Selection of host cells expressing protein at high levels

Inactive Publication Date: 2006-08-03
CHROMAGENICS BV
View PDF67 Cites 33 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0014] The present invention uses a novel and unique concept for selecting host cells expressing high levels of polypeptides of interest, the concept referred to herein as ‘reciprocal interdependent translation’. It is unique with respect to the prior art approaches in that an extra level of regulation is used to fine-tune the amount of translation products from a multicistronic transcript, whereby the level of translation of a selectable marker polypeptide is lowered, thereby increasing the level of translation of the polypeptide of interest coded on the same multicistronic transcription unit, i.e

Problems solved by technology

This results in a decreased use of this ATG as startcodon,

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Selection of host cells expressing protein at high levels
  • Selection of host cells expressing protein at high levels
  • Selection of host cells expressing protein at high levels

Examples

Experimental program
Comparison scheme
Effect test

Example

[0082] It is also possible to include more coding sequences on the same transcription unit, downstream of the (first) polypeptide of interest, e.g. coding for a second selectable marker polypeptide or for a second polypeptide of interest. Such an extra coding sequence downstream of the coding sequence for the first polypeptide of interest then preferably is preceded by a sequence encoding a translation reinitiation site or internal ribosome entry site (IRES), such that also the second polypeptide of interest or the second selection marker polypeptide is translated, in this case independently from the earlier two coding sequences. In such an embodiment, it is for instance possible to have the coding sequences for subunits of a multimeric protein, e.g. a heavy and a light chain of an immunoglobulin, encoded as a first and second polypeptide of interest (in any order), to code for subunits of a multimeric protein within a single multicistronic expression unit. It is however preferred t...

Example

Example 1

Construction of STAR67 Vectors

[0160] A novel anti-repressor (STAR) sequence was isolated using a genetic screen as described in WO 03 / 004704, and this novel sequence was coined STAR67. The effects of STAR67 on expression of transgenes in mammalian cell lines were tested. Here we describe the construction of the various constructs.

Materials and Methods

[0161] Three plasmids were created (FIG. 1):

[0162] A) CMV-d2EGFP-ires-Zeo (CMV Control),

[0163] B) STAR67-CMV-d2EGFP-ires-Zeo (CMV-STAR67),

[0164] C) STAR7-STAR67-CMV-d2EGFP-ires-Zeo-STAR7 (CMV-STAR67 7 / 7)

[0165] The construction of construct A is described below. Plasmid pd2EGFP (Clontech 6010-1) was modified by insertion of a linker at the BsiWI site to yield pd2EGFP-link. The linker, made by annealing oligonucleotides GTACGGATATCAGATCTTTAATTAAG (SEQ. ID. NO. 67) and GTACCTTAATTAAAGATCTGATAT (SEQ. ID. NO. 68), introduced sites for the PacI, BglII, and EcoRV restriction endonucleases. This created the multiple cloning si...

Example

Example 2

STAR67 Enhances the Expression Level from CMV, EF1α and UB6 Promoters in Stably Transfected CHO Cells

[0169] We tested whether the presence of STAR67 adjacent to the CMV, EF1α and UB6 promoters influences the expression level of these promoters in CHO cells. The constructs A and B (FIG. 1) described in Example 1 are used for this purpose, modified for the respective promoters:

[0170] 1 CMV-d2EGFP-ires-Zeo (CMV Control)

[0171] 2 STAR67-CMV-d2EGFP-ires-Zeo (CMV-STAR67)

[0172] 3 EF1α-d2EGFP-ires-Zeo (EF1α Control)

[0173] 4 STAR67-EF1α-d2EGFP-ires-Zeo (EF1α-STAR67)

[0174] 5 UB6-d2EGFP-ires-Zeo (UB6 Control)

[0175] 6 STAR67-UB6-d2EGFP-ires-Zeo (UB6-STAR67).

Materials and Methods

[0176] The UB6 and EF1α promoters were exchanged for the CMV promoter in the plasmids described in FIG. 1. The UB6 promoter was cloned as follows. A DNA 0.37 kb stuffer from the pd2EGFP plasmid was amplified by PCR, as described in example 1, using primers identified by SEQ. ID. NOs. 69 and 70. The res...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Electrical resistanceaaaaaaaaaa
Antimicrobial propertiesaaaaaaaaaa
Login to view more

Abstract

The invention provides a DNA molecule comprising a multicistronic transcription unit coding for i) a selectable marker polypeptide functional in a eukaryotic host cell, and for ii) a polypeptide of interest, the polypeptide of interest having a translation initiation sequence separate from that of the selectable marker polypeptide, characterized in that the coding sequence for the polypeptide of interest is downstream from the coding sequence for the selectable marker in said multicistronic transcription unit, and the nucleic acid sequence coding for the selectable marker polypeptide comprises a mutation that decreases the translation efficiency of the selectable marker in a eukaryotic host cell. The invention also provides methods for obtaining host cells expressing a polypeptide of interest, said host cells comprising the DNA molecules of the invention. The invention further provides the production of polypeptides of interest, comprising culturing host cells comprising the DNA molecules according to the invention.

Description

BACKGROUND OF THE INVENTION Field of the Invention [0001] The invention relates to the field of molecular biology and biotechnology. More specifically the present invention relates to means and methods for improving the selection of host cells that express proteins at high levels. [0002] Proteins can be produced in various host cells for a wide range of applications in biology and biotechnology, for instance as biopharmaceuticals. Eukaryotic and particularly mammalian host cells are preferred for this purpose for expression of many proteins, for instance when such proteins have certain posttranslational modifications such as glycosylation. Methods for such production are well established, and generally entail the expression in a host cell of a nucleic acid (also referred to as ‘transgene’) encoding the protein of interest. In general, the transgene together with a selectable marker gene is introduced into a precursor cell, cells are selected for the expression of the selectable mark...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07H21/04C12P21/06C12N5/06C07K16/18C12N15/11
CPCC07K16/30C07K14/00C07K16/00
Inventor OTTE, ARIEVAN BLOKLAND, HENRICUSKWAKS, THEODORUSSEWALT, RICHARD
Owner CHROMAGENICS BV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap