195 results about "Zearalenone" patented technology

The invention discloses streptomyces allogeri and an application thereof in biological prevention and control of toxin-producing fungi. In particular to streptomyces allorgeus ZxBac193 CGMCC (China General Microbiological Culture Collection Center) No.32341 and an application thereof. The streptomyces allorgeus ZxBac193 shows a strong antagonistic effect on toxin-producing fungi such as aspergillus flavus, aspergillus ochraceus, fusarium graminearum, fusarium oxysporum, penicillium citrinum and penicillium islanigerum; the compound can inhibit the growth of aflatoxin producing fungi, ochratoxin producing fungi, deoxynivalenol producing fungi, zearalenone toxin producing fungi, fumonisins producing fungi, citrinin producing fungi and island penicillin producing fungi, and can be prepared into various biological control products aiming at mycotoxins, such as biopesticides, antifungal agents and the like. The compound is used for inhibiting toxic fungi in the environment and preventing or relieving mycotoxin pollution, and has good development and application prospects in the fields of prevention and treatment of fungal pollution of food crops and the like.

The present application relates to a novel zearalenone-degrading enzyme and a use thereof.

The invention belongs to the technical field of gene engineering, and relates to high-temperature-resistant laccase, a gene and application of the high-temperature-resistant laccase in mycotoxin degradation. The amino acid sequence of the laccase TtLac-4 is as shown in SEQ ID NO: 1. On the basis of wild laccase, site-directed mutagenesis modification is carried out through artificial rational design, and an amino acid sequence of the modified high-temperature-resistant laccase and a nucleotide sequence of the artificially optimized high-temperature-resistant laccase gene are obtained. The high-temperature-resistant laccase obtained through gene coding of the high-temperature-resistant laccase has the remarkably-improved high-temperature-resistant characteristic, and the optimum temperature reaches 90 DEG C. The degradation rate of the laccase TtLac-4 obtained by the invention on mycotoxin aflatoxin B1 and zearalenone reaches 100%. The invention lays a foundation for a green degradation process and application of mycotoxin degradation.

The invention relates to the technical field of analysis and detection, in particular to a fluorescent switch sensor based on quantum dot-nano porphyrin and application. The specific technical scheme is as follows: the fluorescent switch sensor is constructed by utilizing cadmium telluride quantum dots modified by mercaptosuccinic acid and a 5, 10, 15, 20-tetra (4-nitrophenyl) porphyrin nano material modified by a cationic surfactant hexadecyl trimethyl ammonium bromide. And the method has a good enrichment effect on zearalenone. The sensor has high sensitivity, high selectivity and anti-interference performance, can accurately analyze trace zearalenone in actual grain samples (corn, rice, soybean and the like), and has the advantages of simplicity in operation, low detection limit, high sensitivity, low cost and the like.

The invention belongs to the technical field of bioengineering, and particularly relates to a zearalenone toxin degrading enzyme variant and application thereof. The amino acid sequence of the zearalenone toxin degrading enzyme is as shown in SEQ ID NO.2, or the zearalenone toxin degrading enzyme with the amino acid sequence as shown in SEQ ID NO.2 is obtained through amino acid mutation. The zearalenone toxin degrading enzyme mutant is obtained through mutation screening, and compared with a wild type, the zearalenone toxin degrading enzyme mutant has the advantages that the zearalenone degrading capability is obviously improved; besides, the zearalenone toxin degrading enzyme is expressed by using alfalfa, the zearalenone toxin degrading enzyme with biological activity is easy to obtain, and the zearalenone toxin degrading enzyme has certain application potential in prevention and treatment of animal poisoning caused by zearalenone toxin pollution in agriculture and animal husbandry production.

