25 results about "Neonicotinoid insecticide" patented technology

The invention discloses a neonicotinoid insecticide degrading strain B27 and application thereof, the neonicotinoid insecticide degrading strain B27 is identified as Flexivirga sp. And is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC NO: M 2022981. According to the invention, a new strain Flexivirga sp.B27 is separated and screened from soil in which earthworms move, and can be used for degrading neonicotinoid insecticides such as imidacloprid, acetamiprid and nitenpyram; the degrading bacterium B27 disclosed by the invention can be used for degrading residual neonicotinoid insecticides in soil or a water body environment, so that the problem of pollution residues of the neonicotinoid insecticides to the soil or the water body environment is solved, and new resources of the degrading bacterium of the Flexivirga neonicotinoid insecticides are enriched.

The invention discloses an insecticidal synergistic composition containing tea saponin and application thereof, and belongs to the technical field of pest control. The insecticidal synergistic composition comprises tea saponin and an insecticidal active component, the insecticidal active component comprises but is not limited to one of neonicotinoid insecticides, sulfoxaflor or spinetoram, and the weight ratio of the tea saponin to the insecticidal active component is (1: 1)-(50: 1). The invention discloses an insecticidal synergistic composition containing tea saponin and application of the insecticidal synergistic composition. The insecticidal synergistic composition can be used for effectively preventing and treating plant diseases and insect pests, improving the insecticidal effect and effectively delaying the resistance accumulation of cotton aphids and Frankliniella occidentalis on imidacloprid, sulfoxaflor and spinetoram.

The invention relates to the technical field of insecticides, in particular to an insecticide composition and a preparation method and application thereof.The insecticide composition is prepared from, by weight, 5-25 parts of neonicotinoid insecticides, 2-15 parts of 4-trifluoromethyl nicotinamide, 2-5 parts of microbial insecticides, 2-20 parts of botanical insecticides and 2-10 parts of sulfonated modified graphene nano powder. 5-15 parts of silicon dioxide-titanium oxide composite powder particles; the microbial insecticide is prepared from bacillus thuringiensis and metarhizium anisopliae; the botanical insecticide is prepared from azadirachtin, veratrine and celastrus angulatus. By matching and combining the raw materials, the prepared insecticide composition can improve the insecticidal effect while reducing the use of neonicotinoid insecticides, and reduces the influence on the farmland environment.

The invention relates to a pesticide preparation for preventing and treating aphids on apple trees, which is prepared from neonicotinoid insecticides, pyrethroid insecticides, cosolvents, synergists, nano silicon dioxide dispersing agents, organic silicon surfactants, sodium lignin sulfonate, penetrating agents JFC, xanthan gum and deionized water. A nano silicon dioxide dispersing agent is sprayed on apple leaves to construct a micro-rough surface, the contact area of the liquid medicine and the apple leaves is increased, the sprayed liquid medicine is prevented from rapidly sliding off from the apple leaves, the adhesion of the liquid medicine to the apple leaves is enhanced, meanwhile, an organic silicon surfactant can reduce the surface tension value of the liquid medicine, and the effect of preventing the liquid medicine from falling off is achieved. The problem that the aphid control effect is affected due to the poor attachment effect after the traditional pesticide is sprayed is avoided as far as possible.

The invention belongs to the technical field of analysis detection and electrochemistry, and particularly relates to a preparation method of an electrochemical sensor based on monatomic Pt and application of the electrochemical sensor to detection of neonicotinoid pesticides. Glucose is used as a carbon source, chloroplatinic acid is used as a metal precursor, a rapid pyrolysis method is adopted to controllably synthesize GFs-loaded monatomic Pt, agglomeration of monatomic is avoided, and the prepared sensor shows good repeatability, reproducibility and stability, can be used for sensitive detection of CLO in fruit and vegetable samples, and has good application prospects. A novel method is provided for detecting the neonicotinoid insecticides in food.

A termiticide concentrate comprising a termiticide composition comprising a phenylpyrazole, such as tipronil and a neonicotinoid, such as imidacloprid, wherein the composition is dispersed in an aqueous medium to form the termiticide concentrate. The concentrate containing the combination of active termiticides provides an increased efficacy not exhibited by either active when used alone.

