Artificial cultivation method of xylaria fungus sclerotium

By purifying and culturing the fungi of the genus *Caryachaeus* through spore or tissue isolation and gene identification, a single strain of sclerotia was obtained, solving the problems of difficulty in harvesting wild resources and inconsistent medicinal properties, and realizing stable and efficient sclerotia cultivation and large-scale production.

CN120924408APending Publication Date: 2025-11-11RENMIN HOSPITAL OF WUHAN UNIVERSITY (HUBEI GENERAL HOSPITAL)
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202511031388.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-25
Publication Date
2025-11-11

AI Technical Summary

Technical Problem

Existing technologies make it difficult to obtain sclerotia of the genus *Carya* with uniform medicinal properties and stable efficacy in large quantities. Wild resources are difficult to harvest and the germplasm resources are mixed, resulting in inconsistent medicinal properties of *Codonopsis pilosula*.

Method used

Anthracnose spores or core tissues were obtained by spore isolation or tissue isolation. Single strains were obtained by purification culture and gene sequencing identification. After being propagated into the original strain, they were cultured in the dark on a solid culture medium. The cultivated strains were cultivated in the dark in the soil. Environmental parameters were controlled to obtain stable sclerotia.

Benefits of technology

This approach improved the quality stability and viability of sclerotia of the genus *Caryachaeus*, shortened the seed production cycle, expanded the selection of cultivation sites, reduced harvesting costs, and enabled large-scale cultivation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention discloses an artificial cultivation method of xylaria fungus sclerotium, and relates to the field of sclerotium cultivation. The method comprises the following steps: collecting xylaria producing sclerotia, obtaining spores by adopting a spore separation method or obtaining core tissues by adopting a tissue separation method, inoculating the spores or the core tissues on an enriched PDA culture medium to be cultured into bacterial colonies, selecting hyphae with vigorous growth vigor at the edges of the bacterial colonies, and performing purification culture until a mother strain only containing a single strain is obtained; performing gene sequencing to identify the strain; propagating the mother strain to obtain an original strain, inoculating the original strain into a sterilized solid culture medium, culturing in a dark place to obtain a cultivated strain, placing the cultivated strain on soil, reserving a space for sclerotium development around the cultivated strain, culturing in the dark place for 33-90 days, and harvesting the sclerotium. The xylaria sclerotium with single germplasm can be cultivated on a large scale, and the problems of wild resource shortage and germplasm mixing are effectively solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of sclerotium cultivation, and in particular to a method for the artificial cultivation of sclerotia of fungi of the genus *Caryachaeus*. Background Technology

[0002] *Carya* is a genus within the family Caryaceae of the phylum Ascomycota, comprising over 300 species worldwide, with more than 100 reported in my country. Several species in this genus produce sclerotia, commonly known as "Wuling Shen" in traditional Chinese medicine, also called Wuling Shen, Leizhenzi, Wuli Shen, and Jizongdan. According to the *Sichuan Materia Medica*, Wuling Shen has the effects of dispelling dampness and calming the nerves, stopping palpitations, and lowering blood pressure; it can be used to treat insomnia, palpitations, epistaxis, hypertension, and burns.

[0003] Early studies suggested that *Cynoglossum var. cinnamomea* was the sclerotium of *Cynoglossum var. cinnamomea*, but recent research indicates that the *Cynoglossum var. cinnamomea* used in traditional medicine contains sclerotia from several other species within the genus *Cynoglossum*, resulting in inconsistent medicinal properties and efficacy. Furthermore, wild *Cynoglossum var. cinnamomea* grows in abandoned termite nests in a unique environment, sometimes extending several meters underground, making harvesting extremely difficult. The diverse species within the *Cynoglossum* genus, with many having similar fruiting body morphologies, further complicates the process, making it challenging to obtain large quantities of single-species *Cynoglossum* sclerotia with uniform medicinal properties and stable efficacy. Summary of the Invention

[0004] In view of the shortcomings of the above-mentioned related technologies, this application provides a method for artificially cultivating sclerotia of the genus *Caryachaeus*.

