113 results about "Virus identification" patented technology

The embodiment of the invention provides a dynamic unshelling method, a dynamic unshelling device and dynamic unshelling equipment, and relates to the field of computers. The method comprises the following steps: calling, in a reflecting manner, an installation package having a name which is the same as or different from that of a host application program to serve as a host application program supplementary resource to load a target application program implemented by the installation package; calling a monitoring module by the host application program to monitor the activity of the target application program; when the target application program is monitored to call a function loaded with a dex file, hooking the function loaded with the dex file to acquire dex file information; repairing the dex file according to the dex file information. According to the dynamic unshelling method, the problem that viruses are hard to identify as the dex file which is hidden is difficult to analyze after an application with the viruses is shelled is solved; the shelled application can be unshelled under the condition of no Root, so that the hidden dex file can be reduced, and an operable condition can be provided for virus identification.

An embodiment of the invention discloses a method, a device and a cloud server for detesting viruses, relates to the technical field of communication, and solves problems that scanning engines are single, and the virus identification efficiency and the accuracy are low of antivirus software. The method comprises receiving virus detection request messages sent by a terminal, wherein the virus detection request messages include virus identification information of files to be detected and source information of the virus identification information; selecting a first virus scanning engine and a second virus scanning engine; obtaining sample files corresponding to the virus identification information from a sample file library; scanning the sample files by the first virus scanning engine and the second virus scanning engine; obtaining scanning results of the first virus scanning engine and the second virus scanning engine, analyzing obtained scanning results according to a preset virus detection result norm mode and determining virus detection results of the files to be detected; and sending the virus detection results of the files to be detected according to the source information. The method, the device and the cloud server for detesting viruses can be applied in computer safety protection.

The invention discloses a specification method of harmful program based on the virus attack identification base of state movement set, which comprises the following steps: 1.1) monitoring and recording the movement behavior of unknown program; 1.2) integrating the recorded program to compare with the virus identification regular base; 1.3) judging the compared result whether the result is harmful program behavior; alarming or stopping the operation of program if yes; continuing operating and returning to the step 1.1) if not. The invention analyses the unknown program behavior without depending virus code, which improves the efficiency and precision.

The invention provides a real-time fluorescence RT-PCR detection method and a kit for a novel coronavirus 2019-nCoV. Specifically, the invention discloses a kit and a method for detecting the nucleicacid of an E gene of the novel coronavirus 2019-nCoV. The kit and the method have extremely high sensitivity and specificity, and can remarkably improve the accuracy of virus identification.

The invention discloses a virus identification method comprising the following steps: obtaining RNA sequencing data of a to-be-tested sample; assembling the first portion of the sequencing data so as to obtain assemble sequences; comparing the first portion of the sequencing data with the assemble sequences so as to obtain a comparison result; determining mutation sites on the assemble sequences according to the comparison result, and determining at least one of the following assemble sequences a-c: a, at least one from the group formed by average entropy and median entropy, and mutation site proportion; b, at least one from the group formed by the average mutation rate and median mutation rate, and the mutation site proportion; c, mutation site proportion; comparing at least one from the assemble sequences a-c with the corresponding boundary, and determining the assemble sequence falling into the boundary to be from virus. The invention also discloses a virus identification device; the virus identification method and / or device can accurately predict whether an unknown sequence is a virus sequence or not without depending on the homologous sequence alignment.

The invention discloses a detoxification, tissue culture and rapid propagation method of common turmeric, which comprises the explant selection and treatment, induction culture, the virus identification of plant regeneration, proliferation culture, transplanting and other steps. In the invention, on the basis of the MS culture medium, the plant growth regulators such as 6-benzyladenine, kinetin, Alpha-banai acid, adenine sulphate are added for the induction culture of common turmeric apical meristem and the proliferation and rooting of multiple shoot two key stages. With the adoption of the packaged technology and method provided in the invention for the tissue culture and rapid propagation of common turmeric, the difficult problems of common turmeric such as virus accumulation, declining quality and yield reduction caused by propagation coefficient and technical stability are met. Therefore, the invention can provide a seedling-raising method with short cycle, high rate of reproduction, low-cost for the factory production of common turmeric.

