Preparation method and application of colon cancer cell strain expressed by stabilized silent PKM2 gene

A colon cancer cell, gene expression technology, applied in the field of colon cancer cell line preparation, can solve the problem of unclear tumor and other problems

Inactive Publication Date: 2013-12-18
SHANXI UNIV
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, whether PKM2 contributes to other malignant features of tumors is unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method and application of colon cancer cell strain expressed by stabilized silent PKM2 gene
  • Preparation method and application of colon cancer cell strain expressed by stabilized silent PKM2 gene
  • Preparation method and application of colon cancer cell strain expressed by stabilized silent PKM2 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] (1) Design of shRNA oligonucleotide sequence targeting PKM2 gene

[0019] The complete mRNA sequence of the PKM2 gene (NM-001206796) was found in GenBank, and the specificity was confirmed by Blast homology comparison, and the secondary structure of the target mRNA sequence was evaluated by using RNA Structure4.4 software, and finally a 21nt target was screened. Nucleotide sequence: SEQ ID NO: 5, CGGGTGAACTTTGCCATGAAT, the target position is 946-966.

[0020] Design and synthesize a shRNA DNA template single strand according to the target nucleotide sequence, named shRNA1, and design a pair of control sequences shRNAc, the specific sequence is shown in Table 1. The designed shRNA oligonucleotide chains were synthesized by Shanghai Yingjun Biotechnology Co., Ltd.

[0021] Table 1 shRNA oligonucleotide sequences targeting PKM2 gene

[0022]

[0023] (2) Construction of shRNA lentiviral expression vector

[0024] Mix the synthetic shRNA oligonucleotide single-strande...

Embodiment 2

[0038] Example 2 Fluorescent quantitative PCR detection of glutamine metabolism-related enzymes and receptor gene expression

[0039] Using each cDNA in Example 1 (5) as a template, using GAPDH as an internal reference, fluorescent quantitative PCR was used to detect the relative expression of glutamine metabolism-related enzyme genes, and the reaction conditions were set: 94°C for 30s, one cycle; 94°C for 5s ; 60°C for 34s, 40 cycles. The result is as Figure 4 As shown, compared with shRNAc cells, the gene expression levels of glutamine metabolism-related enzymes and receptors in shRNA1 cells increased, indicating that silencing the expression of PKM2 gene caused the compensatory effect of glutamine in cells.

Embodiment 3

[0040] Example 3 MTT method (thiazolium blue colorimetric method) detection of glutamine compensation in stable cell lines

[0041] Inoculate 8×10 shRNAc cells and shRNA1 cells in good growth state, respectively. 3 Put each well into a 96-well plate, incubate in a 37°C incubator for 24 hours, add Don (glutaminase inhibitor) at a final concentration of 0.5mM, set up five duplicate wells, and use the medium without drug as a control . After 48 hours of drug action, add 20 μL of 5 mg / mL MTT solution to each well, continue to incubate for 4 hours, and terminate the culture. Carefully aspirate and discard the culture supernatant in the wells, add 150 μL DMSO to each well, and shake for 10 minutes to fully dissolve the purple crystals. At 570nm wavelength on the enzyme-linked immunoassay instrument, measure the light absorption value (A value) of each hole, the result is as follows Figure 5 As shown, the survival rate of shRNA1 cells is lower than that of control cells, which sh...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method of a colon cancer cell strain expressed by stabilized silent PKM2 gene. The preparation method comprises the steps of constructing of shRNA lentiviral expression vector of human PKM2 gene, packaging and obtaining of lentivirus, DLD1 colon cancer lentivirus infecting, stabilized cell strain puromycin screening and Real-time PCR, Western blot identification. The experimental results show that the shRNA nucleotide sequence can be successfully inserted into the pLKO.1-puro expression vector, and the inhibitory effect on the expression of PKM2 gene is remarkable, endurable and stable. The prepared cell strain can be used as the experimental material for researching the regulating effect of PKM2 in malignant characteristics such as colon cancer cell energy metabolism, cell proliferation, cell migration and inflammation.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a method for preparing colon cancer cell lines stably silencing PKM2 gene expression, and the obtained cell lines are used in the study of PKM2 regulating the malignant characteristics of colorectal cancer cells such as energy metabolism, proliferation, migration and inflammation. Applications. Background technique [0002] Abnormal glucose metabolism is an important feature of tumor cells. Even in the presence of oxygen, tumor cells primarily metabolize through glycolysis rather than oxidative phosphorylation, consuming large amounts of glucose and producing lactate, the "Warburg effect". More and more studies believe that many intermediate products produced in the glycolysis process can be used by tumor cells to synthesize biomacromolecules such as proteins, nucleic acids, and lipids, and provide the necessary material basis for the growth and proliferation of tumo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C12N5/09C12Q1/02
Inventor李卓玉武海丽李宗伟杨鹏
OwnerSHANXI UNIV