[0005] The method for artificially cultivating sclerotia of the genus *Caryachaeus* provided in this application adopts the following technical solution: A method for artificially cultivating sclerotia of the genus *Caryachaeus* includes the following steps: collecting sclerotia-producing *Caryachaeus*, obtaining spores using a spore isolation method or obtaining core tissue using a tissue isolation method, inoculating the spores or core tissue onto a PDA-enriched medium to cultivate into colonies, selecting vigorous hyphae from the edge of the colonies for purification and culture until a mother culture containing only a single strain is obtained, and identifying the strain through gene sequencing. The mother culture is propagated to obtain the original culture. The original culture is inoculated into a sterilized solid culture medium and cultured in the dark to obtain the spore. The spore is placed on the soil with space reserved around it for sclerotium development. It is cultured in the dark for 33–90 days, and then the sclerotia are harvested.

[0006] Preferably, the spore isolation method includes the following steps: taking the fruiting body of *Carya carnosa*, washing it, and scraping off the mature spores from the fruiting body.

[0007] Preferably, the tissue separation method includes the following steps: taking the fruiting body or mycelial cord of *Carya carnosa*, washing the fruiting body or mycelial cord, and then cutting off the core tissue.

[0008] Preferably, the propagation includes culturing the mother culture in a liquid or solid culture medium.

[0009] Preferably, the step of culturing the mother culture in a liquid culture medium includes the following steps: crushing the mother culture, suspending it in water, and then inoculating it into the liquid culture medium, controlling the inoculation amount to be 5%–10% and the temperature to be 20–32℃.

[0010] Preferably, the liquid culture medium comprises the following components at the following concentrations: potato extract 10–20 g / L, malt extract 2–5 g / L, glucose 15–30 g / L, peptone 4–10 g / L, potassium dihydrogen phosphate 0.8–2 g / L, magnesium sulfate 0.4–1 g / L, with the balance being water.

[0011] Preferably, the step of culturing the mother culture in a solid culture medium includes the following steps: inoculating 3–5 pieces of mother culture into a sterilized solid culture medium, controlling the temperature at 20–32°C and the relative humidity at 60%–80%, and culturing in the dark for 5–10 days to obtain the original culture.

[0012] Preferably, the solid culture medium comprises the following components in parts by weight: 40–70 parts biomass, 20–40 parts grain crops, 4–10 parts wheat bran, 4–10 parts soybean meal, 0.5–2 parts gypsum, 0.2–1 parts potassium dihydrogen phosphate, and 0.2–1 parts magnesium sulfate, and the water content of the solid culture medium is 50%–60%.

[0013] Preferably, the biomass includes one or more of sawdust, cottonseed hulls, corn cobs, rice hulls, and straw; the food crop includes one or more of wheat, corn, rice, millet, and sorghum.

[0014] Preferably, the biomass is wood chips and the grain crop is wheat.

[0015] Preferably, the step of placing the spawn on the soil and reserving space around the spawn for sclerotium development, and cultivating it in the dark for 33–90 days includes the following steps: taking a cultivation container, laying a 3–10 cm thick layer of soil with a moisture content of 30%–65% at the bottom of the cultivation container, placing the spawn in the cultivation container, controlling the relative humidity at 60%–80%, cultivating it in the dark at a temperature of 15–25℃ for 3–10 days, and then continuing to cultivate it in the dark at a temperature of 18–28℃ for 30–60 days.

[0016] Preferably, the step of placing the cultivar on the soil and reserving space around the cultivar for sclerotium development, and cultivating it in the dark for 33–90 days includes the following steps: digging a pit 20–70 cm deep in the soil, placing the cultivar in the pit, leaving a cavity around the cultivar for sclerotium development when covering it with soil, controlling the soil temperature at 15–30℃, the soil moisture content at 30%–65%, and cultivating for 45–90 days.

[0017] Preferably, the sclerotia include one of the following: *Anthracis niger* sclerotia, *Anthracis neoniger* sclerotia, *Anthracis scabii* sclerotia, *Anthracis near pyroscabii* sclerotia, *Anthracis rubescens* sclerotia, and *Anthracis purpureus* sclerotia.

[0018] Preferably, the sclerotium includes one of the following: *Anthracis niger* sclerotium, *Anthracis neoniger* sclerotium, *Anthracis scabii* sclerotium, and *Anthracis rubescens* sclerotium.

