Gene for enhancing plant disease resistance and function thereof
A gene and function technology, applied in the field of disease resistance function, can solve the problem of unknown gene function and use
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Embodiment 1, the construction of AT5G02580 gene knockout vector
[0024] According to the AT5G02580 gene sequence (SEQ ID NO: 1), the targeted sgRNA sequence for CRISPR / Cas9 knockout was designed: 5'-GAATGTATAGTATTCAACA-3', and the corresponding primers 5'-TGATTGGAATGTATAGTATTCAACA-3' and 5'- AAACTGTTGAATACTATACATTCCA, and use CRISPR / Cas9 kit (Biogle, China) to construct the knockout vector of AT5G02580 gene, and the construction method is operated according to the product instructions.
Embodiment 2
[0025] Embodiment 2, genetic transformation of Arabidopsis
[0026] The CRISPR / Cas9 vector constructed in Example 1 was genetically transformed into the Arabidopsis wild-type variety Col-0, and the transformation method was referred to the literature (Plant Journal, 1998,16(6):735-743), and the corresponding transgenic Arabidopsis Mustard plants ko-1 and ko-2.
Embodiment 3
[0027] Example 3, Identification of AT5G02580 Gene Knockout Plants
[0028] DNA extraction: Take 0.1 g of fresh leaves of Arabidopsis wild-type variety Col-0 and transgenic plants, grind with liquid nitrogen and add 300 μL of extract (0.1mol / L Tris-HCl pH8.0, 500mmol / LNaCl, 1.25g / L SDS), incubate at 65°C for 1 hour, shake 2 to 3 times during this period, add 100 μL of 5mol / L KAC, shake well, put in ice bath for 10 minutes, add 250 μL chloroform, mix well, let stand for 5 minutes, and then centrifuge at 8000 r / min After 10 minutes, transfer 250 μL of the supernatant to a 1.5ml new tube, add 250 μL of pre-cooled isopropanol and shake until flocculent precipitates appear, refrigerate for 10 minutes, centrifuge at 12000 r / min, 4°C for 5 minutes, discard the supernatant, add 1mL of 70% ethanol was centrifuged at 12000r / min for 7min, the supernatant was discarded, air-dried at room temperature by inversion, mixed with 80μL ddH2O, and stored at -20℃ for later use.
[0029] PCR ampl...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



