159 results about "Zearalenone" patented technology

The invention discloses streptomyces allogeri and an application thereof in biological prevention and control of toxin-producing fungi. In particular to streptomyces allorgeus ZxBac193 CGMCC (China General Microbiological Culture Collection Center) No.32341 and an application thereof. The streptomyces allorgeus ZxBac193 shows a strong antagonistic effect on toxin-producing fungi such as aspergillus flavus, aspergillus ochraceus, fusarium graminearum, fusarium oxysporum, penicillium citrinum and penicillium islanigerum; the compound can inhibit the growth of aflatoxin producing fungi, ochratoxin producing fungi, deoxynivalenol producing fungi, zearalenone toxin producing fungi, fumonisins producing fungi, citrinin producing fungi and island penicillin producing fungi, and can be prepared into various biological control products aiming at mycotoxins, such as biopesticides, antifungal agents and the like. The compound is used for inhibiting toxic fungi in the environment and preventing or relieving mycotoxin pollution, and has good development and application prospects in the fields of prevention and treatment of fungal pollution of food crops and the like.

The invention relates to the technical field of analysis and detection, in particular to a fluorescent switch sensor based on quantum dot-nano porphyrin and application. The specific technical scheme is as follows: the fluorescent switch sensor is constructed by utilizing cadmium telluride quantum dots modified by mercaptosuccinic acid and a 5, 10, 15, 20-tetra (4-nitrophenyl) porphyrin nano material modified by a cationic surfactant hexadecyl trimethyl ammonium bromide. And the method has a good enrichment effect on zearalenone. The sensor has high sensitivity, high selectivity and anti-interference performance, can accurately analyze trace zearalenone in actual grain samples (corn, rice, soybean and the like), and has the advantages of simplicity in operation, low detection limit, high sensitivity, low cost and the like.

The invention belongs to the technical field of bioengineering, and particularly relates to a zearalenone toxin degrading enzyme variant and application thereof. The amino acid sequence of the zearalenone toxin degrading enzyme is as shown in SEQ ID NO.2, or the zearalenone toxin degrading enzyme with the amino acid sequence as shown in SEQ ID NO.2 is obtained through amino acid mutation. The zearalenone toxin degrading enzyme mutant is obtained through mutation screening, and compared with a wild type, the zearalenone toxin degrading enzyme mutant has the advantages that the zearalenone degrading capability is obviously improved; besides, the zearalenone toxin degrading enzyme is expressed by using alfalfa, the zearalenone toxin degrading enzyme with biological activity is easy to obtain, and the zearalenone toxin degrading enzyme has certain application potential in prevention and treatment of animal poisoning caused by zearalenone toxin pollution in agriculture and animal husbandry production.

The invention discloses a preparation method of a mycotoxin degrading enzyme intelligent slow-release feed additive, and relates to the technical field of feed additive production, a double-emulsion embedding technology is adopted, enzyme is embedded in a multi-layer shell composed of chitosan, sodium alginate and an enteric polymer Eudragit S100, and then Ca < 2 + > ion cross-linking solidification is performed to obtain the mycotoxin degrading enzyme intelligent slow-release feed additive. And finally, freeze-drying or spray-drying to obtain the core-shell structure microcapsule. The obtained microcapsules are compounded with functional carriers such as yeast cell walls, sodium aluminosilicate, mannan oligosaccharide, talcum powder and the like to prepare finished products which can be directly added into various feeds. The release rate of the additive in simulated gastric juice with the pH value of 2.0 for 4 hours is lower than 15%, the release rate of the additive in simulated intestinal juice with the pH value of 6.8 for 6 hours exceeds 90%, the enzyme activity can be effectively protected, and targeted release of intestinal tracts is achieved; meanwhile, the compound carrier has a synergistic adsorption effect on various mycotoxins, and the degradation rates of aflatoxin B1, zearalenone and ochratoxin A in an in-vitro experiment respectively reach 87% or above.

