70 results about "Zearalenone" patented technology

The invention relates to the technical field of analysis and detection, in particular to a fluorescent switch sensor based on quantum dot-nano porphyrin and application. The specific technical scheme is as follows: the fluorescent switch sensor is constructed by utilizing cadmium telluride quantum dots modified by mercaptosuccinic acid and a 5, 10, 15, 20-tetra (4-nitrophenyl) porphyrin nano material modified by a cationic surfactant hexadecyl trimethyl ammonium bromide. And the method has a good enrichment effect on zearalenone. The sensor has high sensitivity, high selectivity and anti-interference performance, can accurately analyze trace zearalenone in actual grain samples (corn, rice, soybean and the like), and has the advantages of simplicity in operation, low detection limit, high sensitivity, low cost and the like.

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.

The invention belongs to the technical field of enzyme engineering, and particularly relates to a codon optimized superoxide dismutase AfSOD gene and application thereof in degradation of aflatoxin B1 and zearalenone. Under the conditions that the pH is 7, the temperature is 40 DEG C and the enzyme addition amount is 10 micrograms, the degradation rate of the AFB1 reaches 99.08% within 24 hours, and the degradation rate is kept to be 80% or above within 40-80 DEG C; under the conditions that the pH is 8, the temperature is 60 DEG C and the enzyme addition amount is 20 micrograms, the degradation rate of ZEN reaches 85.1% in 24 hours, and the degradation rate is kept to be 80% or above within 50-80 DEG C; the result shows that AfSOD is a toxin degrading enzyme which can tolerate a certain degree of high temperature; the degradation rates of AFB1 and ZEN in polluted peanut powder or corn powder are 73.7% and 88.2% respectively; the invention provides a new candidate for detoxification of AFB1 and ZEN in food or feed, and has a good application prospect.

The invention relates to the technical field of organic functional material synthesis and mycotoxin removal, in particular to a magnetic covalent organic framework for adsorbing zearalenone and a preparation method and application thereof.The magnetic covalent organic framework is Fe3O4 (at) COF-VPBA and is prepared from 1, 3, 5-tris (4-aminophenyl) benzene, 2, 5-dimethoxy terephthalaldehyde, 4-alkenyl phenylboronic acid, boron trifluoride diethyl etherate, 2, 3-dichloro-5, 5-di (4-aminophenyl) benzene, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2 The catalyst is prepared from 2, 6-dicyano-1, 4-benzoquinone and nano ferroferric oxide through a four-component one-pot in-situ Povarov reaction. According to the method, the process is simplified, the defects of a fractional step method are avoided, due to specific covalent binding of boric acid groups and ZEN catechol hydroxyl groups, the adsorption capacity and the adsorption rate are remarkably superior to those of traditional and unfunctionalized adsorption materials, the adsorption rate still exceeds 90% after acetonitrile is eluted and regenerated and is repeatedly used for more than 5 times, and the comprehensive requirements of high selectivity, high adsorption capacity, easiness in separation and recyclability are met.

This invention relates to the field of enzyme engineering technology, and in particular to a highly efficient lactone hydrolase mutant for degrading zearalenone and its applications. This lactone hydrolase mutant uses the lactone hydrolase gene from Monosporascus sp. GIB2 as a template, and performs a site-directed mutation at amino acid position 134 to obtain L134A, L134V, L134I, and L134M mutants. Under optimal conditions of pH 9.0 and 60℃, these single-point mutants can efficiently degrade zearalenone (ZEN) within 3 minutes. The enzyme activity for degrading zearalenone is significantly improved compared to the original enzyme, with degradation activities increasing by 1.22 (L134A), 1.25 (L134V), 1.17 (L134I), and 1.14 (L134M), respectively, demonstrating significant applications and economic value in the feed industry.

The invention belongs to the technical field of biology, relates to a zearalenone degrading enzyme, and particularly relates to a bacillus subtilis source zearalenone degrading enzyme, an engineering strain thereof and an enzyme preparation prepared from the bacillus subtilis source zearalenone degrading enzyme. Compared with the known zearalenone degrading enzyme, the zearalenone degrading enzyme not only has obvious structure and sequence differences, but also shows an excellent degrading effect at low concentration. The lactone hydrolase derived from bacillus is found for the first time, and the biological resource basis of zearalenone degrading enzyme is expanded. The enzyme not only has significant difference from other degrading enzymes in structure, but also shows unique characteristics in degradation mechanism. The capability of efficiently degrading zearalenone shows that the bacillus subtilis has a wide application prospect in the fields of agriculture, food industry and the like. In addition, the invention also covers the structure of a degradation product generated by the zearalenone enzyme, and provides a new perspective for understanding a zearalenone degradation mechanism.