A method and apparatus for identifying computer virus variants are disclosed to improve the accuracy of virus identification and removal, and may relate to the field of internet technology. The method includes running a virus sample to be tested and recording an API call sequence produced during running of the virus sample. The method further includes obtaining a characteristic API call sequence for each one of a plurality of virus families, matching the API call sequence produced during running of the virus sample to be tested with the characteristic API call sequences of the virus families, and obtaining a matching result. The method also includes determining the virus sample to be tested is a virus variant by extent of a match between the API call sequence produced by the virus sample and any characteristic API call sequence of any one of the virus families.

The invention fulfills reconstruction and design on a network creeper based on local servers on the background of traditional search engines, so as to perform partition on the network creeper into a network creeper client end and a network creeper service end. The service end is installed in the local server on the search engine and has the same function with creeping-decomposed web pages in the traditional network creeper; however, the invention increases a virus identification function, so that only safe web pages can be saved into local databases. The client end is bound to install on a key node in an agency server that a web content supplier or a user uses to accesses Internet, so as to find updates on web page URLs and contents in time, and meanwhile, automatically send the updated URLs to the service end through an information system. The invention has the following beneficial technical effects: The invention can more effectively improve the quality of updating and safety of web pages in local databases in search engines, so as to avoid dead link, link loss as well as being infected by virus web pages with virus while a user is searching the web pages with the search engine, so as to resolve the shortcomings in prior network creepers.

Provided is a method of identifying a target cell using a virus. The method includes infecting the target cell with the virus by contacting the virus to the target cell and culturing the target cell to propagate the virus; adding a chromogenic substrate to the resultant cell culture to induce enzyme reaction converting the chromogenic substrate to a chromogenic product; and measuring an optical signal emitted from the chromogenic product, wherein the virus contains in its genome a gene encoding an enzyme capable of converting the chromogenic substrate to the chromogenic product and a gene encoding a ligand allowing the virus to specifically bind with a receptor of the target cell to infect the target cell with the virus.

The invention discloses an apple virus recognition method based on deep learning, and the method comprises the steps: building a fruit damage recognition network through the improvement of an originalresidual network structure and a loss function based on deep learning; for a training problem under a small sample, carrying out model training by combining strategies of transfer learning and a hierarchical learning rate in a network training process; and compressing the finally obtained model, so as to reduce the deployment cost of the model and improve the recognition efficiency. Theoretical guidance and technical support are provided for crop disease recognition.

The invention discloses an initial culture medium special for preventing brown stain of strawberries, which is prepared by taking an MS culture medium containing 0.2-0.5 mg / L of 6-benayl aminopurine (BA) and 0.1-0.2 mg / L of naphthylacetic acid (NAA) as a basic culture medium and adding vitamin C (VC) with the concentration of 5-15 mg / L and brassinolide (BR) with the concentration of 0.001-0.5 mg / L, wherein the brown stain rate in the initial strawberry tissue culture process can be greatly reduced; and the germination rate can be increased. The invention further discloses a method for producing tissue culture strawberry seedlings by culturing strawberry stem tip tissues through the culture medium, which comprises the steps of taking strawberry seedlings, sterilizing, inoculating, initially culturing, sub-culturing, acclimating, carrying out virus identification, breeding in a net yarn greenhouse and the like. According to the invention, the brown stain phenomenon in the initial strawberry culture can be effectively prevented; the anti-oxidant condition in the initially cultured strawberry tissues is effectively improved; and the germination rate is increased to be above 70% from 40-60%.

The invention provides a bucleic acid detection reagent kit for novel coronavirus 2019-nCoV, and particularly relates to a reagent kit and method for multiple detection of nucleic acid of novel coronavirus 2019-nCoV. 3 nucleic acid targets of the novel coronavirus 2019 nCoV can be detected at the same time, through mutual authentication between different targets, false positive can be prevented, and undetection which can be possibly caused by mutation is confirmed, so that the virus identification accuracy is notably improved.