[0019] In summary, this application includes the following beneficial technical effects: 1. This application purifies and cultured the obtained strain and performs molecular biological identification, resulting in a single strain of bacteria. Based on this, the sclerotia germplasm obtained is of a single type, which improves the stability of the quality of the cultured sclerotia. 2. This application uses multi-stage seed production, which is beneficial to improving the viability of the strain and shortening the seed production cycle. The cultivation of the spawn in stages is beneficial to the sterilization of the culture medium in actual production and also to shorten the sclerotium cultivation cycle. 3. The artificial cultivation method for sclerotia of the genus *Anthracis* provided in this application is simple and stable. By transplanting cultivated species, different species of *Anthracis* can be cultivated on a large scale indoors, in the field, or in facility agriculture, which expands the range of cultivation sites, eliminates dependence on wild resources, has good versatility, and the cultivated sclerotia are easy to harvest, which greatly reduces harvesting costs. Detailed Implementation

[0020] The present application will be further described in detail below with reference to the embodiments. The following embodiments are for illustrative purposes only and should not be considered as limiting the scope of the invention. Unless otherwise specified, specific conditions in the following embodiments were performed under conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, the methods used are conventional methods known in the art, and the consumables and reagents used are commercially available. Unless otherwise stated, the technical and scientific terms used herein have the same meaning as those familiar to those skilled in the art. Furthermore, any methods or materials similar to or equivalent to those described herein may also be applied to the present invention.

[0021] Example 1 Example 1 of this application provides a method for artificially cultivating sclerotia of the genus *Caryachaeus*, the steps of which are as follows: Mother strain isolation: The fruiting bodies of *Xylaria escharoidea* collected from Wenshan, Yunnan Province, were rinsed with sterile water. Mature spores were scraped from the fruiting bodies and inoculated onto PDA-enriched medium. The medium was incubated at 28–32℃ for 3–6 days. Vigorous mycelia at the colony edges were selected for purification and culture until a single strain was obtained. The resulting strain was amplified using primers TCCGTAGGTGAACCTGCGG / TCCTCCGCTTATTGATATGC and then sequenced. The sequencing results, compared with ITS sequences in the database, identified it as *Xylaria escharoidea*. This strain was used as the mother strain.

[0022] Preparation of primary culture: Take 13g potato extract powder, 3g malt extract powder, 20g glucose, 5g peptone, 1g potassium dihydrogen phosphate, and 0.5g magnesium sulfate, and add water to a final volume of 1L to obtain a sterilized liquid culture medium for later use. Transfer the mother culture to a sterile mortar, crush it with a pestle, and then add twice the volume of sterile water to suspend it. Inoculate this mixture at a 5% inoculation rate into the sterilized liquid culture medium, maintaining the temperature at 25℃. After shaking at 100 rpm for 2–4 days, until the mycelium has fully colonized the liquid culture medium, the primary culture is obtained.

[0023] Preparation of spawn: Take 500g sawdust, 382g wheat, 50g wheat bran, 50g soybean meal, 10g gypsum, 5g potassium dihydrogen phosphate, and 3g magnesium sulfate. Add 1.4L of water and mix well to obtain a solid culture medium, which should be sterilized for later use. Place the solid culture medium in a spawn bag, and inoculate the original spawn onto the solid culture medium in the spawn bag at an inoculation rate of 10%. Control the temperature at 25–30℃ and the relative humidity at 60%–80%, and incubate in the dark for 5–10 days. Once the mycelium has fully colonized the spawn bag, the spawn is obtained.

[0024] Sclerotium culture: Take a culture container and lay a 3-10cm thick layer of soil with a moisture content of 40%-60% at the bottom of the container. After removing the spawn bag, place the spawn into the culture container. Control the temperature inside the container at 15-25℃ and the relative humidity at 60%-80%. Cultivate in the dark for 3-7 days. After the mycelial cords have formed, adjust the temperature to 18-28℃ and continue to cultivate in the dark for 30-60 days. Harvest the sclerotia when the surface of the sclerotia has completely turned black and no longer swells.

