Gene for enhancing plant disease resistance and function thereof

A gene and function technology, applied in the field of disease resistance function, can solve the problem of unknown gene function and use

Active Publication Date: 2021-06-11
ZHEJIANG NORMAL UNIVERSITY
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the sequence of the [0003] gene AT5G02580 has been published in The Arabidopsis Information Resource database https: / / www.arabidopsis.org / , the function and use of the gene are unknown

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for enhancing plant disease resistance and function thereof
  • Gene for enhancing plant disease resistance and function thereof
  • Gene for enhancing plant disease resistance and function thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1, the construction of AT5G02580 gene knockout vector

[0024] According to the AT5G02580 gene sequence (SEQ ID NO: 1), the targeted sgRNA sequence for CRISPR / Cas9 knockout was designed: 5'-GAATGTATAGTATTCAACA-3', and the corresponding primers 5'-TGATTGGAATGTATAGTATTCAACA-3' and 5'- AAACTGTTGAATACTATACATTCCA, and use CRISPR / Cas9 kit (Biogle, China) to construct the knockout vector of AT5G02580 gene, and the construction method is operated according to the product instructions.

Embodiment 2

[0025] Embodiment 2, genetic transformation of Arabidopsis

[0026] The CRISPR / Cas9 vector constructed in Example 1 was genetically transformed into the Arabidopsis wild-type variety Col-0, and the transformation method was referred to the literature (Plant Journal, 1998,16(6):735-743), and the corresponding transgenic Arabidopsis Mustard plants ko-1 and ko-2.

Embodiment 3

[0027] Example 3, Identification of AT5G02580 Gene Knockout Plants

[0028] DNA extraction: Take 0.1 g of fresh leaves of Arabidopsis wild-type variety Col-0 and transgenic plants, grind with liquid nitrogen and add 300 μL of extract (0.1mol / L Tris-HCl pH8.0, 500mmol / LNaCl, 1.25g / L SDS), incubate at 65°C for 1 hour, shake 2 to 3 times during this period, add 100 μL of 5mol / L KAC, shake well, put in ice bath for 10 minutes, add 250 μL chloroform, mix well, let stand for 5 minutes, and then centrifuge at 8000 r / min After 10 minutes, transfer 250 μL of the supernatant to a 1.5ml new tube, add 250 μL of pre-cooled isopropanol and shake until flocculent precipitates appear, refrigerate for 10 minutes, centrifuge at 12000 r / min, 4°C for 5 minutes, discard the supernatant, add 1mL of 70% ethanol was centrifuged at 12000r / min for 7min, the supernatant was discarded, air-dried at room temperature by inversion, mixed with 80μL ddH2O, and stored at -20℃ for later use.

[0029] PCR ampl...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a disease resistance function of a gene of a model plant arabidopsis thaliana, and belongs to the field of plant pathology research. The invention discloses an arabidopsis thaliana gene AT5G02580. The nucleotide sequence of the arabidopsis thaliana gene AT5G02580 is as shown in SEQ ID NO: 1. The invention further discloses application / functions of the arabidopsis thaliana gene AT5G02580. The disease resistance of plants can be remarkably improved by knocking out the AT5G02580 gene in arabidopsis thaliana. According to the invention, an sgRNA sequence of AT5G02580 gene targeted knockout is firstly designed, then a carrier is constructed, and arabidopsis thaliana is subjected to genetic transformation by the carrier, so that a corresponding transgenic plant is obtained, and two strains ko-1 and ko-2 of different mutation types of the AT5G02580 gene are identified from the transgenic plant.

Description

technical field [0001] The invention relates to the disease resistance function of a gene of the model plant Arabidopsis thaliana, belonging to the field of plant pathology research. Background technique [0002] Due to its small genome, convenient planting, and short growth cycle, Arabidopsis has become the first model plant for global botany research. Since Staskawicz's team first cloned the disease resistance gene RPS2 in Arabidopsis in 1993, scientists have discovered a large number of disease resistance genes in Arabidopsis, forming a relatively systematic disease resistance regulatory network, making Arabidopsis in plants It has become an irreplaceable star plant in the field of disease resistance breeding. Pathogen invasion is one of the stresses that affect plant growth and development. Among them, Pseudomonas syringae pv.tomato DC3000 (PstDC3000) is the main model strain for the study of Arabidopsis pathogen invasion. In recent years, scientists have used PstDC3000...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/82A01H6/20A01H5/00
CPCC07K14/415C12N15/8218C12N15/8281Y02A40/146
Inventor马紫程沈淑容陈析丰马伯军
OwnerZHEJIANG NORMAL UNIVERSITY