The invention discloses a preparation method of a mycotoxin degrading enzyme intelligent slow-release feed additive, and relates to the technical field of feed additive production, a double-emulsion embedding technology is adopted, enzyme is embedded in a multi-layer shell composed of chitosan, sodium alginate and an enteric polymer Eudragit S100, and then Ca < 2 + > ion cross-linking solidification is performed to obtain the mycotoxin degrading enzyme intelligent slow-release feed additive. And finally, freeze-drying or spray-drying to obtain the core-shell structure microcapsule. The obtained microcapsules are compounded with functional carriers such as yeast cell walls, sodium aluminosilicate, mannan oligosaccharide, talcum powder and the like to prepare finished products which can be directly added into various feeds. The release rate of the additive in simulated gastric juice with the pH value of 2.0 for 4 hours is lower than 15%, the release rate of the additive in simulated intestinal juice with the pH value of 6.8 for 6 hours exceeds 90%, the enzyme activity can be effectively protected, and targeted release of intestinal tracts is achieved; meanwhile, the compound carrier has a synergistic adsorption effect on various mycotoxins, and the degradation rates of aflatoxin B1, zearalenone and ochratoxin A in an in-vitro experiment respectively reach 87% or above.

The invention discloses a mycotoxin degrading bacterium (Lactobacillus plantarum) R4-30 and application thereof, the strain is preserved in the China Center for Type Culture Collection, the preservation number is CCTCC No: M2018437, and the strain is obtained by screening in Guangxi sugarcane tail leaf silage. The strain can inhibit the growth of aspergillus flavus and fusarium graminearum, so that the production of mycotoxin is reduced, and the mycotoxin can be degraded. The aflatoxin B1 degradation rate of the strain is as high as 91.21% when the bacterial concentration is 12 * 10 < 8 > cfu / ml, the pH value is 2 and the culture time is 16 days; when the bacterium concentration is 3 * 10 < 8 > cfu / ml, the pH value is 6 and the culture time is 12 days, the zearalenone degradation rate is as high as 94.56%; when the bacterial concentration is 12 * 10 < 8 > cfu / ml, the pH value is 2 and the culture time is 16 days, the degradation efficiency of AFB1 and ZEN in the mango peel fermented feed is remarkably improved, the degradation rates of AFB1 and ZEN under the conditions reach 91.2% and 58.16% respectively, the nutritional quality is high, the fermentation quality is good, chemical additives are not needed, and the method is suitable for green detoxification treatment of agricultural products and feed.

The invention belongs to the technical field of materials and harmful pollutant removal, and particularly relates to a graphite-phase carbon material for adsorbing and removing mycotoxin in food as well as a preparation method and application of the graphite-phase carbon material. The preparation method of the graphite-phase carbon material comprises the following steps: at normal temperature and normal pressure, ball-milling graphite or a mixture of graphite and ferroferric oxide into solid powder, so as to prepare the graphite-phase carbon material for adsorbing and removing mycotoxin in food. The graphite phase carbon material is good in adsorption effect; the composition can be used for preparing aflatoxin, zearalenone, ochratoxin, deoxynivalenol and T-2 toxin in various oils such as peanut oil, soybean oil, corn germ oil, rapeseed oil, sesame oil, walnut oil, linseed oil, rice bran oil, wheat germ oil, edible plant blend oil, sunflower seed oil, olive oil, camellia oleosa seed oil, perilla seed oil and almond oil. And various fungaltoxins such as fumonisins are removed, so that the pollution level of the fungaltoxins in the edible vegetable fat can be effectively reduced.

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.

The invention belongs to the technical field of enzyme engineering, and particularly relates to a codon optimized superoxide dismutase AfSOD gene and application thereof in degradation of aflatoxin B1 and zearalenone. Under the conditions that the pH is 7, the temperature is 40 DEG C and the enzyme addition amount is 10 micrograms, the degradation rate of the AFB1 reaches 99.08% within 24 hours, and the degradation rate is kept to be 80% or above within 40-80 DEG C; under the conditions that the pH is 8, the temperature is 60 DEG C and the enzyme addition amount is 20 micrograms, the degradation rate of ZEN reaches 85.1% in 24 hours, and the degradation rate is kept to be 80% or above within 50-80 DEG C; the result shows that AfSOD is a toxin degrading enzyme which can tolerate a certain degree of high temperature; the degradation rates of AFB1 and ZEN in polluted peanut powder or corn powder are 73.7% and 88.2% respectively; the invention provides a new candidate for detoxification of AFB1 and ZEN in food or feed, and has a good application prospect.

