Selection of host cells expressing protein at high levels

Inactive Publication Date: 2006-08-03
CHROMAGENICS BV
View PDF67 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0015] In one aspect, the invention provides a DNA molecule comprising a multicistronic transcription unit coding for i) a selectable marker polypeptide functional in a eukaryotic host cell, and for ii) a polypeptide of interest, the polypeptide of interest having a translation initiation sequence (and startcodon) separate from that of the selectable marker polypeptide, characterized in that the coding sequence for the polypeptide of interest is downstream from the coding sequence for the selectable marker in said multicistronic transcription unit, and in that the nucleic acid sequence coding for the selectable marker polypeptide comprises a mutation that decreases the translation efficiency of the selectable marker in a eukaryotic host cell. Preferably the translation initiation efficiency of the selectable marker is decreased. In a preferred embodiment, the decreased translation initiation efficiency is brought about by having a non-optimal translation start sequence of the selectable marker polypeptide.
[0020] In preferred embodiments, the selectable marker protein provides resistance against lethal and / or growth-inhibitory effects of a selection agent, such as an antibiotic.

Problems solved by technology

This results in a decreased use of this ATG as startcodon, when compared to an ATG startcodon in an optimal context.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Selection of host cells expressing protein at high levels
  • Selection of host cells expressing protein at high levels
  • Selection of host cells expressing protein at high levels

Examples

Experimental program
Comparison scheme
Effect test

example 1

Construction of STAR67 Vectors

[0160] A novel anti-repressor (STAR) sequence was isolated using a genetic screen as described in WO 03 / 004704, and this novel sequence was coined STAR67. The effects of STAR67 on expression of transgenes in mammalian cell lines were tested. Here we describe the construction of the various constructs.

Materials and Methods

[0161] Three plasmids were created (FIG. 1):

[0162] A) CMV-d2EGFP-ires-Zeo (CMV Control),

[0163] B) STAR67-CMV-d2EGFP-ires-Zeo (CMV-STAR67),

[0164] C) STAR7-STAR67-CMV-d2EGFP-ires-Zeo-STAR7 (CMV-STAR67 7 / 7)

[0165] The construction of construct A is described below. Plasmid pd2EGFP (Clontech 6010-1) was modified by insertion of a linker at the BsiWI site to yield pd2EGFP-link. The linker, made by annealing oligonucleotides GTACGGATATCAGATCTTTAATTAAG (SEQ. ID. NO. 67) and GTACCTTAATTAAAGATCTGATAT (SEQ. ID. NO. 68), introduced sites for the PacI, BglII, and EcoRV restriction endonucleases. This created the multiple cloning site MCSII f...

example 2

STAR67 Enhances the Expression Level from CMV, EF1α and UB6 Promoters in Stably Transfected CHO Cells

[0169] We tested whether the presence of STAR67 adjacent to the CMV, EF1α and UB6 promoters influences the expression level of these promoters in CHO cells. The constructs A and B (FIG. 1) described in Example 1 are used for this purpose, modified for the respective promoters:

[0170] 1 CMV-d2EGFP-ires-Zeo (CMV Control)

[0171] 2 STAR67-CMV-d2EGFP-ires-Zeo (CMV-STAR67)

[0172] 3 EF1α-d2EGFP-ires-Zeo (EF1α Control)

[0173] 4 STAR67-EF1α-d2EGFP-ires-Zeo (EF1α-STAR67)

[0174] 5 UB6-d2EGFP-ires-Zeo (UB6 Control)

[0175] 6 STAR67-UB6-d2EGFP-ires-Zeo (UB6-STAR67).

Materials and Methods

[0176] The UB6 and EF1α promoters were exchanged for the CMV promoter in the plasmids described in FIG. 1. The UB6 promoter was cloned as follows. A DNA 0.37 kb stuffer from the pd2EGFP plasmid was amplified by PCR, as described in example 1, using primers identified by SEQ. ID. NOs. 69 and 70. The resulting DNA...

example 3

STAR67 Enhances the Expression Level from CMV, EF1α and UB6 Promoters in Stably Transfected PER.C6 Cells

[0183] We tested whether the presence of STAR67 adjacent of the CMV, EF1α and UB6 promoters influences the expression level of these promoters in another cell type than CHO cells, namely human PER.C6 cells. The same constructs as in example 1 were used.

Materials and Methods

Transfection, Culturing and Analysis of PER.C6 Cells

[0184] PER.C6® cells were cultured in DMEM medium+pyridoxine+9% Foetal Bovine Serum (Non-Heat Inactivated), 8.9 mM MgCl2 100 U / ml penicillin, and 100 micrograms / ml streptomycin at 37° C. / 10% CO2. Cells were transfected with the plasmids using Lipofectamine 2000 (Invitrogen) as described by the manufacturer. Briefly, cells were seeded to 6-wells and grown overnight to 70-90% confluence. Lipofectamine reagent was combined with plasmid DNA at a ratio of 15 microliters per 3 microgram (e.g. for a 10 cm Petri dish, 20 micrograms DNA and 120 microliters Lipofec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Electrical resistanceaaaaaaaaaa
Antimicrobial propertiesaaaaaaaaaa
Login to View More

Abstract

The invention provides a DNA molecule comprising a multicistronic transcription unit coding for i) a selectable marker polypeptide functional in a eukaryotic host cell, and for ii) a polypeptide of interest, the polypeptide of interest having a translation initiation sequence separate from that of the selectable marker polypeptide, characterized in that the coding sequence for the polypeptide of interest is downstream from the coding sequence for the selectable marker in said multicistronic transcription unit, and the nucleic acid sequence coding for the selectable marker polypeptide comprises a mutation that decreases the translation efficiency of the selectable marker in a eukaryotic host cell. The invention also provides methods for obtaining host cells expressing a polypeptide of interest, said host cells comprising the DNA molecules of the invention. The invention further provides the production of polypeptides of interest, comprising culturing host cells comprising the DNA molecules according to the invention.

Description

BACKGROUND OF THE INVENTION Field of the Invention [0001] The invention relates to the field of molecular biology and biotechnology. More specifically the present invention relates to means and methods for improving the selection of host cells that express proteins at high levels. [0002] Proteins can be produced in various host cells for a wide range of applications in biology and biotechnology, for instance as biopharmaceuticals. Eukaryotic and particularly mammalian host cells are preferred for this purpose for expression of many proteins, for instance when such proteins have certain posttranslational modifications such as glycosylation. Methods for such production are well established, and generally entail the expression in a host cell of a nucleic acid (also referred to as ‘transgene’) encoding the protein of interest. In general, the transgene together with a selectable marker gene is introduced into a precursor cell, cells are selected for the expression of the selectable mark...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07H21/04C12P21/06C12N5/06C07K16/18C12N15/11
CPCC07K16/30C07K14/00C07K16/00
InventorOTTE, ARIEVAN BLOKLAND, HENRICUSKWAKS, THEODORUSSEWALT, RICHARD
OwnerCHROMAGENICS BV