The application discloses a preparation method and application of a two-stage heat-treated rice hull biochar adsorbent, relates to the field of environmental functional materials and water pollution control technology, and comprises the following steps: preparing a biochar matrix by pyrolyzing rice hull under a nitrogen atmosphere, contacting the biochar matrix with a metal salt aqueous solution to realize metal ion loading, and finally preparing the adsorbent through a two-stage heat treatment process of "oxygen-containing atmosphere heating-inert atmosphere constant temperature". The specific surface area of the prepared adsorbent is significantly improved, the surface oxygen-containing functional groups are rich, the carbon skeleton structure is stable, and the adsorbent has excellent adsorption performance on organic pollutants such as neonicotinoid insecticides and phenolic compounds in water. The preparation method has the advantages of simple process, controllable conditions, low cost, environmental friendliness, easy scale production, wide application in industrial and agricultural wastewater treatment, drinking water deep purification and emergency water pollution treatment and the like, and important practical value and industrialization potential.

The invention discloses a prediction method for neonicotinoid insecticide pollution of a surface water body in a drainage basin based on a sub-drainage basin and a machine learning model, and belongs to the field of surface water pollution prediction. Comprising the following steps: step 1, determining a sub-basin range, and taking a coordinate range of each sub-basin as an identity ID of the sub-basin; step 2, data acquisition and preprocessing; 3, establishing a data set, constructing a machine learning model, and adjusting and optimizing the model; 4, predicting the pollution of neonicotinoid insecticides to the surface water in the sub-drainage basins; and step 5, result visualization. According to the method, synchronous, rapid and accurate prediction of multiple sub-basins under the national scale is realized, and a brand new method reference is provided for forecasting and monitoring in the field of surface water body neonicotinoid insecticide pollution; meanwhile, six common neonicotinoid insecticides are integrated, so that synchronous prediction of multiple pollutants by one model is realized; and social and economic factors are supplemented, and pollution influence factors are comprehensively captured.

The invention discloses a sulfur-doped carbon-based confinement composite material as well as a preparation method and application thereof, and belongs to the technical field of sewage treatment. The preparation method comprises the following steps: jointly dispersing biochar, soluble copper salt, soluble iron salt and sodium sulfate into water to obtain a mixed solution A; adjusting the pH value of the mixed solution to 4.8-5.2 by using a pH regulator and a pH buffer agent to obtain a mixed solution B; performing hydrothermal reaction on the mixed solution B, and then filtering, washing, drying and calcining to obtain the sulfur-doped carbon-based confinement composite material. The prepared sulfur-doped carbon-based confinement composite material is low in price, stable in structure and high in catalytic activity. When the catalyst is used for activating persulfate, the decomposition reaction of the persulfate can be accelerated through a free radical and non-free radical synergistic path. When a catalytic oxidation system formed by the catalyst and persulfate is used for degrading the neonicotinoid insecticides in water, the degradation efficiency is high, and the catalyst has a broad-spectrum degradation effect on various neonicotinoid insecticides such as thiamethoxam and clothianidin.

The application discloses a magnesium-doped cobalt-nitrogen co-modified biochar composite material and a preparation method and application thereof, and belongs to the technical field of sewage treatment. The preparation method comprises the following steps: pyrolyzing agricultural waste under an inert atmosphere to obtain biochar; and through an impregnation-pyrolysis process, soluble cobalt salt, magnesium salt and a nitrogen source are combined with the biochar to obtain the magnesium-doped cobalt-nitrogen co-modified biochar composite material. According to the application, the electronic structure of cobalt is regulated through magnesium doping, and a stable Co-N x and Mg-O-Co interface is formed by combining nitrogen coordination, so that the activation capacity of the composite material on peroxymonosulfate is enhanced. When the material activates peroxymonosulfate, thiamethoxam is efficiently degraded through a free radical and non-free radical synergistic path, and the material has the advantages of low metal ion leaching rate, wide pH adaptation range, strong anti-interference capacity and the like, and exhibits excellent degradation performance on neonicotinoid insecticides such as thiamethoxam in a complex water environment.