The invention relates to oligonucleotide primers for detecting arbo encephalitis viruses, which comprise 12 pairs of virus specific primers, 1 pair of universal amplification primers and 1 pair of contrast primers inside a mosquito. In the detection step, firstly, an object to be detected is required to carry out an RT (Reverse Transcriptase) amplification reaction and a PCR (Polymerase Chain Reaction) amplification reaction, and a signal to be detected is amplified. The amplification product is detected by using an electrophoresis system, and the rapid detection and the synchronous identification of 12 kinds of viruses are realized by analyzing the segment length of the amplification product. The primers can be used for rapidly realizing detection and identification about whether the unknown sample carries the 12 kinds of arbo encephalitis viruses. The detection has high sensitivity and strong specificity. The primers provided by the invention can be applied to the efficient detection and virus identification of mosquitoes and other blood sucking insects under different environments such as departure and entry ports, baffle fields, livestock houses, rainforests, swamps and the like.

The invention discloses a group I type 4 aviadenovirus strain WZ. The strain has a preservation number of China Center for Type Culture Collection (CCTCC) No: V201662, is named as group I type 4 aviadenovirus strain WZ in a classified way, and is preserved in December 14, 2016; a group I type 4 viral vaccine of the aviadenovirus is prepared from the inactivated group I type 4 aviadenovirus strain which is taken as an active ingredient; the invention also provides application of the group I type 4 aviadenovirus strain WZ in preparation of an agar gel precipitating antigen, a hemagglutination inhibition (HI) antigen and positive serum antigen reagent which are used for diagnosing the group I type 4 virus of the aviadenovirus, and preparation of egg yolk antibody and antiserum which are used for treating the group I type 4 virus of the aviadenovirus. After the vaccine prepared by using the group I type 4 aviadenovirus strain is used for immunizing, the toxin attacking protection rate for the group I type 4 aviadenovirus strain WZ reaches 90-100%. As a vaccine strain with good manufacturing effect, the group I type 4 aviadenovirus strain WZ can be used for preventing avian inclusion body hepatitis and pericardial effusion syndrome, and also can be used for virus identification and epidemiological investigation.

The invention relates to network safety system and method, more concretely a network safety system and method for preventing Trojan. A control terminal (240) is connected with server (210) through Internet (230) so that control terminal (240) transmits instruction to server (210) and / or server (210) transmits data back to control terminal (240). The network safety system of the invention identifies Trojan virus through virus identification module (221), performs protection operation for server (210) through strategy control module (222). In one embodiment, Trojan virus is identified based on data of application layer, while in another embodiment based on data of application layer and TCP head or IP head information, and based on relation between data packet during connection. The network safety system and method for preventing Trojan of the invention are widely used among LAN and single PC.

The invention discloses a virus detection method and apparatus for a file. A specific embodiment of the method comprises the steps of extracting characteristic information from a to-be-detected file, wherein the characteristic information is used for representing a running behavior of the to-be-detected file; performing normalization processing on the characteristic information to obtain normalized data corresponding to the characteristic information; and converting the normalized data into binary data, and importing the binary data into a pre-trained virus detection model to perform virus detection to obtain a virus detection result. According to the implementation mode, a virus identification deviation caused by quantity can be avoided, the virus identification accuracy can be improved, and the virus identification speed is increased.

The invention provides a noninvasive biopsy virus detection method based on high throughput gene sequencing. The method can carry out DNA sequencing and RNA sequence in parallel and thus precisely determines the biological composition and structure of viruses in patients. The method can maximally avoid the interference of nucleic acid of host cells, effectively reduce the cost of sequencing, and is capable of detecting multiple unknown crossed viruses at the same time. 80 DNA tagged connectors are designed, related reagents are assembled to form a library so as to construct a kit, and if the throughput allows, the kit can perform sequencing on 80 samples in parallel. The experiment design is strict, the automation degree is high, the virus identification can be finished in batches within 24 hours, the requirements of scientific research and clinical detection can be met in different levels, and references are provided for clinical diagnosis and prescription of diseases related with virus infection.

The invention provides a transcriptome sequencing method for microviridae and geminivirus viral genome splice. The method comprises the three steps of performing transcriptome sequencing on an infected DNA virus sample, comparing and splicing viral sequences and filling a blank area of the viral genome sequence. According to the method provided by the invention, the whole genome sequence of the banana bunchy top virus can be acquired and the other microviridae or geminivirus viral genomes can be spliced so as to acquire the whole genome sequence of the virus. The invention firstly reports the method for sequencing the spliced DNA viral genome in high throughput by utilizing transcriptome at home and abroad and fills the blank of the field at home and abroad. The method provided by the invention can be used for identifying and detecting DNA virus.

