIV

A PCR primer for identifying codling moth cell lines and its identification method

The invention provides a PCR primer for identifying codling moth cell lines and an identification method thereof. The PCR primer pair for amplifying the mitochondrial COI gene fragments of codling moth and several other insect cell lines in the present invention has a forward primer sequence of SEQ ID NO: 1 and a reverse primer sequence of SEQ ID NO: 2. The optimized forward primer sequence is SEQ ID NO:3, and the reverse primer sequence is SEQ ID NO:4. The invention also provides a method for identifying the codling moth cell line. The present invention explores the differences in the mitochondrial COI gene fragment sequences between the codling moth cell line and several other insect cell lines from the molecular level, and establishes the identification of the codling moth cell line from the black beetle, beet armyworm, and Trichoplusia spp. method.
Owner:QINGDAO AGRI UNIV

Synthesis method of cis-7-tetradecenol acetate, the main component of sex pheromone of Ulmus beetle moth

The invention discloses a method for synthesizing cis-7- tetradecenol acetate which is a main component of sex pheromone of holcocerus vicarius walker. The method includes (1), preparing (7-bromo-heptyl-1-)-2-tetrahydropyran ether; (2), preparing (7-bromo-heptyl-1-)-2-tetrahydropyran ether phosphonium; (3), preparing cis-7-tetradecenol tetrahydropyran ether; (4), preparing cis-7-tetradecenol; and (5), preparing the cis-7-tetradecenol acetate. The method for synthesizing the cis-7-tetradecenol acetate which is the main component of sex pheromone of holcocerus vicarius walker has the advantages that raw materials are easily available, the method is easy and convenient to implement, low in cost, high in product yield, free of risks and applicable to large-scale production, solvents are common solvents, technological processes are short, synthesis reaction conditions are mild, and products are easy to separate; contents of artificially synthesized sex pheromone can be enriched, basic chemical compounds can be provided for insect pest condition monitoring, mass trapping, mating disruption and the like on the holcocerus vicarius walker by the aid of the sex pheromone, and accordingly the method is obvious in ecological benefits and economical benefits.
Owner:SHANXI AGRI UNIV

Fluorescent PCR detection method and application of pear borer

The invention discloses an oriental fruit moth fluorescence PCR (Polymerase Chain Reaction) detection method. The oriental fruit moth fluorescence PCR detection method comprises the following steps of (1) extracting DNA (Deoxyribose Nucleic Acid) of a to-be-authenticated sample genome; (2) arranging a real-time fluorescence quantification PCR amplification system and performing real-time fluorescence PCR detection through a specific primer and a probe with the DNA of the genome serving as an amplification template; (3) analyzing and judging an amplification result. The probe is 5'-(FAM) CGAAATCTTAATACTTCATTTTTTGACCCTG (TAMRA)-3'. THE oriental fruit moth fluorescence PCR detection method can effectively district an oriental fruit moth from fruit boring pests (comprising the oriental fruit moth, codling moth, euzophera pyriella yang and the like).
Owner:中华人民共和国库尔勒出入境检验检疫局

Metathesis synthesis of pheromones or their components

The present invention relates to metathesis syntheses for insect sex-attractant pheromones or their components, such as E-5-decenyl acetate, the major component of the Peach Twig Borer pheromone; (5R, 6S)-6-acetoxy-5-hexadecanolide, the mosquito oviposition attractant pheromone; E9, Z11-hexadecadienal, the pecan nut casebearer moth pheromone; 9-tetradecenyl formate, an analog of the Diamondback Moth (DBM) pheromone; 11-tetradecenyl acetate, the Omnivorous Leafroller (OLR) pheromone; E-4-tridecenyl acetate, the major component of the Tomato Pinworm (TPW) pheromone; E,E-8,10-dodecadienol, the Codling Moth (CM) pheromone. The syntheses preferably employ a Class I-IV metathesis catalyst, entail few reaction steps, use generally commercially available starting materials, and have relatively short process times. These syntheses produce good yields without the need for expensive or sophisticated equipment. The invention also provides an inexpensive route for producing omega-haloalkenols by cross-metathesizing alpha-omega-diacetoxy alkenes and alpha-omega-dihalides to yield omega-haloalkenols, which are easily converted into omega-haloalkanols under traditional hydrogenation methods.
Owner:R·L·佩德森 +1

Ginkgo derived compositions and their use to prevent fruit infestation by codling moth

