113 results about "Zearalenone" patented technology

The invention relates to the technical field of analysis and detection, in particular to a fluorescent switch sensor based on quantum dot-nano porphyrin and application. The specific technical scheme is as follows: the fluorescent switch sensor is constructed by utilizing cadmium telluride quantum dots modified by mercaptosuccinic acid and a 5, 10, 15, 20-tetra (4-nitrophenyl) porphyrin nano material modified by a cationic surfactant hexadecyl trimethyl ammonium bromide. And the method has a good enrichment effect on zearalenone. The sensor has high sensitivity, high selectivity and anti-interference performance, can accurately analyze trace zearalenone in actual grain samples (corn, rice, soybean and the like), and has the advantages of simplicity in operation, low detection limit, high sensitivity, low cost and the like.

The invention belongs to the technical field of bioengineering, and particularly relates to a zearalenone toxin degrading enzyme variant and application thereof. The amino acid sequence of the zearalenone toxin degrading enzyme is as shown in SEQ ID NO.2, or the zearalenone toxin degrading enzyme with the amino acid sequence as shown in SEQ ID NO.2 is obtained through amino acid mutation. The zearalenone toxin degrading enzyme mutant is obtained through mutation screening, and compared with a wild type, the zearalenone toxin degrading enzyme mutant has the advantages that the zearalenone degrading capability is obviously improved; besides, the zearalenone toxin degrading enzyme is expressed by using alfalfa, the zearalenone toxin degrading enzyme with biological activity is easy to obtain, and the zearalenone toxin degrading enzyme has certain application potential in prevention and treatment of animal poisoning caused by zearalenone toxin pollution in agriculture and animal husbandry production.

The invention discloses a preparation method of a mycotoxin degrading enzyme intelligent slow-release feed additive, and relates to the technical field of feed additive production, a double-emulsion embedding technology is adopted, enzyme is embedded in a multi-layer shell composed of chitosan, sodium alginate and an enteric polymer Eudragit S100, and then Ca < 2 + > ion cross-linking solidification is performed to obtain the mycotoxin degrading enzyme intelligent slow-release feed additive. And finally, freeze-drying or spray-drying to obtain the core-shell structure microcapsule. The obtained microcapsules are compounded with functional carriers such as yeast cell walls, sodium aluminosilicate, mannan oligosaccharide, talcum powder and the like to prepare finished products which can be directly added into various feeds. The release rate of the additive in simulated gastric juice with the pH value of 2.0 for 4 hours is lower than 15%, the release rate of the additive in simulated intestinal juice with the pH value of 6.8 for 6 hours exceeds 90%, the enzyme activity can be effectively protected, and targeted release of intestinal tracts is achieved; meanwhile, the compound carrier has a synergistic adsorption effect on various mycotoxins, and the degradation rates of aflatoxin B1, zearalenone and ochratoxin A in an in-vitro experiment respectively reach 87% or above.

The invention belongs to the technical field of food safety detection, and discloses a preparation method of an aptamer colorimetric sensor constructed by amorphous cobalt-based nano-enzyme and detection application of the aptamer colorimetric sensor to zearalenone (ZEN) in food, and the preparation method comprises the following steps: constructing amorphous Co3O4 (at) CN / SiO2 nano-enzyme; and constructing an aptamer (Apt) colorimetric sensor to detect the ZEN. The amorphous Co-based nano material is simple in preparation process, high in catalase-like activity, easy to modify by biological materials and low in cost. The colorimetric sensor for detection is based on Co3O4 (at) CN / SiO2 nano-enzyme adsorption aptamers, the construction process is simple, the used aptamers are TCATCTATGGTACATACTATCTGTAATGTGATATG and are marked as ZEN-Apt, a detection system of the colorimetric sensor is characterized in that Co3O4 (at) CN / SiO2, ZEN-Apt and ZEN with different concentrations are incubated at a proper temperature to form a competitive reaction, and ZEN-Apt and ZEN are preferentially combined, so that the aptamers on the nano-enzyme are reduced. When the sensor constructed by the invention is used for detecting and analyzing unknown ZEN in an actual sample, the operation is convenient, the specificity is good, the sensitivity is high, the speed is high, and the repeatability and the reproducibility are good.

