26 results about "Benign tumours" patented technology

Devices, systems, and methods for treatment of the subcutaneous tissues of various types. Non-invasive ultrasound energy is used for planning, monitoring and treating the adipose tissue, small blood vessels, and benign tumors of the subcutaneous tissue. While high intensity focal ultrasound (HIFU) has been used to treat many areas of the body including cancer lesions typically using ablation / high heat energy, lower intensity volumetric ultrasound (LIVU) techniques are used to denature the subcutaneous layer. Various safety features may be included to further enhance the treatment of the subcutaneous tissue using LIVU techniques.

This invention discloses a methylation marker for the differential diagnosis of malignant and benign breast tumors. The invention provides the application of the methylated SH3PXD2B gene as a marker in product preparation; the product is used for at least one of the following purposes: (1) distinguishing between benign and malignant breast tumors; (2) distinguishing between benign breast tumors and different subtypes or stages of malignant breast tumors; (3) distinguishing between different subtypes or stages of malignant breast tumors. This invention has significant scientific and clinical application value for differentiating between benign and malignant breast tumors, different subtypes or stages of malignant breast tumors, and guiding the development of reasonable clinical treatment plans.

This utility model discloses a bipolar radiofrequency electrode for bone tumor surgery, which includes a cable assembly, a handle, a scalpel, and a scalpel head connected in sequence. The scalpel head includes a suction tube and an outer steel tube that is spaced and sleeved on the suction tube, with a water outlet channel formed between the suction tube and the outer steel tube. The scalpel head includes an insulating head fixed to the distal end of the outer steel tube. The insulating head is provided with a first strip electrode and a second strip electrode arranged side by side. The insulating head located at the first strip electrode and the second strip electrode has several suction holes, which are connected to the suction tube. Several water outlet holes connected to the water outlet channel are provided on both sides of the distal end of the outer steel tube. This solution uses radiofrequency electrodes to irrigate the incision after the resection of benign spinal tumors, which can accurately stop bleeding at soft tissue bleeding points, effectively reducing the amount of bleeding. Furthermore, by utilizing the circulating supply of physiological saline, the first strip electrode and the second strip electrode are effectively wrapped by physiological saline, thereby ensuring the plasma excitation efficiency.

The present invention relates to C-X-C motif chemokine ligand 10 (CXCL10) binding proteins and their use in methods of detecting and / or diagnosing a condition in a subject, including determining the level of CXCL10 in a subject. Specific antibodies that bind total CXCL10 (full length, N-terminally truncated and citrullinated) and antibodies that bind active CXCL10 (full length) are used to measure the level of total CXCL10 and active CXCL10 in ovarian cancer patient samples. The calculated ratio between active CXCL10 and total CXCL10 is lower in patients with malignant disease compared to patients with benign tumors or healthy individuals, and this calculated ratio is the basis for methods of diagnosing malignant disease, monitoring tumor burden and disease progression.

The invention relates to the use of a pharmaceutical medication comprising an aromatase inhibitor, preferably a steroidal aromatase inactivator and an antioxidant as effective ingredients for the treatment of sex hormone-dependent diseases. Furthermore, the invention relates to a composition comprising an aromatase inhibitor / —inactivator and α-lipoic acid and / or extract of green tea containing polyphenols. The combination of an aromatase inhibitor and—inactivator and α-lipoic acid and / or extract of green tea containing polyphenols is particularly suitable for the treatment of sex hormone-dependent diseases as well as for the treatment of benign tumors such as e.g. lipomatoses as occurring in Madelung's disease.

The present disclosure provides a prophylactic or therapeutic agent for a benign tumor. Provided is a prophylactic or therapeutic agent for a benign tumor, which comprises a WT1 peptide, an analog thereof, or a nucleic acid molecule encoding the same. In a specific embodiment, the present disclosure provides a prophylactic or therapeutic agent for a benign tumor, which comprises a WT1 peptide, an analog thereof, or a nucleic acid molecule encoding the same. In a preferred embodiment, the prophylactic or therapeutic agent for a benign tumor (e.g., familial adenomatous polyposis) according to the present disclosure comprises a killer-type and / or helper-type WT1 peptide. In a further preferred embodiment, the aforementioned WT1 peptide is a WT1 126 killer peptide and / or WT1 35 helper peptide. In another aspect, provided are WT1 peptide-specific CTLs, a method for inducing WT1-specific helper T cells, and a method for inducing dendritic cells presenting a WT1 peptide.