Codling moth, Cydia pomonella, (L.), is a cosmopolitan pest of the apple, potentially causing damage to circa 80% of the fruit. Disclosed here are use of extract of Ginkgo biloba, or its synthetic metabolites for preventing or treating apple feeding and infestation by neonate larvae of codling moth.
Owner:MISSOURI STATE UNIVERSITY

Botanical volatile composition, lure and application for trapping codling moth

ActiveCN111567521BSolved the problem of only trapping malesGood effectBiocidePest attractantsBiotechnologyInsect pest
The invention relates to the field of plant pest control, in particular to lures and applications of botanical volatile composition compositions for trapping codling moths. The composition includes plant volatiles farnesene and pearate. The invention provides a lure containing a combination of two kinds of plant source volatiles, which solves the problem that the traditional sex pheromone lure can only trap males, and has a synergistic effect on the overwintering and first-generation adults.
Owner:INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI

Insecticidal composition containing indoxacarb and cycolxylidin

The invention relates to the field of pesticides, and specifically discloses an insecticidal composition containing indoxacarb and huanyangchonglin. The effective components are indoxacarb and huanyangchonglin. The insecticidal composition can be made into one of the following dosage forms: suspending agent, micro-emulsion, emulsion in water, missible oil, wettable powder, and granule. The insecticidal composition is used to control multiple insects in crops (cabbage, broccoli, etc.) such as asparagus caterpillar, plutella xylostella, cabbage caterpillar, prodenia litura, cabbage moth, cotton bollworm, helicoverpa assulta, tortricid, codling moth, leafhopper, earias cupreoviridis, potato beetle, and also has a good effect on controlling aphis citricola, nilaparvata legen, and cotton aphid. The insecticidal composition has the characteristics of high efficiency, low toxicity, low residue, wide insecticidal spectrum, and prominent synergistic effect, reduces the using cost, and is very suitable for the production of green food due to the characteristics of high efficiency, low toxicity, and low residue.
Owner:JINGBO AGROCHEM TECH CO LTD

Prevention and treatment method for codling moths in Xinjiang region

The invention provides a prevention and treatment method for codling moths in the Xinjiang region, and belongs to the technical field of insect prevention and treatment. According to the prevention and treatment method for the codling moths in the Xinjiang region, by researching biological characteristics of the codling moths, the occurrence rule and harm characteristics of the codling moths in the forest fruit producing area of Xinjiang are basically found out, the prevention and treatment method for the codling moths in the Xinjiang region is provided by combining field prevention and treatment practical experience summary. Artificial prevention and treatment, physical prevention and treatment, biological prevention and treatment and chemical prevention and treatment are carried out according to the occurrence rule and the biological characteristics of the codling moths in the Xinjiang region. According to the prevention and treatment method for the codling moths in the Xinjiang region, through comprehensive prevention and control measures, the codling moths in the Xinjiang region can be effectively prevented and treated, harm of the codling moths to the forest and fruit industry in the Xinjiang region is relieved, and a good foundation is laid for scientific prevention and treatment of the codling moths in the future.
Owner:FOREST ECOLOGICAL RES INST XINJIANG ACADEMY OF FORESTRY

Botanical volatile matter composition for trapping codling moths, lure and application

ActiveCN111567521ASolved the problem of only trapping malesTroubleshooting femaleBiocidePest attractantsInsect pestPlant Sources
The invention relates to the field of plant pest control, in particular to a botanical volatile matter composition, for trapping codling moths, a lure and application. The composition comprises plantvolatile matter farnesene and pear ester. The invention provides the lure containing two plant source volatile matter combinations; the problem that a traditional sex pheromone lure can only trap maleinsects is solved, and the lure has a synergistic effect on overwintering-generation and first-generation and second-generation adults.
Owner:INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI

Insecticide composition containing spirotetramat and methoxyfenozide

The invention relates to an insecticide composition containing spirotetramat and methoxyfenozide, wherein the active ingredients include spirotetramat and methoxyfenozide in binary compounding, and the rest is auxiliary ingredients. The mass ratio of spirotetramat to methoxyfenozide is (10-50):(40-5); and total mass of the active ingredients including spirotetramat and methoxyfenozide in the preparation accounts for 1-80% of the total mass of the whole preparation. The insecticide composition provided by the invention can be prepared into pesticide formulations including missible oil, suspension, wettable powder, water dispersion granules, emulsion in water and microemulsion, can effectively prevent and control various piercing-sucking mouthpart pests such as aphids, thrips, phylloxera, mealybug, aleyrodid, scale insects and the like, and also realizes a good effect on preventing and controlling rice-stem borer, codling moth, spodoptera exigua and prodenia litura.
Owner:HAILIR PESTICIDES & CHEM GRP