The invention belongs to the technical field of enzyme engineering, and particularly relates to a codon optimized superoxide dismutase AfSOD gene and application thereof in degradation of aflatoxin B1 and zearalenone. Under the conditions that the pH is 7, the temperature is 40 DEG C and the enzyme addition amount is 10 micrograms, the degradation rate of the AFB1 reaches 99.08% within 24 hours, and the degradation rate is kept to be 80% or above within 40-80 DEG C; under the conditions that the pH is 8, the temperature is 60 DEG C and the enzyme addition amount is 20 micrograms, the degradation rate of ZEN reaches 85.1% in 24 hours, and the degradation rate is kept to be 80% or above within 50-80 DEG C; the result shows that AfSOD is a toxin degrading enzyme which can tolerate a certain degree of high temperature; the degradation rates of AFB1 and ZEN in polluted peanut powder or corn powder are 73.7% and 88.2% respectively; the invention provides a new candidate for detoxification of AFB1 and ZEN in food or feed, and has a good application prospect.

The invention belongs to the technical field of bioengineering and food safety, and particularly relates to a fusion enzyme for degrading aflatoxin B1 (AFB1) and / or zearalenone (ZEN) and application of the fusion enzyme. The fusion enzyme S1-AsDPP III disclosed by the invention can effectively degrade AFB1 and ZEN, the fusion enzyme is obtained by fusing a section of self-assembled amphiphilic oligopeptide S1 sequence at the N end of wild type AsDPP III, and the thermal stability of the fusion enzyme and the amphipathy of the fusion enzyme in an oil-water coexistence system can be remarkably improved. Under mild reaction conditions, the fusion enzyme can efficiently degrade AFB1 and ZEN in vegetable oil, and is especially suitable for detoxification treatment of common edible oil such as peanut oil and corn oil. The invention provides a green, safe and efficient scheme for removing fungaltoxin from grease food, and the method has a good industrial application prospect.

The invention discloses application of polydatin in preparation of a medicine for relieving hepatotoxicity caused by zearalenone, and belongs to the technical field of biological medicine. The invention reveals that polydatin inhibits hepatotoxicity caused by zearalenone through targeted xanthine oxidase for the first time, so that the toxicity of zearalenone to an organism is relieved. Polydatin can be directly combined with xanthine oxidase to inhibit the catalytic activity of xanthine oxidase, so that the oxidative stress injury of the liver after ZEA exposure is reduced, meanwhile, the content of malondialdehyde (MDA) in the liver can be remarkably reduced, the activity of superoxide dismutase (SOD) is improved, the liver oxidation-antioxidant balance is recovered, and liver cells are protected from oxidative injury of ZEA. The invention provides a new scientific basis and development direction for application of polydatin in the fields of mycotoxin detoxification, oxidation resistance, liver protection and the like.

The invention relates to the technical field of agricultural biology, in particular to a high-activity multi-copper oxidase mutant V286N and application thereof in mycotoxin degradation. The amino acid sequence of the multi-copper oxidase mutant is as shown in SEQ ID NO: 2. The multi-copper oxidase mutant provided by the invention has higher specific activity. Compared with wild type multi-copper oxidase, the multi-copper oxidase mutant MCO-V286N provided by the invention has the advantages that the specific activity is improved by 0.8 time, the degradation efficiency on mycotoxin zearalenone is improved by 0.4 time, the production and application cost is effectively reduced, and the multi-copper oxidase mutant MCO-V286N has important application value and technical significance in wide application of the multi-copper oxidase in the field of mycotoxin detoxification of food and feed.

