40 results about "Benign tumours" patented technology

Treatment of damaged, diseased, abnormal, obstructive, cancerous or undesired tissue (e.g. a tumor, a benign tumor, a malignant tumor, a cyst, or an area of diseased tissue, etc) is provided by delivering specialized pulsed electric field energy to target tissue areas in a specific dose so as to obtain a superior outcome. The specialized PEF energy and delivery has been optimized to provide advanced treatment of target tissue areas, including destruction of undesired tissue and generation of improved inflammatory and immune responses. The specialized PEF energy provides superior outcomes to radiofrequency ablation and irreversible electroporation.

Treatment of damaged, diseased, abnormal, obstructive, cancerous or undesired tissue (e.g. a tumor, a benign tumor, a malignant tumor, a cyst, or an area of diseased tissue, etc) is provided by delivering specialized pulsed electric field (PEF) energy to target tissue areas in a specific dose so as to obtain a superior outcome. The PEF energy and delivery has been optimized to provide advanced treatment of target tissue areas, including destruction of undesired tissue and generation of improved inflammatory and immune responses. These various types of treatment are controlled by a variety of factors including the electrode geometry, the dose of PEF energy delivered, the time the energy is delivered over, and the waveform of the PEF energy itself. The PEF energy is delivered in the form a dose which is considered to be one application of the specialized energy. Each dose creates a lesion in the target tissue area.

This invention provides compounds of Formulae (IA), (IB), (IC), (ID), (IE), (IF), (IG), (IH), (IJ), (IK), (IL), (II), (III), (IIIA), and (IIIB); pharmaceutically acceptable salts and solvates thereof; and compositions thereof. This invention further provides methods for treating a disease, including but not limited to, liver disease or an abnormal liver condition; cancer (such as hepatocellular carcinoma or cholangiocarcinoma); a malignant or benign tumor of the lung, liver, gall bladder, bile duct or digestive tract; an intra- or extra-hepatic bile duct disease; a disorder of lipoprotein; a lipid-and-metabolic disorder; cirrhosis; fibrosis; a disorder of glucose metabolism; a cardiovascular or related vascular disorder; a disease resulting from steatosis, fibrosis, or cirrhosis; a disease associated with increased inflammation (such as hepatic inflammation or pulmonary inflammation); hepatocyte ballooning; a peroxisome proliferator activated receptor-associated disorder; an ATP citrate lyase disorder; an acetyl-coenzyme A carboxylase disorder; obesity; pancreatitis; or renal disease.

CD24-positive malignant and benign tumors are treated by administration of a naturally occurring or modified oncolytic Zika virus. Diseases associated with abnormal T cell activation or T cell-mediated autoimmunity, wherein CD24 expression is increased, are also expected to be treated by administration of a naturally occurring or modified oncolytic Zika virus. Also contemplated are compounds and methods for treating and / or preventing Zika virus infection in a subject.

The invention discloses a methylation marker for differential diagnosis of breast malignant tumors and breast benign tumors and application of the methylation marker. The research finds that the methylation of the biopsy sample AJAP1 can be used as a potential marker for differential diagnosis of benign breast tumors, malignant breast tumors, different subtypes or different stages of malignant breast tumors. The invention has important scientific significance and clinical application value for identifying benign breast tumors, malignant breast tumors, different subtypes or different stages of malignant breast tumors and guiding and formulating a reasonable clinical treatment scheme.

Devices, systems, and methods for treatment of the subcutaneous tissues of various types. Non-invasive ultrasound energy is used for planning, monitoring and treating the adipose tissue, small blood vessels, and benign tumors of the subcutaneous tissue. While high intensity focal ultrasound (HIFU) has been used to treat many areas of the body including cancer lesions typically using ablation / high heat energy, lower intensity volumetric ultrasound (LIVU) techniques are used to denature the subcutaneous layer. Various safety features may be included to further enhance the treatment of the subcutaneous tissue using LIVU techniques.

This invention discloses a methylation marker for the differential diagnosis of malignant and benign breast tumors. The invention provides the application of the methylated SH3PXD2B gene as a marker in product preparation; the product is used for at least one of the following purposes: (1) distinguishing between benign and malignant breast tumors; (2) distinguishing between benign breast tumors and different subtypes or stages of malignant breast tumors; (3) distinguishing between different subtypes or stages of malignant breast tumors. This invention has significant scientific and clinical application value for differentiating between benign and malignant breast tumors, different subtypes or stages of malignant breast tumors, and guiding the development of reasonable clinical treatment plans.