The invention belongs to the technical field of bioengineering and food safety, and particularly relates to a fusion enzyme for degrading aflatoxin B1 (AFB1) and / or zearalenone (ZEN) and application of the fusion enzyme. The fusion enzyme S1-AsDPP III disclosed by the invention can effectively degrade AFB1 and ZEN, the fusion enzyme is obtained by fusing a section of self-assembled amphiphilic oligopeptide S1 sequence at the N end of wild type AsDPP III, and the thermal stability of the fusion enzyme and the amphipathy of the fusion enzyme in an oil-water coexistence system can be remarkably improved. Under mild reaction conditions, the fusion enzyme can efficiently degrade AFB1 and ZEN in vegetable oil, and is especially suitable for detoxification treatment of common edible oil such as peanut oil and corn oil. The invention provides a green, safe and efficient scheme for removing fungaltoxin from grease food, and the method has a good industrial application prospect.

The invention discloses a preparation method and application of immobilized laccase at room temperature, and the preparation method comprises the following steps: step 1, weighing laccase, dissolving the laccase in a sodium acetate-acetic acid buffer solution, carrying out magnetic stirring, and then adding a sodium hydroxide solution containing trimesic acid to form a mixed solution; step 2, adding an aqueous solution containing ferric ions into the mixed solution, magnetically stirring, standing and aging in a refrigerator, and centrifugally collecting a solid product; and step 3, re-suspending the washed precipitate in a polyvinylpyrrolidone aqueous solution, fully dispersing, and then drying to obtain the immobilized laccase, which is recorded as Lacc-Fe-BTC. The immobilized laccase prepared by the invention can be used for rapidly and efficiently degrading aflatoxin B1 and zearalenone, and recycling and reutilization of the enzyme after reaction can be realized.

The invention discloses application of glycyrrhetinic acid in reducing reproductive toxicity of zearalenone to replacement gilts, and belongs to the technical field of animal breeding. Zearalenone can promote advanced development of internal and external reproductive organs such as uterus, ovary, vagina and the like, cause pathological changes of the reproductive organs, disturb the estrus cycle and the like to exert reproductive toxicity on the replacement gilts, so that the reproductive potential of the replacement gilts is influenced. By adding glycyrrhetinic acid into the replacement gilt feed, the development of the uterus, ovary and follicle of the replacement gilt can be promoted, the harm of ZEA to the ovary and uterus of the replacement gilt is reduced, and the estrus initiation of the replacement gilt is improved, so that the breeding potential of the gilt is improved, and the annual productivity of the replacement gilt is improved.

The invention discloses application of trans-anisd in relieving toxicity of zearalenone in animals, and belongs to the technical field of prevention and treatment of mycotoxin. The invention provides an application of trans-anisd in preparation of a medicine or feed for relieving zearalenone poisoning of animals. The trans-anisd is proved to be capable of effectively relieving piglet reproductive toxicity caused by zearalenone, improving uterine organ indexes and ovarian organ indexes and ensuring piglet health and reproductive system development, and a new method is provided for zearalenone detoxification.

The invention discloses a construction method of an efficient zearalenone degrading enzyme, and belongs to the field of enzyme engineering. According to the present invention, D92K / G114L / D117W / V140R / V153M / D157V / S220W combined mutation is performed on a wild type zearalenone degrading enzyme represented by an amino acid sequence such as SEQ ID NO.1, and an AEAEAAHAEAEAAHAGGGSGGGGSEP polypeptide is fused at the N end of the wild type zearalenone degrading enzyme, such that the thermal stability and the enzymatic activity under the acidic condition are improved; compared with a wild type zearalenone degrading enzyme, the thermal stability of the constructed zearalenone degrading enzyme mutant and the enzyme activity under animal stomach conditions (37 DEG C, pH 4.2) are obviously improved; the zearalenone can be used for preparing food additives or feed additives so as to reduce the content of zearalenone in animal bodies and improve the quality of meat in the breeding industry.

The invention belongs to the technical field of agricultural biology, and particularly relates to zearalenone hydrolase ZHRnZ as well as a coding gene, a preparation method and application thereof. The amino acid sequence of the zearalenone hydrolase ZHRnZ provided by the invention is as shown in SEQ ID NO.1, and the nucleotide sequence of the coding gene of the zearalenone hydrolase ZHRnZ is as shown in SEQ ID NO.2. The hydrolase provided by the invention has relatively strong degradation capability on zearalenone, derivatives of zearalenone and macrolide antibiotics, and is high in degradation speed. The method has a huge application prospect in the fields of degradation of feed, food, biomass energy, Chinese herbal medicine mycotoxin and antibiotics.