This invention provides a covalent organic material for adsorbing zearalenones (ZENs), its preparation, and its application. The covalent organic material comprises: a matrix layer formed of melamine sponge; and an adsorption layer covering at least a portion of the surface of the matrix layer, the adsorption layer being composed of a covalent organic framework structure having repeating units as shown in Formula I. This covalent organic material can efficiently and specifically adsorb zearalenones and exhibits good hydrophobicity and thermal stability, making it suitable for the rapid and accurate enrichment and detection of ZENs in complex matrix foods.

A polypeptide hydrolytically cleaving zearalenone and / or at least one zearalenone derivative is a hydrolytic enzyme having an amino acid sequence selected from the group consisting of SEQ ID No. 1-15 or a functional variant thereof, wherein the sequence identity between the functional variant and at least one of the amino acid sequences is at least 40%; and an additive comprising the polypeptide; and an isolated polynucleotide encoding the polypeptide; and a method for hydrolytically cleaving zearalenone and / or at least one zearalenone derivative with the polypeptide.

The application belongs to the field of enzyme engineering, and relates to degradation of aflatoxin B1 and zearalenone. The application provides application of nitrite reductase AfNiR in simultaneous degradation of aflatoxin B1 and zearalenone. The nitrite reductase AfNiR has an optimal temperature of 40 DEG C and an optimal pH of 7.0 for degradation of AFB1. The degradation rate of the enzyme to AFB1 can reach 92.92%. Meanwhile, the nitrite reductase AfNiR can maintain a degradation rate of AFB1 of more than 80% in a temperature range of 40-70 DEG C, and is a fungal toxin degradation enzyme that can tolerate a certain degree of high temperature. The application provides a candidate enzyme with application potential for detoxification of AFB1 and ZEN in the food and feed industries.

This invention provides the use of β-glucuronidase in the preparation of an antidote for the prevention and / or treatment of zearalenone poisoning, and an antidote for the prevention and / or treatment of zearalenone poisoning, belonging to the field of feed additives. This invention, for the first time from the perspective of in vivo exposure control in animals, proposes a method to reduce the overall ZEN exposure level by inhibiting the activity of intestinal bacterial β-glucuronidase. The technical path is clear and highly operable. This is achieved through in vivo toxicokinetic parameters (AUC, C...). max Changes in (and / or MRT) objectively reflect a reduction in ZEN exposure levels in vivo, and the technical effects are quantifiable and verifiable. The β-glucuronidase inhibitors used in this invention are widely available, particularly suitable for the field of feed additives, and have promising application prospects.

The present application relates to feed additives and organic pollutant degradation technical field, specifically relates to a kind of modified biochar immobilized ZEN degradation bacteria microspheres and preparation method and application.The microsphere is by core material, inner layer wall material and outer layer wall material composition;Core material is by carrier, soluble starch and corn scab ketone degrading bacteria preparation;Carrier is by citric acid and octadecyl trimethylammonium chloride to biochar combined modification preparation;Corn scab ketone degrading bacteria is Bacillus Subtilis 168;Inner layer wall material is by sodium alginate and calcium chloride crosslinking preparation;Outer layer wall material is chitosan.The degradation bacteria microsphere of the present application can effectively maintain the activity of corn scab ketone degrading bacteria, combined with the adsorption of biochar and the biological detoxification of degradation bacteria, can realize the efficient degradation of corn scab ketone.

This invention relates to the X178 strain, which inhibits fungal diseases in grains and removes mycotoxins, and its applications. The X178 strain belongs to the Nocardiaceae family (…). Nocardiopsis This fungus (sp.) is deposited at the China General Microbiological Culture Collection Center (CGMCC) under accession number CGMCC No. 34027. Specifically, it exhibits inhibitory effects against grain pathogenic fungi Aspergillus flavus, Aspergillus niger, and Fusarium graminearum, and can remove two mycotoxins: aflatoxin B1 (AFB1) and / or zearalenone.

The invention discloses a monospecific monoclonal antibody for resisting zearalenone-14 glucoside and application of the monospecific monoclonal antibody. An immunogen and a coating antigen are used; the monoclonal antibody capable of monospecifically recognizing the zearalenone-14 glucoside and the rapid detection kit for detecting the zearalenone-14 glucoside are obtained through the technologies of mouse immunization, serum detection, cell fusion, monoclonal screening, ascites induced antibody and the like. The method is suitable for single-specificity trace residue detection of the zearalenone-14 glucoside in samples such as corn, rice, millet, wheat and oat, has very high recognition sensitivity to the zearalenone-14 glucoside, and realizes rapid, large-batch and low-cost detection of the zearalenone-14 glucoside.