This invention discloses a method for controlling potato scab, relating to the field of crop cultivation methods. The method includes: Step S1, preparing a coating agent: mixing a first active ingredient and a second active ingredient, wherein the first active ingredient is selected from neonicotinoid insecticides or macrolide insecticides, and the second active ingredient is selected from at least one of methoxyacrylates, organosulfur compounds, or inorganic copper fungicides; Step S2, seed potato coating treatment: mixing the coating composition with potato seed potatoes to ensure the composition is uniformly adhered to the seed potato surface; Step S3, sowing. This invention, through the synergistic combination of insecticides and fungicides, controls pathogens and pests at the source, combining growth-stage control and soil treatment to construct a comprehensive, multi-effect control method, improving control efficacy, reducing pesticide usage, and achieving highly efficient control of potato scab.

The invention discloses two typical neonicotinoid insecticide aptamers, dinotefuran and nitenpyram are respectively taken as targets, graphene oxide is adopted to adsorb ssDNA sequences which are not combined with the targets, and the dinotefuran and nitenpyram aptamers are obtained through screening. The sequence of the dinotefuran aptamer is CGCAAGTGTTGGCCC-AGGTCGACGCATGCGCCG, and the dissociation constant of the dinotefuran aptamer to the dinotefuran is 48.03 nM. The dinotefuran aptamer can be used for preparing the dinotefuran. The sequence of the aptamer of the nitenpyram is TAGGGAATTCGTCGACGGATCCGCTGGGTGTACGACGTCCCTA, and the dissociation constant of the aptamer of the nitenpyram to the nitenpyram is 25.20 nM. Specific analysis finds that the two aptamers obtained through screening only have a recognition effect on dinotefuran and nitenpyram and do not have affinity to other insecticides. Molecular docking results show that the aptamer is mainly combined with dinotefuran and nitenpyram through hydrogen bonds and hydrophobic interaction. According to the aptamer screening method, the target does not need to be specified, the affinity of the aptamer obtained through screening to the target is improved through combination of positive screening and negative screening, and a new recognition element is provided for construction of a dinotefuran and nitenpyram detection method.

The present application belongs to the technical field of pesticide insecticide and fungicide, and discloses a kind of pesticide composition and its use, the pesticide composition includes active ingredient A, active ingredient B and active ingredient C, the active ingredient A is propiconazole, the active ingredient B is fluazinam, and the active ingredient C is a new nicotine insecticide.The pesticide composition of the present application can simultaneously prevent and treat plant diseases and insect pests, the action mechanism of each active ingredient is different, and after compounding, obvious synergistic effect is played, the persistence of the pesticide can be prolonged, the resistance of pathogenic bacteria and pests is delayed, and the crop is safe and friendly to the environment.

The application discloses application of insect adult cytochrome b5 in pest control and belongs to the field of plant protection. Through a molecular cloning technique, the application successfully obtains full-length sequences of two Cyt b5 genes Cyt b5v1 and Cyt b5v2, and confirms that the two genes are in a high expression state in a whitefly resistant population. Double-stranded RNAs, namely dsCyt b5v1 and dsCyt b5v2, are synthesized by using an RNA interference (RNAi) technique, and after feeding treatment, the expression of target genes is significantly inhibited, and the sensitivity of the whitefly to different neonicotinoid insecticides is effectively improved. The application has the core advantages of low toxicity, high efficiency and high safety while realizing high insecticidal activity, and provides important technical support for a green pest control system in a field.

The present invention discloses a compound synergistic insecticide composition and its application. The composition contains two active components, A and B, with the mass ratio of components A to B being (1-5):(5-20). Active component A is selected from compounds represented by formulas a, b, and c; component B is selected from organophosphorus insecticides, pyrethroid insecticides, and neonicotinoid insecticides. The compound synergistic insecticide composition of the present invention has excellent synergistic effects, a simple preparation process, and low cost. It can be used to reduce the amount of chemical insecticides and increase their efficacy, as well as for the green control of aphids. #imgabs0#

The invention provides a transition metal doped zinc-based phosphide, a preparation method thereof and application of the transition metal doped zinc-based phosphide in an electrochemical sensor. Transition metal (M) doped ZnxPy is prepared by mainly utilizing a Kirkendall effect, and organophosphorus is used as a phosphorus source and a carbon source to control the structural form and promote the formation of an MZnP2 phase in MZnP2 / C doped microspheres, so that the transition metal doped zinc-based phosphide MZnP2 / C is prepared by adjusting electronic structures and bonding states of surrounding P, M and Zn atoms. The MZnP2 / C has large electrode surface area and conductivity, and can increase electrochemical signals to neonicotinoid insecticides as an electrocatalyst. The content of a detected target object is electrochemically reflected by utilizing the gain and loss of electrons on nitrite generated by the neonicotinoid insecticide in a buffer solution with the pH value of 4-7, and a signal-increased electrochemical sensor for on-site detection of the neonicotinoid insecticide is obtained. The method can provide a detection basis for food safety risk monitoring.