This utility model discloses a bipolar radiofrequency electrode for bone tumor surgery, which includes a cable assembly, a handle, a scalpel, and a scalpel head connected in sequence. The scalpel head includes a suction tube and an outer steel tube that is spaced and sleeved on the suction tube, with a water outlet channel formed between the suction tube and the outer steel tube. The scalpel head includes an insulating head fixed to the distal end of the outer steel tube. The insulating head is provided with a first strip electrode and a second strip electrode arranged side by side. The insulating head located at the first strip electrode and the second strip electrode has several suction holes, which are connected to the suction tube. Several water outlet holes connected to the water outlet channel are provided on both sides of the distal end of the outer steel tube. This solution uses radiofrequency electrodes to irrigate the incision after the resection of benign spinal tumors, which can accurately stop bleeding at soft tissue bleeding points, effectively reducing the amount of bleeding. Furthermore, by utilizing the circulating supply of physiological saline, the first strip electrode and the second strip electrode are effectively wrapped by physiological saline, thereby ensuring the plasma excitation efficiency.

The present invention relates to C-X-C motif chemokine ligand 10 (CXCL10) binding proteins and their use in methods of detecting and / or diagnosing a condition in a subject, including determining the level of CXCL10 in a subject. Specific antibodies that bind total CXCL10 (full length, N-terminally truncated and citrullinated) and antibodies that bind active CXCL10 (full length) are used to measure the level of total CXCL10 and active CXCL10 in ovarian cancer patient samples. The calculated ratio between active CXCL10 and total CXCL10 is lower in patients with malignant disease compared to patients with benign tumors or healthy individuals, and this calculated ratio is the basis for methods of diagnosing malignant disease, monitoring tumor burden and disease progression.

A method for enhancing an accuracy of a benign tumor development trend assessment system includes: a first processing procedure, an image captured before the treatment is inputted to and be processed by a server computing device of the benign tumor development trend assessment system to obtain a first processing result; a second processing procedure, the images captured before and in at least one period after the treatment are inputted to and processed by the server computing device to obtain a second processing result; a trend analyzing procedure, the trend analyzing module of the server computing device analyzes the first processing result, the second processing result and the trend pathways to obtain a tumor development trend result; and a storing procedure, the first processing result, the second processing result and the tumor development trend result are transformed to an individual trend pathway which is stored in the trend analyzing module.

The invention relates to the use of a pharmaceutical medication comprising an aromatase inhibitor, preferably a steroidal aromatase inactivator and an antioxidant as effective ingredients for the treatment of sex hormone-dependent diseases. Furthermore, the invention relates to a composition comprising an aromatase inhibitor / —inactivator and α-lipoic acid and / or extract of green tea containing polyphenols. The combination of an aromatase inhibitor and—inactivator and α-lipoic acid and / or extract of green tea containing polyphenols is particularly suitable for the treatment of sex hormone-dependent diseases as well as for the treatment of benign tumors such as e.g. lipomatoses as occurring in Madelung's disease.

The present disclosure provides a prophylactic or therapeutic agent for a benign tumor. Provided is a prophylactic or therapeutic agent for a benign tumor, which comprises a WT1 peptide, an analog thereof, or a nucleic acid molecule encoding the same. In a specific embodiment, the present disclosure provides a prophylactic or therapeutic agent for a benign tumor, which comprises a WT1 peptide, an analog thereof, or a nucleic acid molecule encoding the same. In a preferred embodiment, the prophylactic or therapeutic agent for a benign tumor (e.g., familial adenomatous polyposis) according to the present disclosure comprises a killer-type and / or helper-type WT1 peptide. In a further preferred embodiment, the aforementioned WT1 peptide is a WT1 126 killer peptide and / or WT1 35 helper peptide. In another aspect, provided are WT1 peptide-specific CTLs, a method for inducing WT1-specific helper T cells, and a method for inducing dendritic cells presenting a WT1 peptide.