The invention discloses a mycotoxin degrading bacterium (Lactobacillus plantarum) R4-30 and application thereof, the strain is preserved in the China Center for Type Culture Collection, the preservation number is CCTCC No: M2018437, and the strain is obtained by screening in Guangxi sugarcane tail leaf silage. The strain can inhibit the growth of aspergillus flavus and fusarium graminearum, so that the production of mycotoxin is reduced, and the mycotoxin can be degraded. The aflatoxin B1 degradation rate of the strain is as high as 91.21% when the bacterial concentration is 12 * 10 < 8 > cfu / ml, the pH value is 2 and the culture time is 16 days; when the bacterium concentration is 3 * 10 < 8 > cfu / ml, the pH value is 6 and the culture time is 12 days, the zearalenone degradation rate is as high as 94.56%; when the bacterial concentration is 12 * 10 < 8 > cfu / ml, the pH value is 2 and the culture time is 16 days, the degradation efficiency of AFB1 and ZEN in the mango peel fermented feed is remarkably improved, the degradation rates of AFB1 and ZEN under the conditions reach 91.2% and 58.16% respectively, the nutritional quality is high, the fermentation quality is good, chemical additives are not needed, and the method is suitable for green detoxification treatment of agricultural products and feed.

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.

The invention belongs to the technical field of enzyme engineering, and particularly relates to a codon optimized superoxide dismutase AfSOD gene and application thereof in degradation of aflatoxin B1 and zearalenone. Under the conditions that the pH is 7, the temperature is 40 DEG C and the enzyme addition amount is 10 micrograms, the degradation rate of the AFB1 reaches 99.08% within 24 hours, and the degradation rate is kept to be 80% or above within 40-80 DEG C; under the conditions that the pH is 8, the temperature is 60 DEG C and the enzyme addition amount is 20 micrograms, the degradation rate of ZEN reaches 85.1% in 24 hours, and the degradation rate is kept to be 80% or above within 50-80 DEG C; the result shows that AfSOD is a toxin degrading enzyme which can tolerate a certain degree of high temperature; the degradation rates of AFB1 and ZEN in polluted peanut powder or corn powder are 73.7% and 88.2% respectively; the invention provides a new candidate for detoxification of AFB1 and ZEN in food or feed, and has a good application prospect.

The invention belongs to the technical field of bioengineering and food safety, and particularly relates to a fusion enzyme for degrading aflatoxin B1 (AFB1) and / or zearalenone (ZEN) and application of the fusion enzyme. The fusion enzyme S1-AsDPP III disclosed by the invention can effectively degrade AFB1 and ZEN, the fusion enzyme is obtained by fusing a section of self-assembled amphiphilic oligopeptide S1 sequence at the N end of wild type AsDPP III, and the thermal stability of the fusion enzyme and the amphipathy of the fusion enzyme in an oil-water coexistence system can be remarkably improved. Under mild reaction conditions, the fusion enzyme can efficiently degrade AFB1 and ZEN in vegetable oil, and is especially suitable for detoxification treatment of common edible oil such as peanut oil and corn oil. The invention provides a green, safe and efficient scheme for removing fungaltoxin from grease food, and the method has a good industrial application prospect.

The invention discloses application of polydatin in preparation of a medicine for relieving hepatotoxicity caused by zearalenone, and belongs to the technical field of biological medicine. The invention reveals that polydatin inhibits hepatotoxicity caused by zearalenone through targeted xanthine oxidase for the first time, so that the toxicity of zearalenone to an organism is relieved. Polydatin can be directly combined with xanthine oxidase to inhibit the catalytic activity of xanthine oxidase, so that the oxidative stress injury of the liver after ZEA exposure is reduced, meanwhile, the content of malondialdehyde (MDA) in the liver can be remarkably reduced, the activity of superoxide dismutase (SOD) is improved, the liver oxidation-antioxidant balance is recovered, and liver cells are protected from oxidative injury of ZEA. The invention provides a new scientific basis and development direction for application of polydatin in the fields of mycotoxin detoxification, oxidation resistance, liver protection and the like.

The present invention relates to a mycotoxin degrading agent and its application, belonging to the field of agricultural biology. The present invention provides a highly efficient mycotoxin degrading agent that can be used for mycotoxin degradation. The mycotoxin degrading agent of the present invention comprises bacterial laccase Lac_P.E. and an artificial mediator, and can efficiently degrade mycotoxins, including aflatoxin B1 and zearalenone, and is widely used in the field of mycotoxin detoxification.