Metal proteins on the surfaces of the pathogenic microorganisms have high-density zinc ions, and the zinc ions are beneficial for the pathogenic microorganisms to be attached to metal ions on the metal proteins on the surfaces of host cells (similar to that the zinc ions are found in a battery and form a zinc-other metal electrode pair with other metal ions). The pathogenic microorganisms and fragments thereof release zinc-rich products into the host body, and the zinc-rich products rapidly enable chelating agents (mainly derivatives of polyamine / aminopolycarboxylic acid) with the property of binding zinc ions to be completely bound with the zinc ions, so that the active chelating agents are consumed. When the active chelating agent is used up, the zinc-rich product is combined with the host metal protein to cause most symptoms, then a new active chelating agent is generated in the host, the zinc-rich product is separated from the host metal protein, and most symptoms are eliminated. The medicament according to the invention comprises a chelating agent (polyamine / aminopolycarboxylic acid derivative) with strong zinc ion binding properties, having the following effects:-rapid alleviation of the majority of symptoms; -attenuating the microorganism and making it out of its ability to bind to the host cell; -enhancing the immune system of the host; -clearance of zinc-rich products accumulated in host metalloproteins, eliminating the majority of symptoms; -a post-disease syndrome; -and the like. The medicine provided by the invention contains a high-activity chelating agent and a medicament (in a treated tissue) capable of generating a strong physical effect, is used for treating diseased tissues (such as bacterial infection tissues / necrotic tissues / fungal infection tissues / benign tumors / cancerous tumors), and has a remarkable curative effect.

The invention provides a culture medium and a culture method of normal oral fibroblasts. The culture medium comprises a DMEM (Dulbecco's Modified Eagle Medium) and the following components based on the volume of the DMEM: 10v% of Australian fetal calf serum, 2.5 ng / ml of bFGF (Basic Fibroblast Growth Factor), 1v% of a penicillin-streptomycin solution, 2.0 ug / ml of hydrocortisone and 0.05 ug / ml of FGF10 (Fibroblast Growth Factor 10). The invention solves the problems of high NF culture difficulty, easy pollution, low survival rate, incapability of permanent passage and the like, provides a basis for further exploring a mechanism for activating the NF into CAFs, is beneficial to finding and finding new therapeutic targets, and provides a new clinical diagnosis and treatment idea for treating and preventing the deterioration of the salivary gland benign tumor.

This invention provides compounds of Formulae (IA), (IB), (IC), (ID), (IE), (IF), (IG), (IH), (IJ), (IK), (IL), (II), (III), (IIIA), and (IIIB); pharmaceutically acceptable salts and solvates thereof; and compositions thereof. This invention further provides methods for treating a disease, including but not limited to, liver disease or an abnormal liver condition; cancer (such as hepatocellular carcinoma or cholangiocarcinoma); a malignant or benign tumor of the lung, liver, gall bladder, bile duct or digestive tract; an intra- or extra-hepatic bile duct disease; a disorder of lipoprotein; a lipid-and-metabolic disorder; cirrhosis; fibrosis; a disorder of glucose metabolism; a cardiovascular or related vascular disorder; a disease resulting from steatosis, fibrosis, or cirrhosis; a disease associated with increased inflammation (such as hepatic inflammation or pulmonary inflammation); hepatocyte ballooning; a peroxisome proliferator activated receptor-associated disorder; an ATP citrate lyase disorder; an acetyl-coenzyme A carboxylase disorder; obesity; pancreatitis; or renal disease.

The present disclosure provides a composition for preventing or treating a benign tumor. Provided is a composition for preventing or treating a benign tumor that comprises a WT1 peptide or an analog thereof, or a nucleic acid molecule encoding a WT1 peptide or an analog thereof. In a specific embodiment, the present disclosure provides a composition for preventing or treating a benign tumor that comprises a WT1 peptide or an analog thereof, or a nucleic acid molecule encoding a WT1 peptide or an analog thereof. In a preferred embodiment, the composition for preventing or treating a benign tumor (e.g. familial adenomatous polyposis) according to the present disclosure comprises a killer type WT1 peptide and / or a helper type WT1 peptide. In a further preferred embodiment, the WT1 peptide is WT1126 killer peptide and / or WT135 helper peptide. In another aspect, provided are a method of inducing WT1 peptide-specific CTLs, a method of inducing WT1-specific helper T cells, and a method of inducing dendritic cells presenting a WT1 peptide.