The invention provides a tumor image analysis processing method and system. The method comprises the following steps: acquiring a tumor image of a patient corresponding to an irradiation item; based on the patient tumor image, extracting comprehensive features of the tumor, and based on the comprehensive features, judging a display result corresponding to the tumor; if the tumor is benign, acquiring basic data corresponding to the current benign tumor, and generating a diagnosis and treatment suggestion of the benign tumor; if the tumor is malignant, acquiring a pathological type corresponding to the malignant tumor, extracting intensity distribution data corresponding to the malignant tumor, and analyzing invasiveness corresponding to the malignant tumor; according to the method, the invasiveness of the malignant tumor is comprehensively judged according to the tumor image of the patient and the blood vessel distribution and the blood sampling inspection result corresponding to the tumor position, the misdiagnosis and missed diagnosis situations caused by the poor tumor image are made up, and the diagnosis and treatment advice corresponding to the malignant tumor is generated according to the diagnosis and treatment advice. The effectiveness of tumor result analysis is guaranteed, the workload of doctors is relieved, and effective tumor intervention is achieved.

The present invention relates to the technical field of computer-aided preoperative analysis, and discloses a surgical margin path generating method and system for tumor surgery and a storage medium. The method comprises: acquiring clinical pictures of a tumor, dermatoscopy pictures, and medical history information of patients; segmenting and extracting tumor boundaries from the dermatoscopy pictures by using a preset deep learning network model to obtain skin tumor boundaries under a dermoscope; registering the skin tumor boundaries with the clinical pictures to obtain target tumor boundaries; generating an initial surgical margin path according to the medical history information, the target tumor boundaries, and a preset path generating model; in the case of a benign tumor, smoothing the initial surgical margin path to generate a surgical margin path of a fusiform incision.

Metal proteins on the surfaces of the pathogenic microorganisms have high-density zinc ions, and the zinc ions are beneficial for the pathogenic microorganisms to be attached to metal ions on the metal proteins on the surfaces of host cells (similar to that the zinc ions are found in a battery and form a zinc-other metal electrode pair with other metal ions). The pathogenic microorganisms and fragments thereof release zinc-rich products into the host body, and the zinc-rich products rapidly enable chelating agents (mainly derivatives of polyamine / aminopolycarboxylic acid) with the property of binding zinc ions to be completely bound with the zinc ions, so that the active chelating agents are consumed. When the active chelating agent is used up, the zinc-rich product is combined with the host metal protein to cause most symptoms, then a new active chelating agent is generated in the host, the zinc-rich product is separated from the host metal protein, and most symptoms are eliminated. The medicament according to the invention comprises a chelating agent (polyamine / aminopolycarboxylic acid derivative) with strong zinc ion binding properties, having the following effects:-rapid alleviation of the majority of symptoms; -attenuating the microorganism and making it out of its ability to bind to the host cell; -enhancing the immune system of the host; -clearance of zinc-rich products accumulated in host metalloproteins, eliminating the majority of symptoms; -a post-disease syndrome; -and the like. The medicine provided by the invention contains a high-activity chelating agent and a medicament (in a treated tissue) capable of generating a strong physical effect, is used for treating diseased tissues (such as bacterial infection tissues / necrotic tissues / fungal infection tissues / benign tumors / cancerous tumors), and has a remarkable curative effect.

The invention discloses a methylation marker for differential diagnosis of breast malignant tumors and breast benign tumors. The invention provides an application of a methylated SH3PXD2B gene as a marker in preparation of a product. The application of the product is at least one of the following applications: (1) distinguishing benign breast tumors and malignant breast tumors; (2) distinguishing breast benign tumors and breast malignant tumors of different subtypes or different stages; and (3) distinguishing different subtypes or different stages of the breast malignant tumors. The invention has important scientific significance and clinical application value for identifying benign breast tumors, malignant breast tumors, different subtypes or different stages of malignant breast tumors and guiding and formulating a reasonable clinical treatment scheme.

The invention provides a culture medium and a culture method of normal oral fibroblasts. The culture medium comprises a DMEM (Dulbecco's Modified Eagle Medium) and the following components based on the volume of the DMEM: 10v% of Australian fetal calf serum, 2.5 ng / ml of bFGF (Basic Fibroblast Growth Factor), 1v% of a penicillin-streptomycin solution, 2.0 ug / ml of hydrocortisone and 0.05 ug / ml of FGF10 (Fibroblast Growth Factor 10). The invention solves the problems of high NF culture difficulty, easy pollution, low survival rate, incapability of permanent passage and the like, provides a basis for further exploring a mechanism for activating the NF into CAFs, is beneficial to finding and finding new therapeutic targets, and provides a new clinical diagnosis and treatment idea for treating and preventing the deterioration of the salivary gland benign tumor.