The invention relates to the technical field of zearalenone detection, in particular to zearalenone immunomagnetic beads as well as a preparation method and application thereof. The method specifically comprises the following steps: (1) cleaning N-hydroxysuccinimide activated agarose magnetic beads with ethanol, removing ethanol, adding a 2-morpholinoethanesulfonic acid buffer solution and a ZEN monoclonal antibody for mixed incubation, and discarding an upper solution; and (2) adding a glycine-containing buffer solution into the incubated magnetic beads, mixing, sealing, carrying out magnetic separation, and leaching to obtain the ZEN immunomagnetic beads. According to the method, IMBs high-flux full-automatic purification is combined with a high performance liquid chromatograph, the method which is rapid and convenient and can automatically treat ZEN in feed and feed raw material samples in batches is established, and the first feed industry association group standard about the IMBs purification technology is researched and formulated on the basis of the method; and a method reference is provided for prevention and control of fungaltoxin pollution in basic detection laboratories and feed enterprises.

The invention discloses application of polydatin in preparation of a medicine for relieving hepatotoxicity caused by zearalenone, and belongs to the technical field of biological medicine. The invention reveals that polydatin inhibits hepatotoxicity caused by zearalenone through targeted xanthine oxidase for the first time, so that the toxicity of zearalenone to an organism is relieved. Polydatin can be directly combined with xanthine oxidase to inhibit the catalytic activity of xanthine oxidase, so that the oxidative stress injury of the liver after ZEA exposure is reduced, meanwhile, the content of malondialdehyde (MDA) in the liver can be remarkably reduced, the activity of superoxide dismutase (SOD) is improved, the liver oxidation-antioxidant balance is recovered, and liver cells are protected from oxidative injury of ZEA. The invention provides a new scientific basis and development direction for application of polydatin in the fields of mycotoxin detoxification, oxidation resistance, liver protection and the like.

The invention discloses a waste liquid treatment device for preparation of a zearalenone combined adsorbent, relates to the technical field of waste liquid multi-stage treatment, and solves the problems of high cost and vibration of the device when the waste liquid is subjected to multi-stage treatment. Meanwhile, the problems that the efficiency is low and the effect is poor when the waste liquid is treated are solved. The waste liquid treatment device for preparing the zearalenone combined adsorbent comprises a first-stage treatment tank, a second-stage treatment tank, a waste recovery assembly, a multi-stage waste liquid treatment mechanism and a base, the eccentric position of the bottom of the first-stage treatment tank is installed at the top of the second-stage treatment tank through a supporting column, and the waste recovery assembly is arranged at the inner bottom of the first-stage treatment tank; and the waste recovery assembly extends to the bottom of the primary treatment tank. According to the waste liquid treatment device, particle impurities and chemical components of waste liquid can be treated at the same time, and the waste liquid treatment effect and efficiency are improved. And meanwhile, the waste liquid can be treated only through operation of a group of direct current motors, so that the vibration and the cost are low.

The present invention relates to a mycotoxin degrading agent and its application, belonging to the field of agricultural biology. The present invention provides a highly efficient mycotoxin degrading agent that can be used for mycotoxin degradation. The mycotoxin degrading agent of the present invention comprises bacterial laccase Lac_P.E. and an artificial mediator, and can efficiently degrade mycotoxins, including aflatoxin B1 and zearalenone, and is widely used in the field of mycotoxin detoxification.

The invention discloses bacillus subtilis K6 which is preserved in the China Center for Type Culture Collection, and the preservation number of the bacillus subtilis K6 is CCTCC (China Center for Type Culture Collection) NO: 20231096. The invention further discloses application of the bacillus subtilis K6 in detoxification of the corn germ meal, the bacillus subtilis K6 is used for fermenting and detoxifying polluted corn germ meal, the degradation rate of zearalenone in the corn germ meal reaches 95% or above, the degradation rate of aspergillus flavus B1 in the corn germ meal reaches 90% or above, toxic substances can be effectively degraded, the detoxification activity is high, and the bacillus subtilis K6 can be applied to detoxification of the corn germ meal. And the method has good tolerance to high temperature and low pH, has stable detoxification capability, and can remove recessive zearalenone toxin contained in the cake meal at the same time. The utilization value of the corn germ meal can be improved, the nutrient components of the corn germ meal can be improved, and a good technical foundation is laid for deep processing of the corn germ meal.