The invention relates to the technical field of agricultural biology, in particular to a high-activity multi-copper oxidase mutant V286N and application thereof in mycotoxin degradation. The amino acid sequence of the multi-copper oxidase mutant is as shown in SEQ ID NO: 2. The multi-copper oxidase mutant provided by the invention has higher specific activity. Compared with wild type multi-copper oxidase, the multi-copper oxidase mutant MCO-V286N provided by the invention has the advantages that the specific activity is improved by 0.8 time, the degradation efficiency on mycotoxin zearalenone is improved by 0.4 time, the production and application cost is effectively reduced, and the multi-copper oxidase mutant MCO-V286N has important application value and technical significance in wide application of the multi-copper oxidase in the field of mycotoxin detoxification of food and feed.

The invention relates to the technical field of organic functional material synthesis and mycotoxin removal, in particular to a magnetic covalent organic framework for adsorbing zearalenone and a preparation method and application thereof.The magnetic covalent organic framework is Fe3O4 (at) COF-VPBA and is prepared from 1, 3, 5-tris (4-aminophenyl) benzene, 2, 5-dimethoxy terephthalaldehyde, 4-alkenyl phenylboronic acid, boron trifluoride diethyl etherate, 2, 3-dichloro-5, 5-di (4-aminophenyl) benzene, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2 The catalyst is prepared from 2, 6-dicyano-1, 4-benzoquinone and nano ferroferric oxide through a four-component one-pot in-situ Povarov reaction. According to the method, the process is simplified, the defects of a fractional step method are avoided, due to specific covalent binding of boric acid groups and ZEN catechol hydroxyl groups, the adsorption capacity and the adsorption rate are remarkably superior to those of traditional and unfunctionalized adsorption materials, the adsorption rate still exceeds 90% after acetonitrile is eluted and regenerated and is repeatedly used for more than 5 times, and the comprehensive requirements of high selectivity, high adsorption capacity, easiness in separation and recyclability are met.

The invention relates to a bacillus velezensis strain resistant to high temperature and alkali, and belongs to the technical field of microbial detoxification and feed safety. The bacillus velezensis B.26 strain with the preservation number of CGMCC (China General Microbiological Culture Collection Center) No.34475 is provided aiming at the problems that in the prior art, the thermal stability of zearalenone (ZEN) degrading enzyme is insufficient, the efficiency is low in an alkaline environment, and toxic metabolites are easily generated by traditional strains. CotA laccase and peroxide reductase Prx secreted by the strain can efficiently degrade ZEN and derivatives alpha-zearalenol and beta-zearalenol, the products are low-toxicity C17H24O4 and C12H16O4, and harmful by-products such as alpha-ZEL / beta-ZEL and the like do not exist. The strain and recombinase thereof are suitable for a high-temperature alkaline environment for feed processing, and can be applied to biological detoxification of ZEN pollution in food and feed on a large scale through an immobilized carrier.

This invention relates to the field of enzyme engineering technology, and in particular to a highly efficient lactone hydrolase mutant for degrading zearalenone and its applications. This lactone hydrolase mutant uses the lactone hydrolase gene from Monosporascus sp. GIB2 as a template, and performs a site-directed mutation at amino acid position 134 to obtain L134A, L134V, L134I, and L134M mutants. Under optimal conditions of pH 9.0 and 60℃, these single-point mutants can efficiently degrade zearalenone (ZEN) within 3 minutes. The enzyme activity for degrading zearalenone is significantly improved compared to the original enzyme, with degradation activities increasing by 1.22 (L134A), 1.25 (L134V), 1.17 (L134I), and 1.14 (L134M), respectively, demonstrating significant applications and economic value in the feed industry.