The application discloses a binary health insecticidal composition containing cycloprothrin and application thereof, effective components are cycloprothin and neonicotinoid insecticides; the total content of the cycloprothin and the neonicotinoid insecticides is 2% to 80%; and the weight ratio of the cycloprothin to the neonicotinoid insecticides is 10:1 to 1:20. The fly-killing composition adopts the effective components with two different action mechanisms, is mixed in a suitable ratio, and has obvious synergistic effect compared with single agents, can effectively control pests, delays the occurrence of drug resistance, and the addition of the attracting composition is innovative.

The application discloses a phosphorus-doped copper-cobalt layered double hydroxide-biochar composite material and a preparation method and application thereof, and belongs to the technical field of sewage treatment. The preparation method comprises the following steps: pyrolyzing agricultural waste to obtain biochar; dispersing the biochar, soluble copper salt, soluble cobalt salt, urea and a phosphorus source, i.e., disodium hydrogen phosphate, in water, and preparing a composite material through ultrasonic treatment, hydrothermal reaction and freeze-drying. The composite material prepared by the application builds a stable phosphorus-oxygen-metal interface through phosphorus doping, optimizes the electrical conductivity and pore structure of the biochar, realizes targeted adsorption of pollutants through the pi-pi conjugation and electrostatic interaction between the biochar and neonicotinoid insecticides, and efficiently activates persulfate through a free radical and non-free radical synergistic path. The composite material has the advantages of stable structure, low metal leaching amount and strong anti-interference capability, has a broad-spectrum degradation effect on various neonicotinoid insecticides such as imidacloprid and thiamethoxam, and is suitable for the treatment of neonicotinoid insecticides in complex water environments.

The invention belongs to the technical field of pesticides, and particularly relates to application of an insecticide composition containing cyprosulfuron to prevention and treatment of aphids. The insecticide composition comprises the cyprosulfuron and the neonicotinoid insecticide, the mass ratio of the cyprosulfuron to the neonicotinoid insecticide is (1: 5)-(5: 1), and the neonicotinoid insecticide is imidacloprid and / or acetamiprid. According to the insecticide composition, through synergistic interaction in the aphid prevention and control process, the chemical aphid prevention and control effect can be improved while the use amount of the insecticide is reduced, and a novel, efficient and environment-friendly solution is provided for prevention and control of agricultural insects including aphids.

This invention discloses an ELISA method and its application based on liposome nanovesicles, belonging to the field of biotechnology. The invention prepares HRP-coated and biotinylated liposome nanovesicles using phospholipids, sterol derivatives, and biotinylated polyethylene glycol phospholipids as raw materials. These nanovesicles are highly sensitive to acidic environments of pH 3-6, specifically recognizing streptavidin. Under acidic conditions, they cleave to release HRP and catalyze substrate color development. Using these nanovesicles as tracers, an ELISA is established based on the principle of antigen-antibody competitive binding to achieve the detection of thiamethoxam residues, a neonicotinoid insecticide. The method of this invention has a detection limit as low as 0.24 µg / L for thiamethoxam, exhibiting high sensitivity, simple operation, economy, speed, and high-throughput screening capabilities. It is suitable for the detection of thiamethoxam residues in agricultural products, soil, and water bodies, solving the technical problem of low sensitivity in traditional ELISA methods.

A method for analyzing the source of neonicotinoid insecticides in sediments, a storage medium and a device. The method comprises: calculating the statistical distribution characteristics of each crop type soil sample in the source sample set on each fingerprint index; and obtaining the observed value of each sediment sample in the receptor sample set on each fingerprint index; for each sediment sample, inputting the observed value and the statistical distribution characteristics of each crop type soil sample into a Bayesian mixture model to generate the posterior probability distribution of the sediment contribution rate of each crop type to the sediment sample, and performing convergence diagnosis on the Markov chain Monte Carlo sampling process of each sediment sample; when the diagnosis result meets the convergence standard, extracting the posterior statistics of the sediment contribution rate of each crop type from the posterior probability distribution; calculating the contribution proportion of each crop type to the neonicotinoid insecticide in each sediment sample to obtain the source of the neonicotinoid insecticide in each sediment sample, and improve the accuracy of source positioning.