This invention provides compounds of Formulae (IA), (IB), (IC), (ID), (IE), (IF), (IG), (IH), (IJ), (IK), (IL), (II), (III), (IIIA), and (IIIB); pharmaceutically acceptable salts and solvates thereof; and compositions thereof. This invention further provides methods for treating a disease, including but not limited to, liver disease or an abnormal liver condition; cancer (such as hepatocellular carcinoma or cholangiocarcinoma); a malignant or benign tumor of the lung, liver, gall bladder, bile duct or digestive tract; an intra- or extra-hepatic bile duct disease; a disorder of lipoprotein; a lipid-and-metabolic disorder; cirrhosis; fibrosis; a disorder of glucose metabolism; a cardiovascular or related vascular disorder; a disease resulting from steatosis, fibrosis, or cirrhosis; a disease associated with increased inflammation (such as hepatic inflammation or pulmonary inflammation); hepatocyte ballooning; a peroxisome proliferator activated receptor-associated disorder; an ATP citrate lyase disorder; an acetyl-coenzyme A carboxylase disorder; obesity; pancreatitis; or renal disease.

The present disclosure provides a composition for preventing or treating a benign tumor. Provided is a composition for preventing or treating a benign tumor that comprises a WT1 peptide or an analog thereof, or a nucleic acid molecule encoding a WT1 peptide or an analog thereof. In a specific embodiment, the present disclosure provides a composition for preventing or treating a benign tumor that comprises a WT1 peptide or an analog thereof, or a nucleic acid molecule encoding a WT1 peptide or an analog thereof. In a preferred embodiment, the composition for preventing or treating a benign tumor (e.g. familial adenomatous polyposis) according to the present disclosure comprises a killer type WT1 peptide and / or a helper type WT1 peptide. In a further preferred embodiment, the WT1 peptide is WT1126 killer peptide and / or WT135 helper peptide. In another aspect, provided are a method of inducing WT1 peptide-specific CTLs, a method of inducing WT1-specific helper T cells, and a method of inducing dendritic cells presenting a WT1 peptide.

The invention relates to the technical field of image recognition, and discloses a breast ultrasonic tumor recognition method fusing channel attention and dynamic channel routing, which comprises the following steps: acquiring a breast ultrasonic image, and carrying out preprocessing and data enhancement; constructing a deep convolutional neural network containing a ResNet101 backbone network, an SE channel attention unit and a dynamic feature reconstruction module; taking Focal Loss with category weight as a loss function, and combining with an SAM optimizer to train the network; according to the method, an SE channel attention unit is embedded, a dynamic feature reconstruction module is connected, and an SAM optimizer is cooperatively used, so that the model can model channel importance and global space context dependence at the same time, and the classification probability of a benign tumor, a malignant tumor or a normal tissue is output. And a flat minimum value is found on a complex loss curved surface, so that accurate and robust recognition of tumors in low-quality and small-sample breast ultrasound images is realized, and the classification accuracy and generalization ability are effectively improved.

The invention discloses a system for identifying benign and malignant thyroid tumors based on combined genes. The invention provides a computer device, which comprises a memory, a processor and a computer program stored on the memory, and the processor executes the computer program to realize the following steps: collecting methylation level data of DNA methylation marker combinations (selected from LZTFL1, BCAR3 and LPR4) of two types of samples A and B, establishing a model, and determining a threshold value; inputting methylation level data of a DNA methylation marker combination of a to-be-detected person, substituting the methylation level data into the model to obtain a detection index, and comparing the detection index with a threshold to determine whether a to-be-detected sample is a type A or a type B; the A type sample and the B type sample are thyroid benign tumor and malignant tumor respectively. Compared with the low methylation phenomenon of LZTFL1, BCAR3 and LPR4 genes in benign tumor and thyroid malignant tumor tissues, the invention has important clinical application value for improving the early diagnosis and treatment effect of thyroid cancer.