The invention discloses a preparation method of an enzyme biosensor for simultaneously detecting multiple mycotoxins, the sensor and application. According to the method, the carbon nano tube-nano gold laccase electrochemical biosensor is prepared through a layer-by-layer dispensing method, the preparation process is simple and rapid, operation is easy, the cost is low, a carbon nano tube modified electrode has reusability, the catalytic activity and stability of an enzyme modified by a nano material are remarkably improved, and the electrochemical biosensor has good application prospects. The obtained biosensor can perform high-flux simultaneous detection on mycotoxins such as aflatoxin B1, zearalenone and the like, is high in detection sensitivity, good in selectivity and small in reagent consumption, has the detection limit of the aflatoxin B1 of 0.012 mu mol / L and the detection range of 0.05-100 mu mol / L, has the detection limit of the zearalenone of 0.007 mu mol / L and the detection range of 0.01-120 mu mol / L, has the low detection limit and the wide detection range, and can be widely applied to detection of mycotoxins such as aflatoxin B1, zearalenone and the like. The problems of low flux, complex electrode preparation and poor stability and sensitivity of a traditional electrochemical detection mode are solved, and the method can be widely applied to rapid detection under the condition of co-pollution of multiple fungimycin in cereals.

The invention discloses bacillus subtilis IFST-Xd-2, and the preservation number of the bacillus subtilis IFST-Xd-2 is CGMCC (China General Microbiological Culture Collection Center) No. 29966. The invention relates to a mycotoxin degrading agent which comprises bacillus subtilis (IFST)-Xd-2 and a mycotoxin degrading bacterium agent containing bacillus subtilis (IFST)-Xd-2. The invention relates to bacillus subtilis IFST-Xd-2 and an application of a mycotoxin degrading bacterial agent of the bacillus subtilis IFST-Xd-2. The invention also discloses a method for simultaneously degrading various mycotoxins. The bacillus subtilis IFST-Xd-2 disclosed by the invention has the advantages of heat resistance, alkali resistance, capability of efficiently degrading aflatoxin B1 and zearalenone at the same time, and the like.

The invention relates to the technical field of agricultural biology, in particular to a high-activity multi-copper oxidase mutant V286N and application thereof in mycotoxin degradation. The amino acid sequence of the multi-copper oxidase mutant is as shown in SEQ ID NO: 2. The multi-copper oxidase mutant provided by the invention has higher specific activity. Compared with wild type multi-copper oxidase, the multi-copper oxidase mutant MCO-V286N provided by the invention has the advantages that the specific activity is improved by 0.8 time, the degradation efficiency on mycotoxin zearalenone is improved by 0.4 time, the production and application cost is effectively reduced, and the multi-copper oxidase mutant MCO-V286N has important application value and technical significance in wide application of the multi-copper oxidase in the field of mycotoxin detoxification of food and feed.

The invention relates to the technical field of organic functional material synthesis and mycotoxin removal, in particular to a magnetic covalent organic framework for adsorbing zearalenone and a preparation method and application thereof.The magnetic covalent organic framework is Fe3O4 (at) COF-VPBA and is prepared from 1, 3, 5-tris (4-aminophenyl) benzene, 2, 5-dimethoxy terephthalaldehyde, 4-alkenyl phenylboronic acid, boron trifluoride diethyl etherate, 2, 3-dichloro-5, 5-di (4-aminophenyl) benzene, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2 The catalyst is prepared from 2, 6-dicyano-1, 4-benzoquinone and nano ferroferric oxide through a four-component one-pot in-situ Povarov reaction. According to the method, the process is simplified, the defects of a fractional step method are avoided, due to specific covalent binding of boric acid groups and ZEN catechol hydroxyl groups, the adsorption capacity and the adsorption rate are remarkably superior to those of traditional and unfunctionalized adsorption materials, the adsorption rate still exceeds 90% after acetonitrile is eluted and regenerated and is repeatedly used for more than 5 times, and the comprehensive requirements of high selectivity, high adsorption capacity, easiness in separation and recyclability are met.