[0025] Example 2 Example 2 of this application provides a method for artificially cultivating sclerotia of the genus *Caryachaeus*, the steps of which are as follows: Mother strain isolation: The fruiting bodies of *Xylaria nigripes* collected from Wenshan, Yunnan Province, were rinsed with sterile water. Mature spores were scraped from the fruiting bodies and inoculated onto PDA-enriched medium. The medium was incubated at 28°C for 3–6 days. Vigorous mycelia at the colony edges were selected for purification and culture until a single strain was obtained. The resulting strain was amplified using primers TCCGTAGGTGAACCTGCGG / TCCTCCGCTTATTGATATGC and then sequenced. The sequencing results, compared with ITS sequences in the database, identified it as *Xylaria nigripes*. This strain was used as the mother strain.

[0026] Preparation of primary culture medium: Take 500g sawdust, 382g wheat, 50g wheat bran, 50g soybean meal, 10g gypsum, 5g potassium dihydrogen phosphate, and 3g magnesium sulfate, add 1.4L of water and mix well to obtain a solid culture medium, which is then sterilized for later use. Place the solid culture medium in culture bottles, inoculate each bottle with 3-5 pieces of mother culture, control the temperature at 25℃ and the relative humidity at 75%, and incubate in the dark for 10-15 days. Once the mycelium has fully colonized the culture bottle, the primary culture medium is obtained.

[0027] Preparation of spawn: Place solid culture medium in a spawn bag, and inoculate the original spawn onto the solid culture medium in the spawn bag at an inoculation rate of 10%. Control the temperature at 25–30℃ and the relative humidity at 60%–80%, and incubate in the dark for 10–15 days. Once the mycelium has fully grown in the spawn bag, the spawn is obtained.

[0028] Sclerotium culture: Take a culture container and lay a 3-10cm thick layer of soil with a moisture content of 40%-60% at the bottom of the container. After removing the spawn bag, place the spawn into the culture container. Control the temperature inside the container at 15-25℃ and the relative humidity at 60%-80%. Cultivate in the dark for 5-10 days. After the mycelial cords have formed, adjust the temperature to 18-28℃ and continue to cultivate in the dark for 45-60 days. Harvest the sclerotia when the surface of the sclerotia has completely turned black and no longer swells.

[0029] Example 3 Example 3 of this application provides a method for artificially cultivating sclerotia of the genus *Caryachaeus*, the steps of which are as follows: Mother culture isolation: The fruiting bodies of *Xylaria neonigripes* collected from Chengdu, Sichuan Province, were rinsed with sterile water and cut into 3–5 mm tissue pieces (core tissue). These pieces were inoculated onto PDA-enriched medium and incubated at 25°C for 2–3 days. Vigorous mycelia at the colony edges were selected for purification and culture until a single strain was obtained. The resulting strain was amplified using primers TCCGTAGGTGAACCTGCGG / TCCTCCGCTTATTGATATGC and then sequenced. The sequencing results, compared with ITS sequences in the database, identified it as *Xylaria neonigripes*. This strain was used as the mother culture.

[0030] Preparation of primary culture medium: Take 500g sawdust, 382g wheat, 50g wheat bran, 50g soybean meal, 10g gypsum, 5g potassium dihydrogen phosphate, and 3g magnesium sulfate, add 1.4L of water and mix well to obtain a solid culture medium, which is then sterilized for later use. Place the solid culture medium in culture flasks, inoculate each flask with 3-5 pieces of mother culture, control the temperature at 25℃ and the relative humidity at 75%, and culture in the dark for 10-15 days to obtain the primary culture medium.

[0031] Preparation of spawn: Place solid culture medium in a spawn bag, and inoculate the original spawn onto the solid culture medium in the spawn bag at an inoculation rate of 10%. Control the temperature at 25–30℃ and the relative humidity at 60%–80%, and incubate in the dark for 10–15 days. Once the mycelium has fully grown in the spawn bag, the spawn is obtained.

[0032] Sclerotium culture: Take a culture container and lay a 3-10cm thick layer of soil with a moisture content of 40%-60% at the bottom of the container. After removing the spawn bag, place the spawn into the culture container. Control the temperature inside the container at 15-25℃ and the relative humidity at 60%-80%. Cultivate in the dark for 5-10 days. After the mycelial cords have formed, adjust the temperature to 18-28℃ and continue to cultivate in the dark for 45-60 days. Harvest the sclerotia when the surface of the sclerotia has completely turned black and no longer swells.