The invention discloses application of adult insect cytochrome b5 in pest control, and belongs to the field of plant protection. According to the invention, the full-length sequences of the Cyt b5v1 and Cyt b5v2 of the two genes Cyt b5 are successfully obtained through a molecular cloning technology, and the high expression state of the two genes Cyt b5v1 and Cyt b5v2 in a bemisia tabaci resistance population is proved. Double-stranded RNA (Ribonucleic Acid), namely dsCyt b5v1 and dsCyt b5v2, is synthesized by utilizing an RNA interference (RNAi) technology, and after feeding treatment, the expression of a target gene is remarkably inhibited, and the sensitivity of bemisia tabaci to different neonicotinoid insecticides is effectively improved. According to the present invention, the efficient insecticidal activity is achieved, the ecological environment safety is considered, the core advantages of low toxicity, high efficiency, high safety and the like are provided, and the important technical support is provided for the green prevention and control system of the field pests.

The invention belongs to the technical field of pesticide disinfestation and sterilization, and discloses a pesticide composition containing pydiflumetofen and metalaxyl-M and application thereof.The pesticide composition comprises an active ingredient A, an active ingredient B and an active ingredient C. The active ingredient A is pydiflumetofen, the active ingredient B is metalaxyl-M, and the active ingredient C is a mixture of pydiflumetofen and metalaxyl-M. The active ingredient A is an active ingredient B, the active ingredient C is a neonicotinoid insecticide, the neonicotinoid insecticide is any one of clothianidin, thiamethoxam, imidacloprid, dinotefuran and thiacloprid, and the mass ratio of the active ingredient A to the active ingredient B to the active ingredient C is (0.05-1): (0.05-1): (1-15). The pesticide composition disclosed by the invention effectively prevents and controls soil insects such as grubs while effectively preventing and controlling seed-borne and soil-borne diseases, realizes multi-prevention by one pesticide, reduces the pesticide application frequency, and reduces the agricultural production cost.

The application discloses a kind of based on sub-basin and machine learning model's prediction method of new neonicotinoid insecticide pollution in watershed surface water body, belong to surface water pollution prediction field;Including the following steps, step one, determine the scope of sub-basin, the coordinate range of each sub-basin is regarded as its identity mark ID;Step two, data acquisition and pretreatment;Step three, establish data set, construct machine learning model and model tuning;Step four, realize the prediction of sub-basin surface water neonicotinoid insecticide pollution;Step five, the visualization of result.The method of the application realizes the synchronous fast and accurate prediction of multiple sub-basins under national scale, provides a new method reference for the forecast monitoring of the field of surface water neonicotinoid insecticide pollution;Meanwhile, integrate six common neonicotinoid insecticides, realize the synchronous prediction of a model to multiple pollutants;Supplement social and economic factors, fully capture pollution influencing factors.

The invention discloses a rapid visual molecular detection method for drug resistance of cotton aphids to neonicotinoid insecticides based on a loop-mediated isothermal amplification (LAMP) technology, and belongs to the technical field of drug resistance detection. The detection method comprises the following steps: respectively designing two pairs of specific primers (outer primers and inner primers) aiming at target variation sites of cotton aphid nicotinic acetylcholine receptor (nAChR) beta1 subunit V62I / R61T, carrying out LAMP (Loop-Mediated Isothermal Amplification) on resistance target variation of neonicotinoid insecticides, adding a color developing agent after the reaction is finished, and judging R81T or V62I mutation of the cotton aphid nAChR beta1 subunit according to the color of a reaction product, and judging whether the cotton aphid individuals are resistant cotton aphid individuals of neonicotinoid insecticides. The method is characterized by comprising the following steps: extracting genome DNA (Deoxyribose Nucleic Acid) of single cotton aphid; a specific primer to be used; an LAMP reaction system; an LAMP reaction procedure; and detecting the color of an amplification product. The method is high in stability, short in period, high in sensitivity and simple to operate, reduces dependence on expensive instruments, is suitable for rapidly detecting the drug resistance of the cotton aphid to the neonicotinoid insecticides under field conditions, and provides an effective means for monitoring and early warning of the drug resistance of the cotton aphid.