The invention relates to the technical field of image recognition, and discloses a breast ultrasonic tumor recognition method fusing channel attention and dynamic channel routing, which comprises the following steps: acquiring a breast ultrasonic image, and carrying out preprocessing and data enhancement; constructing a deep convolutional neural network containing a ResNet101 backbone network, an SE channel attention unit and a dynamic feature reconstruction module; taking Focal Loss with category weight as a loss function, and combining with an SAM optimizer to train the network; according to the method, an SE channel attention unit is embedded, a dynamic feature reconstruction module is connected, and an SAM optimizer is cooperatively used, so that the model can model channel importance and global space context dependence at the same time, and the classification probability of a benign tumor, a malignant tumor or a normal tissue is output. And a flat minimum value is found on a complex loss curved surface, so that accurate and robust recognition of tumors in low-quality and small-sample breast ultrasound images is realized, and the classification accuracy and generalization ability are effectively improved.

Disclosed herein is a method and apparatus for cancer detection and diagnosis by amplification of a reflected signal from the tissue of interest. Specifically, a linearly polarized EM beam travels above the tested area and enters the tested area curvature at a zero incidence angle. The detected tumor's size is correlated with the area under the reflected signal's curve, which depends on size and depth inside the tested body. The amplitude of the reflected signal depends on an angle (θ), unique to each type of tissue, between the plane of the linearly polarized EM beam and its vector of velocity. A method is also disclosed that includes conducting a background scan, scanning at the angle (θ-m) determined for the malignant tumor's tissue, and scanning at the angle (θ-b) determined for the benign tumor's tissue. Amplitude differences between the malignant or benign scans and the background scans indicates the discovered tumor.

Provided are fluorescent probes capable of detecting breast cancer, lung cancer, and squamous cell carcinoma. A fluorescent probe for detecting breast cancer and benign breast tumors comprises a compound represented by the following general formula (I) or a salt thereof.

Provided are an anti-Nectin-4 antibody and the use thereof. The anti-Nectin-4 antibody or antigen-binding fragment can specifically bind to Nectin-4 and has high affinity and strong endocytosis capacity, and therefore can be used for diagnosis, prevention, and / or treatment of tumors (comprising cancers and benign tumors).

The application discloses application of serum tsRNA in preparation of a non-small cell lung cancer early diagnosis or detection reagent, and is characterized in that the serum tsRNA is tsRNA-Asp-5-0013 sequence, the stem loop structure reverse transcription primer sequence is CACTCAACAGACCTGCACGAGCACGAC AGTCACAAGAGGTGCAGGTCTGT, the fluorescence quantitative PCR specific amplification upstream primer is GAGAACACTGACAGCACGAG, and the downstream primer is CCTTCCTCGTTAGTATAGT. The application also provides application of the serum tsRNA in preparation of non-small cell lung cancer and benign tumor, tumor size, non-small cell lung cancer N0 and N1-3 stage, M0 and M1 stage and TNM stage diagnosis, and has high specificity and sensitivity.

The present invention discloses a gynecological tumor diagnosis system based on super-resolution imaging of platelet subcellular structure, which includes a super-resolution image acquisition module of platelet subcellular structure, a platelet classification and statistics module, and a gynecological tumor diagnosis module; the gynecological tumor diagnosis system is based on the super-resolution image of platelet α particles, classifies platelets according to the distribution form of α particles, and counts the proportion of platelets with "regular distribution" of α particles. The higher the proportion of platelets with "regular distribution" of α particles, the higher the risk of judging that the sample is a gynecological malignant tumor. In particular, if the proportion of platelets with "regular distribution" of α particles is greater than the proportion corresponding to the Youden maximum, the sample is judged to be at high risk of gynecological malignant tumor. The gynecological tumor diagnosis system has high sensitivity and good specificity, and can be used to quickly identify patients with benign gynecological tumors and gynecological malignant tumors.

The present disclosure provides methods and reagents for diagnosing pancreatic cystic tumors. Specifically, it relates to a pancreatic cyst fluid detection method based on proteins and their glycosylation modifications, which is used for the diagnosis of pancreatic cystic tumors, thereby distinguishing mucinous tumors from non-mucinous tumors, and malignant / borderline malignant tumors from benign tumors.

The present invention relates anti-microbial antibody signatures related to lung tumors, including benign tumors and adenocarcinomas. Disclosed herein are antibody panels comprising antigens from bacteria and / or viruses for use in early and accurate diagnosis of lung cancer and for reducing false positive lung carcinoma diagnoses from CT screening.