The invention belongs to the field of biotechnology and discloses an RT-LAMP detection method for citrus tristeza viruses. Based on RT-LAMP and the gene sequence of different stains of CTV issued by GenBank, four specific primers required by the RT-LAMP detection method are designed in accordance with the conserved regions of the sequences of the viruses, and the sequences of the four primers areshown below: F3: CGAAGTGGATTTGTCTGACA; B3: GGAATCCCTGCATCTAGCG; FIP:ACTCGAAGGGCGTTAGTACGGCTTTGGACTGACGTCGTGTT; and BIP: CTGGGGTAGGACTAACGATGCCGACGTCCGCCATAACTCAA. The four primers are completely matched with 6 regional sequences in a target sequence respectively. Experiment results indicate that the sensitivity of the method is 100 times higher than a common reverse transcription-polymerase chainreactions (RT-PCR) method and has high virus early diagnosis accuracy. The result obtained by the method is consistent with that obtained by the RT-PCR detection method, but more sensitive and accurate than that obtained by a direct tissue blot immuno-assay (DTBIA) method. The method can quickly, accurately and sensitively detect CTV, and is suitable for quick detection of a sample, CTV spread monitoring, virus-free seedling identification and tristeza virus identification.

The embodiment of the invention discloses a training method used for virus identification and a virus identification method and a corresponding device. The training method used for the virus identification comprises the following steps: extracting the characteristics of a program in a pure black sample; according to the characteristics of the program, obtaining the mathematical characteristics of the program; judging whether the mathematical characteristics conform to the requirements of the mathematical characteristics of a preset virus or not; if yes, obtaining the common characteristic of the mathematical characteristics of the program and the mathematical characteristics of the preset virus; and if not, recording the mathematical characteristics of the program to serve as the mathematical characteristics of a newly-added virus. The viruses can be quickly scanned.

The invention discloses a computer software security defending system. The computer software security defending system comprises a main system and a virtual system, the output end of the main system is electrically connected with the input end of the virtual system, a file is newly built in the main system, the newly-built file is identified through a virus identification unit, the virus identification unit is connected with a virus library unit, it is ensured that a locally stored hard disk is separated from the main system, and large-area damage of viruses to stored data is avoided. After hard disk power is shut off through a circuit shutoff unit, the virtual system is started, and then an identity authentication system is popped up; after a user is successfully authenticated through theidentity authentication system and enters the virtual system, the user can obtain the authority authorization of a highest authority authorization unit and then can delete files in the locally storedhard disk, and virus files in the locally stored hard disk can be deleted through an abnormal file force delete unit, so that the security of the main system is ensured. The computer software security defending system is reasonable in design, computer software can be protected, and the computer software security defending system is suitable for popularization.

The invention relates to the technical field of virus detection, in particular to a multiple fluorescent quantitative PCR detection primer pair for novel goose astrovirus, goose paramyxovirus and goose parvovirus, and an application of a specific probe. The established multiple fluorescent quantitative PCR system can accurately detect single or mixed infection of the novel goose astrovirus, the goose paramyxovirus and the goose parvovirus, the multiple fluorescent quantitative PCR system is optimized, the optimal primer concentration and the optimal probe concentration are determined, the detection precision is higher, and the multiple fluorescent quantitative PCR detection primer pair has important advantages in the field of virus identification.

The embodiment of the invention provides an identification method and equipment of viruses. The method comprises the following steps of: monitoring the behavior of a process; obtaining an executable file name corresponding to the process according to the behavior of the process; determining a file name the same as or similar to the executable file name; identifying the executable file as file folder viruses according to the behavior of the process and the attribute of a file folder corresponding to the same or similar file name. The virus characteristic information of the file holder viruses do not need to be relied on, the operation is simple, and errors do not easily occur, so that the efficiency and reliability of virus identification can be improved.

