Brown planthopper resistant gene in rice and use thereof

An anti-BPH gene technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problem of not yet cloning the anti-BPH gene, etc., and achieve the effect of improving resistance, good effect and clear function

Active Publication Date: 2009-06-24
WUHAN UNIV
View PDF0 Cites 25 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no BPH resistance gene has been cloned in rice so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brown planthopper resistant gene in rice and use thereof
  • Brown planthopper resistant gene in rice and use thereof
  • Brown planthopper resistant gene in rice and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Embodiment 1: Positional cloning of Bph14 gene

[0052] 1. Preliminary positioning results of Bph14

[0053] The brown planthopper-resistant rice material RI35 (Hao PY, Liu CX, Wang YY, Chen RZ, TangM, Du B, Zhu LL, He GC (2008) Herbivore-induced callose deposition on the sieve plates of rice: an important mechanism for host resistance. PlantPhysiology 146: 1810-1820) was crossed with a brown planthopper-susceptible rice variety (Taichung Local No. 1, TN1, purchased from the National Rice Germplasm Bank) to construct a Bph14-containing F 2 group. To identify F 2 To locate the N. lugens resistance phenotype of each individual plant in the population, the seedling stage group method was used to investigate the resistance performance of each individual plant in the population (see figure 1 B). f 2 The insect resistance level of a single plant is according to the corresponding F 2-3 The average value of the insect resistance level of all individual plants in the famil...

Embodiment 2

[0069] Example 2: Functional verification and application of Bph14 gene

[0070] 1. Construction of genetic transformation vector

[0071] The vector used was pCAMBIA1301 (purchased from Center for the Application of Molecular Biology to International Agriculture, Australia). According to the results of genome sequencing, design primers (5'cg gaattc ctccctgactgaagaagagaagag3',5'cg gaattc tgctagctgtgattctcttatgatg3'), which includes an EcoRI adapter, amplifies the genome of insect-resistant rice B5 (Z. Huang et al., Identification and mapping of two brown planthopper resistance genes in rice. Theor Appl Genet, 2001, 102: 929-934). The total volume of the PCR reaction is 50 μl: 1 μl DNA, 5 μl 10× buffer, 1 μl 10 mM dNTP, 3 μl each of 10 μM primers, 1 U high-fidelity Taq enzyme; reaction program: 94°C for 2 minutes, 94°C for 15 seconds, 58°C for 30 seconds, 72°C for 7 minutes and 30 seconds, total 30 cycles; the product was purified by adding 1 / 10 volume of 3mM NaAC and 2× v...

Embodiment 3

[0077] Example 3: Molecular marker-assisted selection of brown planthopper-resistant rice with Bph14 gene

[0078] According to the genome sequence and cDNA sequence of the Bph14 gene, multiple pairs of SSR-marked or STS-marked primers can be designed. In this example, the primer pair 5'ctgctgctgctctcgtattg3' and 5'cagggaagctccaagaacag3' were used as marker primers to breed rice with insect resistance function, and the length of the amplified fragment was 172bp. Genomic DNA of insect-resistant rice, insect-susceptible varieties and their hybrid and backcross progeny plants is extracted, and after PCR amplification with primers designed for the Bph14 gene sequence, molecular marker detection is carried out by polyacrylamide gel electrophoresis. Among the hybrid progeny plants, those with the same PCR band pattern as the insect-resistant rice (the amplified product contains a 172bp fragment) are the selected plants containing the Bph14 gene (such as figure 2 ). The insect res...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a brown planthopper resistance gene Bph14 in rice. The gene has a nucleotide sequence shown in SEQ ID No. 1 and a cDNA sequence thereof is shown in SEQ ID No.2. The gene Bph14 of the invention belongs to CC-NBS-LRR gene family, and coded protein is related to plant disease resistance. The gene Bph14 has function of resisting the brown planthopper. Through genetic transformation and hybridization, the gene Bph14 is transferred into normal rice varieties, which can improve the resistance of the rice to the brown planthopper, thus reducing the damage caused by the brown planthopper and achieving the purposes of increasing and stabilizing the production of rice.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, specifically relates to a rice brown planthopper resistance gene Bph14, and also relates to the application of the gene in rice and rice seeds resistance to brown planthopper. Background technique [0002] Rice is an important food crop, which is the staple food for more than half of the world's people. At the same time, since the fine genetic map and physical map of the rice genome have been completed, its transgenic technology is relatively easy, and it has collinearity with other grass crop genomes, so it is regarded as a model plant. With the completion of genome sequencing of various organisms including rice, human beings have entered the post-genome era. It has become the frontier field of life science to carry out functional genome research in an all-round way. Therefore, the study of rice functional genes is of great significance to socioeconomic development and biological resea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C07K14/415C12Q1/68A01H5/00A01H5/10
CPCC07K14/415A01H1/04A01H5/10C12N15/8286Y02A40/146A01H6/4636
Inventor何光存杜波张维林祝莉莉陈荣智
OwnerWUHAN UNIV