The invention relates to the technical field of organic functional material synthesis and mycotoxin removal, in particular to a magnetic covalent organic framework for adsorbing zearalenone and a preparation method and application thereof.The magnetic covalent organic framework is Fe3O4 (at) COF-VPBA and is prepared from 1, 3, 5-tris (4-aminophenyl) benzene, 2, 5-dimethoxy terephthalaldehyde, 4-alkenyl phenylboronic acid, boron trifluoride diethyl etherate, 2, 3-dichloro-5, 5-di (4-aminophenyl) benzene, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2, 5-dimethoxy terephthalaldehyde, 2 The catalyst is prepared from 2, 6-dicyano-1, 4-benzoquinone and nano ferroferric oxide through a four-component one-pot in-situ Povarov reaction. According to the method, the process is simplified, the defects of a fractional step method are avoided, due to specific covalent binding of boric acid groups and ZEN catechol hydroxyl groups, the adsorption capacity and the adsorption rate are remarkably superior to those of traditional and unfunctionalized adsorption materials, the adsorption rate still exceeds 90% after acetonitrile is eluted and regenerated and is repeatedly used for more than 5 times, and the comprehensive requirements of high selectivity, high adsorption capacity, easiness in separation and recyclability are met.

The invention relates to a bacillus velezensis strain resistant to high temperature and alkali, and belongs to the technical field of microbial detoxification and feed safety. The bacillus velezensis B.26 strain with the preservation number of CGMCC (China General Microbiological Culture Collection Center) No.34475 is provided aiming at the problems that in the prior art, the thermal stability of zearalenone (ZEN) degrading enzyme is insufficient, the efficiency is low in an alkaline environment, and toxic metabolites are easily generated by traditional strains. CotA laccase and peroxide reductase Prx secreted by the strain can efficiently degrade ZEN and derivatives alpha-zearalenol and beta-zearalenol, the products are low-toxicity C17H24O4 and C12H16O4, and harmful by-products such as alpha-ZEL / beta-ZEL and the like do not exist. The strain and recombinase thereof are suitable for a high-temperature alkaline environment for feed processing, and can be applied to biological detoxification of ZEN pollution in food and feed on a large scale through an immobilized carrier.

This invention relates to the field of enzyme engineering technology, and in particular to a highly efficient lactone hydrolase mutant for degrading zearalenone and its applications. This lactone hydrolase mutant uses the lactone hydrolase gene from Monosporascus sp. GIB2 as a template, and performs a site-directed mutation at amino acid position 134 to obtain L134A, L134V, L134I, and L134M mutants. Under optimal conditions of pH 9.0 and 60℃, these single-point mutants can efficiently degrade zearalenone (ZEN) within 3 minutes. The enzyme activity for degrading zearalenone is significantly improved compared to the original enzyme, with degradation activities increasing by 1.22 (L134A), 1.25 (L134V), 1.17 (L134I), and 1.14 (L134M), respectively, demonstrating significant applications and economic value in the feed industry.

The invention belongs to the technical field of biology, relates to a zearalenone degrading enzyme, and particularly relates to a bacillus subtilis source zearalenone degrading enzyme, an engineering strain thereof and an enzyme preparation prepared from the bacillus subtilis source zearalenone degrading enzyme. Compared with the known zearalenone degrading enzyme, the zearalenone degrading enzyme not only has obvious structure and sequence differences, but also shows an excellent degrading effect at low concentration. The lactone hydrolase derived from bacillus is found for the first time, and the biological resource basis of zearalenone degrading enzyme is expanded. The enzyme not only has significant difference from other degrading enzymes in structure, but also shows unique characteristics in degradation mechanism. The capability of efficiently degrading zearalenone shows that the bacillus subtilis has a wide application prospect in the fields of agriculture, food industry and the like. In addition, the invention also covers the structure of a degradation product generated by the zearalenone enzyme, and provides a new perspective for understanding a zearalenone degradation mechanism.