The present invention relates to the technical field of genetic engineering. Provided is a method for constructing an efficient zearalenone-degrading enzyme in the gastric environment of a pig. In the zearalenone-degrading enzyme as shown in SEQ ID NO: 1 that is taken as the parent, the amino acid at position 92, the amino acid at position 114, the amino acid at position 117, the amino acid at position 140, the amino acid at position 153, the amino acid at position 157 and the amino acid at position 220 are respectively mutated into lysine, leucine, tryptophan, arginine, methionine, valine and tryptophan to obtain the mutant. The obtained zearalenone-degrading enzyme mutant has high enzymatic activity and thermal stability, and is better adapted to the internal environment of pigs.

The invention aims to provide a microbial feed additive for preventing zearalenone poisoning, which can obviously improve the reproductive performance and growth performance of livestock and poultry and enhance the immunity of animals. The composite microbial agent mainly comprises the following components in parts by weight: 1-5 parts of DL-alpha-tocopheryl acetate, 1-3 parts of superoxide dismutase (SOD), 5-10 parts of coated vitamin C and 82-93 parts of a bacillus subtilis microbial agent. 100 parts by weight of feed contains 0.005-0.01 part by weight of the feed additive disclosed by the invention. The embodiment 1 of the invention is preparation of bacillus subtilis for degrading ZEA, and the embodiment 2 of the invention is preparation of the microbial feed additive according to the content of the invention. The embodiment 3 is a detoxification experiment of the microbial feed additive on the ZEA in the young sow feed. An embodiment 3 verifies that the traditional Chinese medicine composition can well prevent the problems of reproductive disorder, low production capacity, reduced immunity and the like caused by ZEA poisoning of young sows.

The invention belongs to the technical field of biology, relates to a zearalenone degrading enzyme, and particularly relates to a bacillus subtilis source zearalenone degrading enzyme, an engineering strain thereof and an enzyme preparation prepared from the bacillus subtilis source zearalenone degrading enzyme. Compared with the known zearalenone degrading enzyme, the zearalenone degrading enzyme not only has obvious structure and sequence differences, but also shows an excellent degrading effect at low concentration. The lactone hydrolase derived from bacillus is found for the first time, and the biological resource basis of zearalenone degrading enzyme is expanded. The enzyme not only has significant difference from other degrading enzymes in structure, but also shows unique characteristics in degradation mechanism. The capability of efficiently degrading zearalenone shows that the bacillus subtilis has a wide application prospect in the fields of agriculture, food industry and the like. In addition, the invention also covers the structure of a degradation product generated by the zearalenone enzyme, and provides a new perspective for understanding a zearalenone degradation mechanism.

The present invention discloses the application of trans-anethole in alleviating the toxicity of zearalenone in animals, belonging to the technical field of mycotoxin prevention and control. The present invention provides the application of trans-anethole in the preparation of a drug or feed for alleviating zearalenone poisoning in animals. The present invention has confirmed that trans-anethole can effectively alleviate the reproductive toxicity of zearalenone in piglets, improve the uterine organ index and ovarian organ index, ensure the health of piglets and the development of the reproductive system, and provide a new method for detoxifying zearalenone.

The invention relates to the technical field of biological adsorbents, in particular to a protein nanofiber membrane zearalenone adsorbent and a preparation method thereof. According to the invention, zein is dissolved in an ethanol water solution, and then a film is prepared by an electrostatic spinning technology, so that a novel ZEN adsorbent is obtained. Compared with a traditional adsorbent, the adsorbent obtained based on the electrostatic spinning technology has the advantages that the specific surface area and adsorption sites are high, mass transfer pores are controllable, the composite design has adsorption selectivity, good flexibility and self-supporting characteristics, and the adsorbent can be accurately processed and integrated in various application scenes. The prepared adsorbent is low in raw material cost, simple and convenient in preparation process, free of toxic organic substances, easy to produce on a large scale, remarkable in ZEN adsorption effect and good in application prospect.