The invention relates to the technical field of virus detection, and specifically relates to multiplex PCR detection primer pairs for goose astrovirus, goose paramyxovirus and goose parvovirus; and the invention further relates to a detection method of the primer pairs and application of the primer pairs. The multiplex PCR system established by the invention is capable of accurately detecting simplex or mixed infection of waterfowl with the goose astrovirus, the goose paramyxovirus and the goose parvovirus. Moreover, the multiplex PCR system is optimized with determined optimal primer ratio, primer concentration and Premix rTaq enzyme; and thus, better DNA amplification effects of the 3 viruses are achieved. Therefore, the multiplex PCR system has higher detection accuracy, and thereby having important advantages in the field of virus identification.

The invention provides a Cyprinus carpio var. jian cerebral line and application thereof. Through primary isolation on Cyprinus carpio var. jian cerebral tissues with pancreatin of an appropriate concentration and reasonable digestion conditions, Cyprinus carpio var. jian cerebral cells can be obtained, and through subculture, the Cyprinus carpio var. jian cerebral line CCB-J is established for the first time; the Cyprinus carpio var. jian cerebral line is mainly represented as epithelioid cells and can be passaged for more than 60 generations, thereby be high in research and application the fields such as virology, toxicology, physiology, molecular genetics and biology of evolution. The Cyprinus carpio var. jian cerebral line can be applied to virus identification and virus strain isolation, to preparation of Cyprinus carpio var. jian virus preventing or killing vaccines, as biological models of drug screening, preparation and evaluation and the like.

The invention discloses a method for detecting a macro virus group in a sample, and belongs to the technical field of metagenome analys.The method comprises the steps that second-generation sequencing data and third-generation sequencing data of a to-be-detected sample are mutually corrected and mixed and assembled to obtain mixed and assembled contigs, and the third-generation sequencing data are independently assembled to obtain Nanopore contigs; further, the mixed assembly contigs and the Nano-virus contigs are respectively subjected to comparison and annotation, so that candidate virus contigs, non-virus contigs and Nano-virus contigs are obtained, and the candidate virus contigs, the non-virus contigs and the Nano-virus contigs are subjected to comparison and annotation; and finally, carrying out clustering analysis on the three data sets, carrying out further comprehensive analysis according to a clustering result, supplementing missing virus sequences, and correcting a species annotation result to obtain a more sensitive, accurate and comprehensive virus identification result.

The present invention provides primers and a detection kit for avian leukosis J subgroup virus PCR detection. According to the present invention, PCR detection primers are designed by analyzing avian leukosis J subgroup virus env gene, wherein nucleotide sequences of the primers are represented by sequence lists SEQ ID No.1 and SEQ ID No.2; and the primers have good specificity, and the detection method has characteristics of rapidness, simpleness, high accuracy and good sensitivity so as to provide an excellent detection method for avian leukosis J subgroup virus identification. The present invention further provides a detection kit for the avian leukosis virus, wherein the detection kit comprises a primer pair represented by the sequence lists SEQ ID No.1-2.

The invention discloses a macro virus identification method, a device, a storage medium and a processor. The method comprises the following steps: obtaining a macro program to be detected of a file tobe detected; A macro program to be detect is analyzed use a decision model, A method for identify whether a macro program to be detect is a virus macro program, wherein a decision model is trained bya machine learning algorithm using a plurality of set of training data, that plurality of sets of training data including first type data and second type data, each set of training data in the firsttype data including a virus macro program and a tag identifying the macro program as a virus; Each set of training data in the second type of data includes a non-viral macro program and a label identifying the macro program as non-viral; When it is determined that the macro program to be detected belongs to a virus macro program, it is determined that the macro program to be detected corresponds to a virus file. The invention solves the technical problem of low macro virus identification efficiency.

The invention provides an automatic identifying and importing system of a multimedia file type. The automatic identifying and importing system comprises a user interface module, a file type identifying and virus checking module and an automatic importing module, wherein the user interface module is used for obtaining all multimedia files to be imported and receiving the instruction of a user to obtain the operation information of the user; the file type identifying and virus checking module is used for carrying out virus identification and type identification on all obtained multimedia files to be imported according to the operation information of the user; and the automatic importing module is used for importing an identified non-virus multimedia file into a preset folder which is positioned on terminal equipment which loads the system, and corresponds to a type to which the non-virus multimedia file belongs. By use of the automatic identifying and importing system, the copying and using inconvenience of the multimedia file and the application deficiency of file type identification in the prior art can be overcome, and the requirements of the user on the quick importing and use of the file can be met.