The invention relates to the technical field of biological adsorbents, in particular to a protein nanofiber membrane zearalenone adsorbent and a preparation method thereof. According to the invention, zein is dissolved in an ethanol water solution, and then a film is prepared by an electrostatic spinning technology, so that a novel ZEN adsorbent is obtained. Compared with a traditional adsorbent, the adsorbent obtained based on the electrostatic spinning technology has the advantages that the specific surface area and adsorption sites are high, mass transfer pores are controllable, the composite design has adsorption selectivity, good flexibility and self-supporting characteristics, and the adsorbent can be accurately processed and integrated in various application scenes. The prepared adsorbent is low in raw material cost, simple and convenient in preparation process, free of toxic organic substances, easy to produce on a large scale, remarkable in ZEN adsorption effect and good in application prospect.

The present invention belongs to the technical field of zearalenone extraction and relates to a method for extracting zearalenone from corn steep liquor to prepare a crude standard. The method comprises centrifuging corn steep liquor containing ZEN to obtain a supernatant; treating the supernatant using a PA66 membrane to obtain a PA66 membrane enriched with ZEN; eluting the PA66 membrane enriched with ZEN to obtain an eluate; and purifying the eluate by rotary evaporation to obtain a crude ZEN standard. The PA66 membrane is used to enrich and extract ZEN from ZEN-contaminated corn byproducts, achieving an enrichment and extraction efficiency exceeding 90%, providing a reliable and effective method for the high-value utilization of corn byproducts. The PA66 membrane is used to efficiently and selectively adsorb and enrich ZEN to initially prepare a crude ZEN standard, providing a new approach to the preparation of ZEN standard products.

This invention provides a covalent organic material for adsorbing zearalenones (ZENs), its preparation, and its application. The covalent organic material comprises: a matrix layer formed of melamine sponge; and an adsorption layer covering at least a portion of the surface of the matrix layer, the adsorption layer being composed of a covalent organic framework structure having repeating units as shown in Formula I. This covalent organic material can efficiently and specifically adsorb zearalenones and exhibits good hydrophobicity and thermal stability, making it suitable for the rapid and accurate enrichment and detection of ZENs in complex matrix foods.

A polypeptide hydrolytically cleaving zearalenone and / or at least one zearalenone derivative is a hydrolytic enzyme having an amino acid sequence selected from the group consisting of SEQ ID No. 1-15 or a functional variant thereof, wherein the sequence identity between the functional variant and at least one of the amino acid sequences is at least 40%; and an additive comprising the polypeptide; and an isolated polynucleotide encoding the polypeptide; and a method for hydrolytically cleaving zearalenone and / or at least one zearalenone derivative with the polypeptide.

The invention belongs to the technical field of bioengineering, and particularly relates to lactone hydrolase and application thereof. The lactone hydrolase is a protein composed of an amino acid sequence as shown in SEQ ID NO. 1; the nucleotide sequence of the coding gene of the lactone hydrolase is as shown in SEQ ID NO. 2. The lactone hydrolase constructed in the invention has high catalytic performance, and 30% of zearalenone with an initial concentration of 10 [mu] g / mL can be degraded by reacting for 2 h in a reaction system composed of the lactone hydrolase as a biocatalyst, ZEN as a substrate and an MES buffer solution. The method is safe and environment-friendly, the expressed and purified lactone hydrolase can be effectively used for controlling zearalenone pollution, and the method has a wide application prospect.

The application belongs to the field of enzyme engineering, and relates to degradation of aflatoxin B1 and zearalenone. The application provides application of nitrite reductase AfNiR in simultaneous degradation of aflatoxin B1 and zearalenone. The nitrite reductase AfNiR has an optimal temperature of 40 DEG C and an optimal pH of 7.0 for degradation of AFB1. The degradation rate of the enzyme to AFB1 can reach 92.92%. Meanwhile, the nitrite reductase AfNiR can maintain a degradation rate of AFB1 of more than 80% in a temperature range of 40-70 DEG C, and is a fungal toxin degradation enzyme that can tolerate a certain degree of high temperature. The application provides a candidate enzyme with application potential for detoxification of AFB1 and ZEN in the food and feed industries.