[0033] Example 4 Example 4 of this application provides a method for artificially cultivating sclerotia of the genus *Caryachaeus*, the steps of which are as follows: Mother strain isolation: The fruiting bodies of *Xylaria rogersionigripes* collected from Wenshan, Yunnan Province, were rinsed with sterile water. Mature spores were scraped from the fruiting bodies and inoculated onto PDA-enriched medium. The culture was maintained at 28°C for 3–6 days. Vigorous mycelia at the colony edges were selected for purification and culture until a single strain was obtained. The resulting strain was amplified using primers TCCGTAGGTGAACCTGCGG / TCCTCCGCTTATTGATATGC and then sequenced. The sequencing results, compared with ITS sequences in the database, identified it as *Xylaria rogersionigripes*. This strain was used as the mother strain.

[0034] Preparation of primary culture: Take 13g potato extract powder, 3g malt extract powder, 20g glucose, 5g peptone, 1g potassium dihydrogen phosphate, and 0.5g magnesium sulfate, and add water to a final volume of 1L to obtain a sterilized liquid culture medium for later use. Transfer the mother culture to a sterile mortar, crush it with a pestle, and then add twice the volume of sterile water to suspend it. Inoculate this mixture at a 5% inoculation rate into the sterilized liquid culture medium, maintaining the temperature at 25℃. After shaking at 100 rpm for 2–4 days, until the mycelium has fully colonized the liquid culture medium, the primary culture is obtained.

[0035] Preparation of spawn: Take 500g sawdust, 382g wheat, 50g wheat bran, 50g soybean meal, 10g gypsum, 5g potassium dihydrogen phosphate, and 3g magnesium sulfate. Add 1.4L of water and mix well to obtain a solid culture medium, which is then sterilized for later use. Place the solid culture medium in a spawn bag, and inoculate the original spawn onto the solid culture medium in the spawn bag at an inoculation rate of 10%. Control the temperature at 25–30℃ and the relative humidity at 60%–80%, and incubate in the dark for 5–10 days until the mycelium has fully colonized the spawn bag, thus obtaining the spawn.

[0036] Sclerotium cultivation: Dig a 40cm deep pit in the vegetable greenhouse, cut off the spawn bag and place it in the pit, cover the spawn with an earthenware pot and cover it with soil, control the soil temperature at 15-30℃ and the soil moisture content at 30%-65% and cultivate for 60 days, then dig up and harvest the sclerotium.

[0037] Testing and Inspection (1) The fungal species of the mother species in Examples 1–4 were identified, and the results are shown in Table 1 below.

[0038] Table 1:

[0039] (2) The harvesting of sclerotia in Examples 1–4 was statistically analyzed to obtain the average number of sclerotia, average sclerotia diameter, and average sclerotia weight (fresh weight). The results are shown in Table 2 below: Table 2:

[0040] Results Analysis The following detailed description of this application is based on the experimental results provided in Tables 1 and 2.

[0041] According to the results in Table 1, the parent strains isolated and purified from the fruiting bodies of Anthracnose in Examples 1–4 were all single species and all belonged to the genus Anthracnose. Specifically, the parent strain in Example 1 was Anthracnose scabii, the parent strain in Example 2 was Anthracnose nigricans, the parent strain in Example 3 was Anthracnose neonigricans, and the parent strain in Example 4 was Anthracnose rogers.

[0042] Referring to Table 2, the artificial cultivation methods for sclerotia of the genus *Anthracis* in Examples 1–4 all produced an average of more than 4 sclerotia per bag of culture, with an average sclerotia diameter of up to 4.5 cm and an average sclerotia weight of 125.3 g per bag. This indicates that the artificial cultivation methods for sclerotia of the genus *Anthracis* of this application can successfully cultivate sclerotia of various *Anthracis* species, and the sclerotia quality is stable.

[0043] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. A method for artificially cultivating sclerotia of the genus *Caryachaeus*, characterized in that: Includes the following steps: Sclerotium-producing Charae were collected. Spores were obtained by spore isolation or core tissue was obtained by tissue isolation. The spores or core tissue were inoculated on PDA-enriched medium and cultured into colonies. The vigorous hyphae at the edge of the colonies were picked and purified and cultured until a mother culture containing only a single strain was obtained. The strain was identified by gene sequencing. The mother culture is propagated to obtain the original culture. The original culture is inoculated into a sterilized solid culture medium and cultured in the dark to obtain the spore. The spore is placed on the soil with space reserved around it for sclerotium development. It is cultured in the dark for 33–90 days, and then the sclerotia are harvested.