The invention provides a compound preparation for reducing the toxic effect of zearalenone of bred animals as well as a preparation method and application of the compound preparation, and belongs to the technical field of medicines for livestock and poultry. The invention provides a compound preparation for reducing the toxic effect of zearalenone of bred animals. The compound preparation is prepared from the following components in parts by weight: 40 to 50 parts of total flavonoids of radix astragali seu hedysari, 0.1 to 0.4 part of selenium-enriched yeast, 10 to 15 parts of modified montmorillonite and 1 to 4 parts of vitamin C. The four components in the compound preparation are mutually matched and synergistically synergized to reduce the toxic effect of zearalenone and resist zearalenone poisoning of bred animals, and the compound preparation has high safety, so that the production performance of the bred animals and the quality of animal-derived products are improved, the green and healthy development of animal husbandry is promoted, the preparation method is simple, the cost is low, and the compound preparation is suitable for industrial production. The method is suitable for large-scale production and application.

The invention relates to a bacillus velezensis strain resistant to high temperature and alkali, and belongs to the technical field of microbial detoxification and feed safety. The bacillus velezensis B.26 strain with the preservation number of CGMCC (China General Microbiological Culture Collection Center) No.34475 is provided aiming at the problems that in the prior art, the thermal stability of zearalenone (ZEN) degrading enzyme is insufficient, the efficiency is low in an alkaline environment, and toxic metabolites are easily generated by traditional strains. CotA laccase and peroxide reductase Prx secreted by the strain can efficiently degrade ZEN and derivatives alpha-zearalenol and beta-zearalenol, the products are low-toxicity C17H24O4 and C12H16O4, and harmful by-products such as alpha-ZEL / beta-ZEL and the like do not exist. The strain and recombinase thereof are suitable for a high-temperature alkaline environment for feed processing, and can be applied to biological detoxification of ZEN pollution in food and feed on a large scale through an immobilized carrier.

This invention relates to the field of enzyme engineering technology, and in particular to a highly efficient lactone hydrolase mutant for degrading zearalenone and its applications. This lactone hydrolase mutant uses the lactone hydrolase gene from Monosporascus sp. GIB2 as a template, and performs a site-directed mutation at amino acid position 134 to obtain L134A, L134V, L134I, and L134M mutants. Under optimal conditions of pH 9.0 and 60℃, these single-point mutants can efficiently degrade zearalenone (ZEN) within 3 minutes. The enzyme activity for degrading zearalenone is significantly improved compared to the original enzyme, with degradation activities increasing by 1.22 (L134A), 1.25 (L134V), 1.17 (L134I), and 1.14 (L134M), respectively, demonstrating significant applications and economic value in the feed industry.

The present invention relates to the technical field of genetic engineering. Provided is a method for constructing an efficient zearalenone-degrading enzyme in the gastric environment of a pig. In the zearalenone-degrading enzyme as shown in SEQ ID NO: 1 that is taken as the parent, the amino acid at position 92, the amino acid at position 114, the amino acid at position 117, the amino acid at position 140, the amino acid at position 153, the amino acid at position 157 and the amino acid at position 220 are respectively mutated into lysine, leucine, tryptophan, arginine, methionine, valine and tryptophan to obtain the mutant. The obtained zearalenone-degrading enzyme mutant has high enzymatic activity and thermal stability, and is better adapted to the internal environment of pigs.

The invention aims to provide a microbial feed additive for preventing zearalenone poisoning, which can obviously improve the reproductive performance and growth performance of livestock and poultry and enhance the immunity of animals. The composite microbial agent mainly comprises the following components in parts by weight: 1-5 parts of DL-alpha-tocopheryl acetate, 1-3 parts of superoxide dismutase (SOD), 5-10 parts of coated vitamin C and 82-93 parts of a bacillus subtilis microbial agent. 100 parts by weight of feed contains 0.005-0.01 part by weight of the feed additive disclosed by the invention. The embodiment 1 of the invention is preparation of bacillus subtilis for degrading ZEA, and the embodiment 2 of the invention is preparation of the microbial feed additive according to the content of the invention. The embodiment 3 is a detoxification experiment of the microbial feed additive on the ZEA in the young sow feed. An embodiment 3 verifies that the traditional Chinese medicine composition can well prevent the problems of reproductive disorder, low production capacity, reduced immunity and the like caused by ZEA poisoning of young sows.