This invention provides the use of β-glucuronidase in the preparation of an antidote for the prevention and / or treatment of zearalenone poisoning, and an antidote for the prevention and / or treatment of zearalenone poisoning, belonging to the field of feed additives. This invention, for the first time from the perspective of in vivo exposure control in animals, proposes a method to reduce the overall ZEN exposure level by inhibiting the activity of intestinal bacterial β-glucuronidase. The technical path is clear and highly operable. This is achieved through in vivo toxicokinetic parameters (AUC, C...). max Changes in (and / or MRT) objectively reflect a reduction in ZEN exposure levels in vivo, and the technical effects are quantifiable and verifiable. The β-glucuronidase inhibitors used in this invention are widely available, particularly suitable for the field of feed additives, and have promising application prospects.

The present application relates to feed additives and organic pollutant degradation technical field, specifically relates to a kind of modified biochar immobilized ZEN degradation bacteria microspheres and preparation method and application.The microsphere is by core material, inner layer wall material and outer layer wall material composition;Core material is by carrier, soluble starch and corn scab ketone degrading bacteria preparation;Carrier is by citric acid and octadecyl trimethylammonium chloride to biochar combined modification preparation;Corn scab ketone degrading bacteria is Bacillus Subtilis 168;Inner layer wall material is by sodium alginate and calcium chloride crosslinking preparation;Outer layer wall material is chitosan.The degradation bacteria microsphere of the present application can effectively maintain the activity of corn scab ketone degrading bacteria, combined with the adsorption of biochar and the biological detoxification of degradation bacteria, can realize the efficient degradation of corn scab ketone.

The present application relates to a variant polypeptide having zearalenone-degrading activity and uses thereof.

This invention relates to the X178 strain, which inhibits fungal diseases in grains and removes mycotoxins, and its applications. The X178 strain belongs to the Nocardiaceae family (…). Nocardiopsis This fungus (sp.) is deposited at the China General Microbiological Culture Collection Center (CGMCC) under accession number CGMCC No. 34027. Specifically, it exhibits inhibitory effects against grain pathogenic fungi Aspergillus flavus, Aspergillus niger, and Fusarium graminearum, and can remove two mycotoxins: aflatoxin B1 (AFB1) and / or zearalenone.

The invention discloses a monospecific monoclonal antibody for resisting zearalenone-14 glucoside and application of the monospecific monoclonal antibody. An immunogen and a coating antigen are used; the monoclonal antibody capable of monospecifically recognizing the zearalenone-14 glucoside and the rapid detection kit for detecting the zearalenone-14 glucoside are obtained through the technologies of mouse immunization, serum detection, cell fusion, monoclonal screening, ascites induced antibody and the like. The method is suitable for single-specificity trace residue detection of the zearalenone-14 glucoside in samples such as corn, rice, millet, wheat and oat, has very high recognition sensitivity to the zearalenone-14 glucoside, and realizes rapid, large-batch and low-cost detection of the zearalenone-14 glucoside.

The invention discloses a zearalenone degrading enzyme as well as a coding gene and application thereof, and belongs to the technical field of biology. The zearalenone degrading enzyme obtained by the invention is a brand-new enzyme, has better temperature and pH stability, has stronger degradation capacity on mycotoxin zearalenone, is high in degradation speed, and can be widely applied to enzymolysis of zearalenone. Therefore, a new enzyme preparation is provided for biodegradation of zearalenone, and the enzyme can be used in the industrial fields of agriculture, feed, food and the like and has good application potential, so that a good technical foundation is laid for ensuring feed safety, and harm caused by zearalenone pollution to human and livestock health is reduced.

The present application relates to the field of agricultural biotechnology, and in particular to a high-activity multicopper oxidase mutant V286N and its application in mycotoxin degradation. The amino acid sequence of the multicopper oxidase mutant is shown as SEQ ID NO: 2. The multicopper oxidase mutant provided by the present application has higher specific activity. Compared with the wild-type multicopper oxidase, the specific activity of the multicopper oxidase mutant MCO-V286N provided by the present application is increased by 0.8 times, the degradation efficiency of mycotoxin zearalenone is increased by 0.4 times, the production and application cost is effectively reduced, and the multicopper oxidase has important application value and technical significance for the wide application of the multicopper oxidase in the field of mycotoxin detoxification of food and feed.