The invention discloses a zearalenone degrading enzyme as well as a coding gene and application thereof, and belongs to the technical field of biology. The zearalenone degrading enzyme obtained by the invention is a brand-new enzyme, has better temperature and pH stability, has stronger degradation capacity on mycotoxin zearalenone, is high in degradation speed, and can be widely applied to enzymolysis of zearalenone. Therefore, a new enzyme preparation is provided for biodegradation of zearalenone, and the enzyme can be used in the industrial fields of agriculture, feed, food and the like and has good application potential, so that a good technical foundation is laid for ensuring feed safety, and harm caused by zearalenone pollution to human and livestock health is reduced.

The present application relates to the field of agricultural biotechnology, and in particular to a high-activity multicopper oxidase mutant V286N and its application in mycotoxin degradation. The amino acid sequence of the multicopper oxidase mutant is shown as SEQ ID NO: 2. The multicopper oxidase mutant provided by the present application has higher specific activity. Compared with the wild-type multicopper oxidase, the specific activity of the multicopper oxidase mutant MCO-V286N provided by the present application is increased by 0.8 times, the degradation efficiency of mycotoxin zearalenone is increased by 0.4 times, the production and application cost is effectively reduced, and the multicopper oxidase has important application value and technical significance for the wide application of the multicopper oxidase in the field of mycotoxin detoxification of food and feed.

The invention discloses an application of butyric acid or a derivative thereof in preparation of a zearalenone reproductive toxicity resisting preparation. Also disclosed is an antitoxic feed composition comprising a specific base ration and a butyric acid derivative. In-vivo and in-vitro tests and molecular mechanism researches prove that butyric acid and derivatives thereof (such as tributyrin and sodium butyrate) can effectively relieve zearalenone (ZEN)-induced animal ovary injury. The action mechanism of the traditional Chinese medicine composition is that follicular atresia is reduced, the balance of reproductive hormones (such as GnRH, E2, AMH and P4) is recovered, and clinical symptoms caused by ZEN poisoning such as vulva swelling and the like are relieved by activating a BMPs / SMAD signal channel, especially up-regulating SMAD4 protein expression and inhibiting oxidative stress (ROS) and Caspase-3 mediated granular cell apoptosis.

The application discloses a kind of feed additive and its application, it is related to feed additive technical field.The prepared feed additive of the application is by mixing sodium glucuronate, glucomannan, dimethyl cyclodextrin, diatomite and sodium lauryl sulfate, then mixed solution is reacted with calcium chloride crosslinking solution, finally form microspheres type feed additive.Compared with prior art, the prepared feed additive of the application is beneficial to the adsorption of deoxynivalenol and zearalenone, amino acid liquid, lemon yellow and titanium dioxide are mixed, then composite bacteria liquid is added to ferment, by feed additive processing, low-temperature drying can retain the nutrient components and biological activity in raw materials, and the biological fermentation protein raw material with good sensory color is obtained.

The application discloses application of an enzyme in degradation of zearalenone. The amino acid sequence of the enzyme comprises: (1) a sequence shown in SEQ ID NO. 1, or (2) an amino acid sequence obtained by substituting, deleting or adding one or at least two amino acid residues from the sequence in (1) and identical or similar in function to the sequence in (1), or (3) an amino acid sequence with at least 90% sequence homology to the sequence in (1) or (2) and identical or similar in function to the sequence in (1). The application first discovers that an enzyme derived from Xylaria multiplex has the function of degrading zearalenone, and catalyzes the degradation of zearalenone into non-toxic substances, so as to be expected to be applied in degradation of zearalenone, the degradation rate is more than 90%, and the application has substantial application value and great significance in the aspect of biological detoxification of food and feed.

The present application relates to a kind of complex enzyme preparation for inhibiting zearalenone generation and its preparation method and application, belong to microorganism and food safety technical field.The complex enzyme preparation prepared in the present application contains medium-temperature alpha-amylase, glucose oxidase, mannose oligosaccharide and soluble starch, medium-temperature alpha-amylase can effectively inhibit the generation of zearalenone in peanut meal, glucose oxidase can consume oxygen and produce acid, inhibit the growth of mould, mannose oligosaccharide can efficiently adsorb the generated zearalenone, and soluble starch is a stable carrier, which can be enzymatically hydrolyzed by medium-temperature alpha-amylase to generate glucose, providing a slow-release substrate for glucose oxidase.The complex enzyme preparation product can inhibit the generation of mycotoxin in crop feed raw materials from the root, has little effect on product quality, is more friendly to the environment, and the raw materials of complex enzyme preparation are easy to obtain, low in cost and widely used.

