Check patentability & draft patents in minutes with Patsnap Eureka AI!

MRNA targeting molecule based on combination of N-acetylgalactosamine polypeptide and preparation method of mRNA targeting molecule

An acetylgalactosamine, targeting molecule technology, applied in DNA/RNA fragments, other methods of inserting foreign genetic materials, hybrid peptides, etc., can solve the problem of cytotoxicity, difficulty in clinical transformation, and inability to achieve effective coupling between mRNA and GalNAc and other problems to achieve the effect of solving targeted delivery and increasing drug efficacy

Active Publication Date: 2020-04-21
SHENZHEN RHEGEN BIOTECHNOLOGY CO LTD
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this receptor has been discovered for many years, the messenger RNA (Messenger RNA, mRNA) delivery system based on this receptor and its ligand has not been able to achieve breakthroughs, because the existing technical means cannot achieve effective coupling between mRNA and GalNAc
[0003] At present, the delivery of mRNA into cells can be achieved by different methods, such as electroporation, sonoporation, microinjection or cell transfection based on polymer compounds, but these methods are relatively toxic to cells, and clinical translation has certain potential. difficulty

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MRNA targeting molecule based on combination of N-acetylgalactosamine polypeptide and preparation method of mRNA targeting molecule
  • MRNA targeting molecule based on combination of N-acetylgalactosamine polypeptide and preparation method of mRNA targeting molecule
  • MRNA targeting molecule based on combination of N-acetylgalactosamine polypeptide and preparation method of mRNA targeting molecule

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] An mRNA targeting molecule based on binding N-acetylgalactosamine polypeptide, which is a new type of mRNA drug with liver cell-specific binding ability. Wherein, the GalNAc modification of the mRNA molecule is combined with the GBD protein sequence of the mRNA-puromycin-GBD molecule through N-acetylgalactosamine transferase to form an mRNA-puromycin-GBD-GalNAc molecule. Puromycin is linked to the GBD polypeptide sequence; the mRNA molecule is obtained by in vitro transcription using a plasmid containing the above-mentioned DNA fragment, and the sequence of the mRNA molecule includes a 5' cap, a target gene sequence, a specific protease cleavage sequence, and a binding The polypeptide GBD sequence of N-acetylgalactosamine, the GBD polypeptide is obtained through ribosome translation of the GBD sequence, which is prepared by the following steps:

[0068] Step S1, according to the delivery tissue is liver cells, the target gene is selected as green fluorescent protein mWa...

Embodiment 2

[0098] An mRNA targeting molecule based on binding N-acetylgalactosamine polypeptide, which is prepared by the following steps:

[0099] Step S1, according to the delivery tissue is liver cells, select the target gene as luciferase (Luc), and design a polypeptide sequence (GBD) that can bind N-acetylgalactosamine (GalNAc), and clone related cloning elements into the pCDNA3.1 plasmid vector. Wherein, the DNA fragment in the plasmid DNA includes a promoter, a target gene, a specific protease cleavage sequence, and a polypeptide GBD sequence capable of binding N-acetylgalactosamine and is sequentially connected.

[0100] In this embodiment, the GBD sequence as shown in SEQ ID No.2 is used as the GBD sequence.

[0101] The sequence of the target gene is shown in SEQ ID No.7.

[0102] SEQ ID No.7

[0103] GTGAGCAAGGGCGAGGAGACCACAATGGGCGTAATCAAGCCCGACATGAAGATCAAGCTGAAGATGGAGGGCAACGTGAATGGCCACGCCTTCGTGATCGAGGGCGAGGGCGAGGGCAAGCCCTACGACGGCACCAACACCATCAACCTGGAGGTGAAGGAGGGAGCCCCCCTGCC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an mRNA (messenger ribonucleic acid) targeting molecule based on N-acetylgalactosamine polypeptide and a preparation method of the mRNA targeting molecule. A plasmid vector containing a DNA fragment formed by sequentially connecting a promoter, a target gene, a specific protease cleavage sequence and a polypeptide GBD sequence capable of being combined with N-acetylgalactosamine is transcribed to obtain mRNA, the mRNA is connected with a DNA-puromycin connector under the action of T4 ligase, through protein translation and shearing with a specific protease, an mRNA-puromycin-GBD compound is obtained, and the mRNA-puromycin-GBD compound is combined with the GBD protein sequence under the action of N-acetylgalactosaminyl transferase to form an mRNA-puromycin-GBD-GalNAccompound to complete the GalNAc modification of the mRNA; in the mRNA drug delivery process, the purpose of accurate drug delivery is achieved, and the drug effect of mRNA drug molecules is improved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an mRNA targeting molecule based on binding N-acetylgalactosamine polypeptide and a preparation method thereof. Background technique [0002] Asialoglycoprotein receptor (ASGPR) is an abundant endocytic receptor of a heterologous oligomer, which mainly exists on the cell membrane surface of liver parenchymal cells facing the sinusoidal space, and has the ability to It is an endocytic receptor specifically expressed by liver cells. In recent years, breakthroughs have been made in the liver-targeted delivery of nucleic acid drugs, such as small interfering RNA (Small interfering RNA, siRNA), using ASGPR’s high-affinity ligand N-acetylgalactosamine (GalNAc) as a targeting molecule. progress. Although the receptor has been discovered for many years, the messenger RNA (Messenger RNA, mRNA) delivery system based on the receptor and its ligand has not made a breakthrough, beca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/87C07K5/083A61K48/00A61K47/64
CPCC12N15/11C12N15/87C07K19/00A61K48/0058A61K48/0033A61K47/64A61K47/549A61K47/65A61P1/16
Inventor 张苗苗
Owner SHENZHEN RHEGEN BIOTECHNOLOGY CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More