The invention discloses an application of butyric acid or a derivative thereof in preparation of a zearalenone reproductive toxicity resisting preparation. Also disclosed is an antitoxic feed composition comprising a specific base ration and a butyric acid derivative. In-vivo and in-vitro tests and molecular mechanism researches prove that butyric acid and derivatives thereof (such as tributyrin and sodium butyrate) can effectively relieve zearalenone (ZEN)-induced animal ovary injury. The action mechanism of the traditional Chinese medicine composition is that follicular atresia is reduced, the balance of reproductive hormones (such as GnRH, E2, AMH and P4) is recovered, and clinical symptoms caused by ZEN poisoning such as vulva swelling and the like are relieved by activating a BMPs / SMAD signal channel, especially up-regulating SMAD4 protein expression and inhibiting oxidative stress (ROS) and Caspase-3 mediated granular cell apoptosis.

The application discloses a kind of feed additive and its application, it is related to feed additive technical field.The prepared feed additive of the application is by mixing sodium glucuronate, glucomannan, dimethyl cyclodextrin, diatomite and sodium lauryl sulfate, then mixed solution is reacted with calcium chloride crosslinking solution, finally form microspheres type feed additive.Compared with prior art, the prepared feed additive of the application is beneficial to the adsorption of deoxynivalenol and zearalenone, amino acid liquid, lemon yellow and titanium dioxide are mixed, then composite bacteria liquid is added to ferment, by feed additive processing, low-temperature drying can retain the nutrient components and biological activity in raw materials, and the biological fermentation protein raw material with good sensory color is obtained.

The application discloses application of an enzyme in degradation of zearalenone. The amino acid sequence of the enzyme comprises: (1) a sequence shown in SEQ ID NO. 1, or (2) an amino acid sequence obtained by substituting, deleting or adding one or at least two amino acid residues from the sequence in (1) and identical or similar in function to the sequence in (1), or (3) an amino acid sequence with at least 90% sequence homology to the sequence in (1) or (2) and identical or similar in function to the sequence in (1). The application first discovers that an enzyme derived from Xylaria multiplex has the function of degrading zearalenone, and catalyzes the degradation of zearalenone into non-toxic substances, so as to be expected to be applied in degradation of zearalenone, the degradation rate is more than 90%, and the application has substantial application value and great significance in the aspect of biological detoxification of food and feed.

The invention relates to the field of microorganisms, and discloses a lactobacillus kefir strain and an application of the lactobacillus kefir strain. The preservation number of the lactobacillus kefir is CGMCC (China General Microbiological Culture Collection Center) No.33431. The lactobacillus kefir provided by the invention can effectively remove mycotoxin, especially zearalenone, and the lactobacillus kefir is used for detoxification of mycotoxin and has important significance for guaranteeing safe production of animal husbandry and agriculture.

The present application relates to a kind of complex enzyme preparation for inhibiting zearalenone generation and its preparation method and application, belong to microorganism and food safety technical field.The complex enzyme preparation prepared in the present application contains medium-temperature alpha-amylase, glucose oxidase, mannose oligosaccharide and soluble starch, medium-temperature alpha-amylase can effectively inhibit the generation of zearalenone in peanut meal, glucose oxidase can consume oxygen and produce acid, inhibit the growth of mould, mannose oligosaccharide can efficiently adsorb the generated zearalenone, and soluble starch is a stable carrier, which can be enzymatically hydrolyzed by medium-temperature alpha-amylase to generate glucose, providing a slow-release substrate for glucose oxidase.The complex enzyme preparation product can inhibit the generation of mycotoxin in crop feed raw materials from the root, has little effect on product quality, is more friendly to the environment, and the raw materials of complex enzyme preparation are easy to obtain, low in cost and widely used.