The invention discloses a Hannaea yeast ZAFU HH1, which is classified and named as Hannaea zeae, and is preserved in China General Microbiological Culture Collection Center (CGMCC) on June 28, 2023, and the preservation number is CGMCC No.27725. The Hannaea yeast ZAFU HH1 is named as Hannaea zeae and is preserved in China General Microbiological Culture Collection Center (CGMCC) on June 28, 2023. The invention also discloses a microbial inoculum prepared from the strain. The invention also discloses application of the bacillus subtilis and a microbial agent prepared from the bacillus subtilis in conversion of zearalenone. The yeast Hannai ZAFU HH1 has excellent ZEN conversion capability, the conversion product is identified as a derivative with lower toxicity, and the safety of the ZEN conversion product is evaluated by using caenorhabditis elegans as a model organism, so that the conversion product is proved to have good biological safety. In addition, under the conditions of low temperature stress and acid stress, the yeast Hannai ZAFU HH1 still keeps a high ZEN conversion rate.

The present invention relates to the use of an animal feed additive that reduces the toxic effects of mycotoxins, especially fumonisin B1 and zearalenone. This additive is a mycotoxin adsorbent consisting of an organically modified phyllosilicate with 71% substitution of its cation exchange capacity with the organic compound dioctadecyldimethylammonium chloride.

The application discloses a detoxification agent and a preparation method and application thereof, and relates to the technical field of detoxification agents, and particularly relates to a detoxification agent and a preparation method and application thereof. The preparation method comprises the following steps: (1) performing crushing treatment on shelled shrimp and / or shelled crab which are cleaned and dried, then performing hydrochloric acid immersion and centrifugal treatment to obtain first precipitates, and finally performing washing and drying on the first precipitates to obtain first dried matters; (2) performing calcination, grinding, ultrasonic treatment and centrifugal treatment on the first dried matters to obtain second precipitates, then performing washing and drying on the second precipitates to obtain second dried matters; (3) performing calcination, ultrasonic treatment and centrifugal treatment on the second dried matters to obtain third precipitates, then performing washing and drying on the third precipitates to obtain the detoxification agent. The detoxification agent disclosed by the application can efficiently remove harmful substances such as zearalenone and / or benzo[a]pyrene.

The invention provides a method for simultaneously determining ochratoxin A and zearalenone in breast milk and application of the method, and belongs to the technical field of food detection. The method comprises the following steps: adding < 13 > C-OTA and < 13 > C-ZEN isotope internal standards into breast milk to be detected, then adding acetonitrile, centrifuging, carrying out purification treatment on supernate by adopting immunomagnetic beads capable of simultaneously purifying ochratoxin A and zearalenone, carrying out nitrogen gas blow-drying and redissolving on the obtained eluent, filtering by virtue of a microfiltration membrane, and collecting the eluent. Detecting by adopting high performance liquid chromatography in series with triple quadrupole mass spectrometry, and substituting a detection result into a linear equation of a standard curve to obtain the concentration of ochratoxin A and zearalenone in the sample to be detected. The method has double functions of enrichment and detection, has the characteristics of high sensitivity and high recovery rate, and provides an efficient and accurate solution for trace pollution detection in breast milk.

The invention discloses an unmarked quantum dot electrochemical luminescence sensing electrode for detecting mycotoxin as well as a preparation method and application thereof. The preparation method comprises the following steps: preparing an interdigital electrode pair with two groups of independent detection channels on a glass substrate; self-assembling cysteamine on the surface of the gold working electrode to form an amination interface; sequentially carrying out covalent immobilization on the ZnCdS (at) ZnS quantum dots and different fungaltoxin aptamers through amidation reaction; and finally, sealing by using bovine serum albumin. The prepared sensing electrode has a unique complementary segmented interdigital structure, comb tooth parts of the gold working electrode and the platinum counter electrode are arranged in a staggered and non-contact manner, and annular parts are arranged in a concentric circle manner, so that electric field interference between channels is effectively avoided. The invention further provides application of the electrode, chemical labeling is not needed in the whole process of the method, high-sensitivity, high-specificity and parallel in-situ detection of high-harm mycotoxins such as ochratoxin A and zearalenone is achieved, the integration level is high, and the electrode is suitable for on-site rapid screening of food safety.

