Check patentability & draft patents in minutes with Patsnap Eureka AI!

Building method of cell strain for stably expressing NS1(non-structural 1) protein

A technology of stable expression and construction method, applied in the field of medical molecular biology, can solve the problem that the role of influenza A virus infecting cells is not very clear, etc.

Inactive Publication Date: 2017-09-22
LIAONING UNIVERSITY
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the apoptosis process is often considered as an antiviral response of the host cell itself to limit viral replication, the role of apoptosis in influenza A virus-infected cells is not well understood.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Building method of cell strain for stably expressing NS1(non-structural 1) protein
  • Building method of cell strain for stably expressing NS1(non-structural 1) protein
  • Building method of cell strain for stably expressing NS1(non-structural 1) protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] (1) NS1 gene amplification

[0031] 1. NS1 gene PCR amplification

[0032] According to the NS1 gene sequence in GeneBank (GenBank: AAT90838.1), use the software LSPrimer (http: / / ccsipb.lnu.edu.cn / primer / ) to design the specific primers NS1-F and NS1-R of the NS1 gene, add enzyme Cutting site EcoR I, the sequences of specific primers NS1-F and NS1-R are:

[0033] NS1-F: 5'CCGGAATTCATGGATTCCAACACTGTGT 3'

[0034] NS1-R: 5' CCGGAATTCCGAACTTTTGACTCAATTGT 3'

[0035] Use the pEGFP-N1-NS1 plasmid stored in our laboratory as a template for PCR amplification. The PCR reaction system is:

[0036]

[0037] PCR reaction program: 94°C for 3min, 94°C for 30s, 55°C for 30s, 72°C for 1min, 4°C for a total of 30 cycles.

[0038] 2. DNA agarose gel electrophoresis

[0039] Prepare 1.5% agarose, and heat it in a microwave oven to completely dissolve the agarose particles; place the washed and dried gel plate horizontally on the workbench; mix well, fill the gel, and insert a com...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a building method of a cell strain for stably expressing NS1 (non-structural 1) protein. An NS1 gene is inserted in an EcoR I polyclone site of a pLenti-CMV-EGFP-3Flag-PGK-Puro carrier; a built pLenti-CMV-NS1-EGFP-3Flag-PGK-Puro recombinant plasmid and a virus packaging plasmid are used for 293T cell cotransfection; culture, toxin elimination, virus liquid supernatant collection and filtering are performed to obtain recombinant lentivirus liquid. Packaged recombinant lentivirus infection A549 cells are subjected to puromycin screening, immunofluorescence and Western blot identification to obtain the cell strain for stably expressing NS1 protein. A recombinant lentivirus system is used for preparing the cell strain fusing tag protein capable of stably expressing the NS1 protein. The cell strain provides a good tool for studying the biological function of the NS1 protein.

Description

technical field [0001] The invention belongs to the field of medical molecular biology. Specifically, it relates to a method for constructing a lung cancer cell line stably expressing NS1 protein (Non-Structural 1 Protein, NS1). Background technique [0002] Lentivirus vector is a gene therapy vector developed on the basis of type I human immunodeficiency virus. Different from general retroviral vectors, lentiviral vectors can effectively integrate foreign genes into host chromosomes to achieve persistent expression. The lentiviral expression vector contains the genetic information required for packaging, transfection, and stable integration. It is necessary to use the expression vector and the packaging plasmid to co-transfect the cells and package the virus in the cells. The packaged virus particles are secreted into the extracellular medium, and the supernatant obtained by centrifugation contains high-titer virus particles, which can be directly used for the infection o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N5/10
CPCC07K14/005C12N15/86C12N2740/15043C12N2760/16122
Inventor 刘宏生陈思瑶朱俊丰李雪
Owner LIAONING UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More