The present invention belongs to the technical field of zearalenone extraction and relates to a method for extracting zearalenone from corn steep liquor to prepare a crude standard. The method comprises centrifuging corn steep liquor containing ZEN to obtain a supernatant; treating the supernatant using a PA66 membrane to obtain a PA66 membrane enriched with ZEN; eluting the PA66 membrane enriched with ZEN to obtain an eluate; and purifying the eluate by rotary evaporation to obtain a crude ZEN standard. The PA66 membrane is used to enrich and extract ZEN from ZEN-contaminated corn byproducts, achieving an enrichment and extraction efficiency exceeding 90%, providing a reliable and effective method for the high-value utilization of corn byproducts. The PA66 membrane is used to efficiently and selectively adsorb and enrich ZEN to initially prepare a crude ZEN standard, providing a new approach to the preparation of ZEN standard products.

The invention relates to an aptamer specifically bound with aflatoxin B1 and application of the aptamer, and belongs to the technical field of biological detection. According to the invention, aflatoxin B1 is taken as a target, on the basis of broad-spectrum recognition of aflatoxin (aflatoxin B1, aflatoxin B2, aflatoxin M1 and aflatoxin G1) by an original aptamer, an aptamer sequence is modified by using directed evolution, and the aflatoxin B1, aflatoxin B2, aflatoxin M1 and aflatoxin G1 are identified on the basis of molecular dynamics in combination with free energy. And the aptamer sequence for recognizing the aflatoxin B1 with high affinity and specificity is obtained. The dissociation constant of the aptamer to the aflatoxin B1 is 9.2 nM, and the aptamer has high affinity to the aflatoxin B1; in addition, the aptamer provided by the invention can only detect the aflatoxin B1, has no recognition force on the aflatoxin B2, the aflatoxin M1, the aflatoxin G1, the fumonisins B1, the zearalenone and the ochratoxin A, and has good specificity.

This invention provides a covalent organic material for adsorbing zearalenones (ZENs), its preparation, and its application. The covalent organic material comprises: a matrix layer formed of melamine sponge; and an adsorption layer covering at least a portion of the surface of the matrix layer, the adsorption layer being composed of a covalent organic framework structure having repeating units as shown in Formula I. This covalent organic material can efficiently and specifically adsorb zearalenones and exhibits good hydrophobicity and thermal stability, making it suitable for the rapid and accurate enrichment and detection of ZENs in complex matrix foods.

The invention discloses a strain of probiotic bacillus subtilis capable of degrading a plurality of mycotoxins. The invention belongs to the technical field of bacillus subtilis, the bacillus subtilis H-1 shows an excellent degradation effect on zearalenone, the ZEN degradation rate of the bacillus subtilis H-1 can reach up to 88.3% under the optimized culture condition, the content of ZEN in feed and food can be effectively reduced, potential threats of mycotoxin to animal and human health are reduced from the source, and the bacillus subtilis H-1 has a good application prospect. The safety of agricultural products and feed is greatly improved, and safe delivery of a food chain is guaranteed; the bacillus subtilis H-1 disclosed by the invention has a remarkable promoting effect on animal health, can improve atrophy conditions of spleen and thymus, enhance immune organ functions, remarkably reduce uterine ovarian coefficient, relieve damage of ZEN to a female reproductive system and guarantee reproductive health of animals; the strain H-1 can generate amylase and cellulase, the enzyme production capacity is good, the enzymes can participate in the decomposition and digestion process of nutrient substances in animal intestinal tracts, the utilization rate of carbohydrates in feed can be increased, absorption of the nutrient substances by animals is promoted, the feed cost is reduced, and the breeding benefits are increased.

A polypeptide hydrolytically cleaving zearalenone and / or at least one zearalenone derivative is a hydrolytic enzyme having an amino acid sequence selected from the group consisting of SEQ ID No. 1-15 or a functional variant thereof, wherein the sequence identity between the functional variant and at least one of the amino acid sequences is at least 40%; and an additive comprising the polypeptide; and an isolated polynucleotide encoding the polypeptide; and a method for hydrolytically cleaving zearalenone and / or at least one zearalenone derivative with the polypeptide.

The invention belongs to the technical field of bioengineering, and particularly relates to lactone hydrolase and application thereof. The lactone hydrolase is a protein composed of an amino acid sequence as shown in SEQ ID NO. 1; the nucleotide sequence of the coding gene of the lactone hydrolase is as shown in SEQ ID NO. 2. The lactone hydrolase constructed in the invention has high catalytic performance, and 30% of zearalenone with an initial concentration of 10 [mu] g / mL can be degraded by reacting for 2 h in a reaction system composed of the lactone hydrolase as a biocatalyst, ZEN as a substrate and an MES buffer solution. The method is safe and environment-friendly, the expressed and purified lactone hydrolase can be effectively used for controlling zearalenone pollution, and the method has a wide application prospect.

The present invention discloses a laccase, its gene and application, belonging to the technical field of genetic engineering. The laccase gene of the present invention is obtained by codon optimization of the laccase gene of Cerrena unicolor, and the nucleotide sequence is as shown in SEQ ID NO.2. The laccase gene provided by the present invention is recombinantly expressed by transforming Aspergillus niger, and high-activity laccase can be mass-produced industrially. The highest enzyme activity in shake flask culture reaches 39 U / ml, and after culturing in a 7L fermenter for 125 h, the total laccase activity reaches 9234 U / ml. At the same time, the laccase provided by the present invention and the mediator methyl syringate have a significant destructive effect on zearalenone, which is beneficial to grain transportation and storage.

The application belongs to the field of enzyme engineering, and relates to degradation of aflatoxin B1 and zearalenone. The application provides application of nitrite reductase AfNiR in simultaneous degradation of aflatoxin B1 and zearalenone. The nitrite reductase AfNiR has an optimal temperature of 40 DEG C and an optimal pH of 7.0 for degradation of AFB1. The degradation rate of the enzyme to AFB1 can reach 92.92%. Meanwhile, the nitrite reductase AfNiR can maintain a degradation rate of AFB1 of more than 80% in a temperature range of 40-70 DEG C, and is a fungal toxin degradation enzyme that can tolerate a certain degree of high temperature. The application provides a candidate enzyme with application potential for detoxification of AFB1 and ZEN in the food and feed industries.

The present invention provides a zearalenone degrading enzyme and its encoding gene, preparation method and application. The amino acid sequence of the degrading enzyme includes: 1) a protein as shown in SEQ ID NO.1; 2) a mutant of the protein as shown in SEQ ID NO.1. The degrading enzyme and its mutant protein provided by the present application have the activity of zearalenone degrading enzyme in an acidic environment. The present invention also constructs a plasmid and an engineering strain capable of expressing the degrading enzyme, and realizes heterologous expression of the enzyme in Escherichia coli BL21 (DE3). The enzyme can be used in industrial fields such as agriculture, feed and food to reduce the harm to human and animal health caused by zearalenone pollution.

This invention provides the use of β-glucuronidase in the preparation of an antidote for the prevention and / or treatment of zearalenone poisoning, and an antidote for the prevention and / or treatment of zearalenone poisoning, belonging to the field of feed additives. This invention, for the first time from the perspective of in vivo exposure control in animals, proposes a method to reduce the overall ZEN exposure level by inhibiting the activity of intestinal bacterial β-glucuronidase. The technical path is clear and highly operable. This is achieved through in vivo toxicokinetic parameters (AUC, C...). max Changes in (and / or MRT) objectively reflect a reduction in ZEN exposure levels in vivo, and the technical effects are quantifiable and verifiable. The β-glucuronidase inhibitors used in this invention are widely available, particularly suitable for the field of feed additives, and have promising application prospects.

The present application relates to feed additives and organic pollutant degradation technical field, specifically relates to a kind of modified biochar immobilized ZEN degradation bacteria microspheres and preparation method and application.The microsphere is by core material, inner layer wall material and outer layer wall material composition;Core material is by carrier, soluble starch and corn scab ketone degrading bacteria preparation;Carrier is by citric acid and octadecyl trimethylammonium chloride to biochar combined modification preparation;Corn scab ketone degrading bacteria is Bacillus Subtilis 168;Inner layer wall material is by sodium alginate and calcium chloride crosslinking preparation;Outer layer wall material is chitosan.The degradation bacteria microsphere of the present application can effectively maintain the activity of corn scab ketone degrading bacteria, combined with the adsorption of biochar and the biological detoxification of degradation bacteria, can realize the efficient degradation of corn scab ketone.