2. The method for artificially cultivating sclerotia of the genus *Caryachaeus* according to claim 1, characterized in that: The propagation involves culturing the mother culture in a liquid or solid culture medium.

3. The method for artificially cultivating sclerotia of the genus *Caryachaeus* according to claim 2, characterized in that: The process of culturing the mother culture in a liquid culture medium includes the following steps: crushing the mother culture, suspending it in water, and then inoculating it into the liquid culture medium, controlling the inoculation amount to be 5%–10%, the temperature to be 20–32℃, and shaking it at 100–150 rpm for 2–4 days to obtain the original culture.

4. The method for artificially cultivating sclerotia of the genus *Caryachaeus* according to claim 3, characterized in that: The liquid culture medium comprises the following components at the following concentrations: potato extract 10–20 g / L, malt extract 2–5 g / L, glucose 15–30 g / L, peptone 4–10 g / L, potassium dihydrogen phosphate 0.8–2 g / L, magnesium sulfate 0.4–1 g / L, with the balance being water.

5. The method for artificially cultivating sclerotia of the genus *Caryachaeus* according to claim 2, characterized in that: The process of culturing the mother culture in a solid culture medium includes the following steps: inoculating 3–5 pieces of mother culture into a sterilized solid culture medium, controlling the temperature at 20–32℃ and the relative humidity at 60%–80%, and culturing in the dark for 5–10 days to obtain the original culture.

6. The method for artificially cultivating sclerotia of the genus *Caryachaeus* according to claim 5, characterized in that: The solid culture medium comprises the following components in parts by weight: 40–70 parts biomass, 20–40 parts grain crops, 4–10 parts wheat bran, 4–10 parts soybean meal, 0.5–2 parts gypsum, 0.2–1 parts potassium dihydrogen phosphate, and 0.2–1 parts magnesium sulfate. The water content of the solid culture medium is 50%–60%.

7. The method for artificially cultivating sclerotia of the genus *Caryachaeus* according to claim 6, characterized in that: The biomass includes one or more of sawdust, cottonseed hulls, corn cobs, rice hulls, and straw; the food crops include one or more of wheat, corn, rice, millet, and sorghum.

8. The method for artificially cultivating sclerotia of the genus *Caryachaeus* according to claim 1, characterized in that: The process of placing the spawn on the soil and reserving space around it for sclerotium development, and then cultivating it in the dark for 33–90 days includes the following steps: Take a cultivation container, lay a 3–10 cm thick layer of soil with a moisture content of 30%–65% at the bottom of the container, place the spawn in the container, control the relative humidity at 60%–80%, and cultivate it in the dark at 15–25℃ for 3–10 days, followed by continued cultivation in the dark at 18–28℃ for 30–60 days.

9. The method for artificially cultivating sclerotia of the genus *Caryachaeus* according to claim 1, characterized in that: The process of placing the cultivar on the soil and reserving space around it for sclerotium development, and cultivating it in the dark for 33–90 days includes the following steps: digging a pit 20–70 cm deep in the soil, placing the cultivar in the pit, leaving a cavity around the cultivar for sclerotium development when covering it with soil, controlling the soil temperature at 15–30℃, the soil moisture content at 30%–65%, and cultivating for 45–90 days.

10. The method for artificially cultivating sclerotia of the genus *Caryachaeus* according to claim 1, characterized in that: The sclerotia include one of the following: *Anthracis niger* sclerotia, *Anthracis neoniger* sclerotia, *Anthracis scabii* sclerotia, *Anthracis near pyroscabii* sclerotia, *Anthracis rubescens* sclerotia, and *Anthracis purpurea* sclerotia.

Citation Information

Cited By

  • Expanding culture method of longitudinal stripe xylaria sporocarp and application method of sleep-aiding functional food

    CN121336650A

  • Efficient cultivation method for longitudinal stripe xylaria

    CN121359666A