The invention discloses a zearalenone degrading enzyme and an application thereof. The amino acid sequence of the zearalenone degrading enzyme is as shown in SEQ ID NO: 2. The invention provides a gene sequence, an amino acid sequence and an expression system of a novel zearalenone degrading enzyme OC4 from marine microorganisms, and verifies the application of the enzyme in the aspect of zearalenone degradation. Experimental research shows that the zearalenone degrading enzyme OC4 disclosed by the invention has a degradation rate up to 62.79% for ZEN (Zearalenone) with the final concentration of 20g / ml within 10min, and shows relatively high degradation efficiency. The ZHD-OC4 can maintain activity at the temperature of 10-50 DEG C and the pH value of 4.0-9.0 and within the pH range, and shows that the ZHD-OC4 has relatively high stability to the environment. Therefore, the enzyme has very high application potential in degradation of zearalenone in the fields of grain storage, food processing, feed preparation and the like.

The utility model discloses equipment for detecting zearalenone, which belongs to the technical field of food detection, and comprises a shell mechanism and an indicating mechanism, a driving mechanism is fixed in the shell mechanism, a centrifugal mechanism is meshed and connected with the driving mechanism, and the centrifugal mechanism is connected with the indicating mechanism. An indicating mechanism is further fixed to the inner side of the shell mechanism, and a lighting mechanism is connected to the indicating mechanism in a clamped mode. Through the arrangement of the driving mechanism, the centrifugal mechanism, the indicating mechanism, the lighting mechanism and the control mechanism, the device can automatically calculate a balancing hole position and carry out lighting indication, the operation convenience is improved, balancing errors are effectively avoided, and through the arrangement of the driving mechanism, the centrifugal mechanism and the indicating mechanism, the service life of the device is prolonged. The maximum rotating speed of the device is effectively increased, the applicability of the device is improved, effective protection can be provided when the device is used for frying, and damage to other parts is reduced.

The application discloses a white goat feed containing zearalenone degrading enzyme, and comprises a basic daily ration and zearalenone degrading enzyme, wherein the addition amount of the zearalenone degrading enzyme is 0.01%-0.10% of the total weight of the feed. The zearalenone in the feed is subjected to enzymatic degradation reaction in the digestive tract of the animal by adding the zearalenone degrading enzyme in the basic daily ration of the white goat, so that the residual amount of the zearalenone in the gastrointestinal tract is reduced, the estrogen-like toxic effect of the zearalenone on the female white goat is reduced, and problems such as vulva swelling, abnormal reproductive organs and abnormal follicular development of the ovary caused by zearalenone pollution are effectively relieved.

The invention relates to the technical field of corn oil processing, in particular to a method for reducing zearalenone in corn oil. The method comprises the following steps: 1) mixing corn crude oil with a sodium hydroxide solution to obtain a mixture; the concentration of the sodium hydroxide solution is 10-40%; (2) shearing and homogenizing the mixture, centrifugally separating the mixture subjected to shearing and homogenizing, and taking supernatant oil, and the rotating speed of shearing and homogenizing is 1000-7000 r / min. The method for reducing zearalenone in corn oil provided by the invention can well improve the quality of corn oil, and realizes better removal of ZEN (Zearalenone).

The invention discloses a laccase mutant and application of the laccase mutant in oxidative conversion of zearalenone (ZEN) and / or aflatoxin (AFB1). According to the invention, laccase Lac5 of Coprinus cinerea is taken as a starting enzyme, and mutation is designed by analyzing a structure-function relationship through molecular docking. After induced expression of engineering bacteria containing mutant genes, mutant laccase Lac5-T485H with improved detoxification efficiency is obtained through screening. When the enzyme with the same protein mass is used, the conversion efficiency of the mutant Lac5-T485H on ZEN is obviously improved compared with that of Lac5, and the mutant enzyme has application value in oxidative conversion of zearalenone (ZEN) and aflatoxin (AFB1).

The present invention relates to polypeptides for enzymatically detoxifying zearalenone, which are monooxygenases that convert the keto group at position 7 of zearalenone into an ester group, in particular an amino acid sequence selected from the group consisting of SEQ ID No. 1, 2 and 3 or a functional variant thereof, wherein there is at least 60%, preferably at least 70%, more preferably at least 80%, and most preferably at least 90% sequence identity between the functional variant and at least one of said amino acid sequences.