Disclosed herein is a method and apparatus for cancer detection and diagnosis by amplification of a reflected signal from the tissue of interest. Specifically, a linearly polarized EM beam travels above the tested area and enters the tested area curvature at a zero incidence angle. The detected tumor's size is correlated with the area under the reflected signal's curve, which depends on size and depth inside the tested body. The amplitude of the reflected signal depends on an angle (θ), unique to each type of tissue, between the plane of the linearly polarized EM beam and its vector of velocity. A method is also disclosed that includes conducting a background scan, scanning at the angle (θ-m) determined for the malignant tumor's tissue, and scanning at the angle (θ-b) determined for the benign tumor's tissue. Amplitude differences between the malignant or benign scans and the background scans indicates the discovered tumor.

Provided are fluorescent probes capable of detecting breast cancer, lung cancer, and squamous cell carcinoma. A fluorescent probe for detecting breast cancer and benign breast tumors comprises a compound represented by the following general formula (I) or a salt thereof.

Provided are an anti-Nectin-4 antibody and the use thereof. The anti-Nectin-4 antibody or antigen-binding fragment can specifically bind to Nectin-4 and has high affinity and strong endocytosis capacity, and therefore can be used for diagnosis, prevention, and / or treatment of tumors (comprising cancers and benign tumors).

The application discloses application of serum tsRNA in preparation of a non-small cell lung cancer early diagnosis or detection reagent, and is characterized in that the serum tsRNA is tsRNA-Asp-5-0013 sequence, the stem loop structure reverse transcription primer sequence is CACTCAACAGACCTGCACGAGCACGAC AGTCACAAGAGGTGCAGGTCTGT, the fluorescence quantitative PCR specific amplification upstream primer is GAGAACACTGACAGCACGAG, and the downstream primer is CCTTCCTCGTTAGTATAGT. The application also provides application of the serum tsRNA in preparation of non-small cell lung cancer and benign tumor, tumor size, non-small cell lung cancer N0 and N1-3 stage, M0 and M1 stage and TNM stage diagnosis, and has high specificity and sensitivity.

The present invention discloses a gynecological tumor diagnosis system based on super-resolution imaging of platelet subcellular structure, which includes a super-resolution image acquisition module of platelet subcellular structure, a platelet classification and statistics module, and a gynecological tumor diagnosis module; the gynecological tumor diagnosis system is based on the super-resolution image of platelet α particles, classifies platelets according to the distribution form of α particles, and counts the proportion of platelets with "regular distribution" of α particles. The higher the proportion of platelets with "regular distribution" of α particles, the higher the risk of judging that the sample is a gynecological malignant tumor. In particular, if the proportion of platelets with "regular distribution" of α particles is greater than the proportion corresponding to the Youden maximum, the sample is judged to be at high risk of gynecological malignant tumor. The gynecological tumor diagnosis system has high sensitivity and good specificity, and can be used to quickly identify patients with benign gynecological tumors and gynecological malignant tumors.

The present disclosure provides methods and reagents for diagnosing pancreatic cystic tumors. Specifically, it relates to a pancreatic cyst fluid detection method based on proteins and their glycosylation modifications, which is used for the diagnosis of pancreatic cystic tumors, thereby distinguishing mucinous tumors from non-mucinous tumors, and malignant / borderline malignant tumors from benign tumors.

The present invention discloses a combination of body fluid markers and its application in distinguishing breast tumors. The present invention uses body fluid as a sample, and uses liquid chromatography tandem mass spectrometry to obtain protein expression and blood routine data of patients with benign breast tumors, patients with malignant breast tumors, and healthy people, and establishes a proteomics-based prediction model for distinguishing whether the sample corresponds to a healthy person, a patient with benign breast tumors, and a patient with malignant breast tumors. The prediction method of the present invention has the characteristics of non-invasive and convenient detection, and can accurately distinguish whether the sample corresponds to a healthy person, a patient with benign breast tumors, and a patient with malignant breast tumors.

The present invention relates anti-microbial antibody signatures related to lung tumors, including benign tumors and adenocarcinomas. Disclosed herein are antibody panels comprising antigens from bacteria and / or viruses for use in early and accurate diagnosis of lung cancer and for reducing false positive lung carcinoma diagnoses from CT screening.