The present invention relates to the technical field of computer-aided preoperative analysis, and discloses a surgical margin path generating method and system for tumor surgery and a storage medium. The method comprises: acquiring clinical pictures of a tumor, dermatoscopy pictures, and medical history information of patients; segmenting and extracting tumor boundaries from the dermatoscopy pictures by using a preset deep learning network model to obtain skin tumor boundaries under a dermoscope; registering the skin tumor boundaries with the clinical pictures to obtain target tumor boundaries; generating an initial surgical margin path according to the medical history information, the target tumor boundaries, and a preset path generating model; in the case of a benign tumor, smoothing the initial surgical margin path to generate a surgical margin path of a fusiform incision.

Devices, systems and methods are provided to treat damaged, diseased, abnormal, obstructive, cancerous or undesired tissue (e.g. a tumor, a benign tumor, a malignant tumor, a cyst, or an area of diseased tissue, etc) by delivering specialized pulsed electric field (PEF) energy to target tissue areas. The energy is delivered in a manner so as to be non-thermal (i.e. below a threshold for causing thermal ablation). Consequently, when extracellular matrices present, the extracellular matrices are preserved, and the targeted tissue maintains its structural architecture including blood vessels and lymphatics. Thus, sensitive structures, such as biological lumens, blood vessels, nerves, etc, are preserved which are critical to maintaining the integrity and functionality of the tissue. The energy is delivered with the use of systems and devices advantageously designed for superior access to target tissue throughout the body, particularly in locations previously considered inaccessible to percutaneous approaches.

The invention relates to the technical field of medical teaching aids, in particular to a breast cancer pathology demonstration teaching aid, which comprises a base and two models rotating on the base, the two models are symmetrically designed, the two models are folded to form a chest model, and the two models are oppositely unfolded to install and debug internal tissue devices; a functional inner cavity is dug in the model, an assembly plate is installed in the functional inner cavity, a capsule body is installed on the assembly plate, the capsule body is a semi-elliptical shell, the interior of the capsule body is hollow, and a reaction medium capable of being hardened or softened is designed in the capsule body; the reaction medium can be driven into solid or liquid by the variable component so as to simulate malignant or benign tumors, and the simulation palpation can be carried out on the movable adhesion, hardness and size of the lumps.

Devices, systems and methods are provided to treat damaged, diseased, abnormal, obstructive, cancerous or undesired tissue (e.g. a tumor, a benign tumor, a malignant tumor, a cyst, or an area of diseased tissue, etc) by delivering specialized pulsed electric field (PEF) energy to target tissue areas. The energy is delivered in a manner so as to be non-thermal (i.e. below a threshold for causing thermal ablation). Consequently, when extracellular matrices present, the extracellular matrices are preserved, and the targeted tissue maintains its structural architecture including blood vessels and lymphatics. Thus, sensitive structures, such as biological lumens, blood vessels, nerves, etc, are preserved which are critical to maintaining the integrity and functionality of the tissue. The energy is delivered with the use of systems and devices advantageously designed for superior access to target tissue throughout the body, particularly in locations previously considered inaccessible to percutaneous approaches.

The present application relates to the field of antibody technology and discloses a CPZ immunohistochemical antibody and its application. The antibody comprises a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO: 2 or SEQ ID NO: 6, and a light chain variable region having an amino acid sequence as shown in SEQ ID NO: 4 or SEQ ID NO: 8. The antibody prepared in the present application can assist in the differential diagnosis of hepatocellular carcinoma and intrahepatic bile duct carcinoma, ultimately effectively using CPZ to differentiate between malignant and benign liver tumors, thereby improving the diagnostic accuracy of hepatocellular carcinoma.

The invention relates to a tumor prediction method and system based on fusion of spatial perception mask prompt and multiple views. The prediction method comprises the following steps: acquiring a three-dimensional ultrasonic mammary gland image of a patient; inputting the obtained three-dimensional ultrasonic mammary gland image into a trained medical image analysis model; processing and analyzing an input three-dimensional ultrasonic mammary gland image by using the medical image analysis model to obtain a tumor benign and malignant classification result and a benign tumor malignant risk prediction result in the three-dimensional ultrasonic mammary gland image; and presenting a benign tumor malignant transformation risk prediction result in a structured text form, and generating a risk assessment result about the benign tumor. By introducing the Prompt mechanism and the training strategy, the key features of the lesion area can be identified more accurately, the accuracy of benign and malignant classification is remarkably improved, a solid foundation is provided for malignant transformation risk assessment of benign tumors, and meanwhile the workload of doctors is relieved to a certain degree.

The present application relates to the technical field of medical teaching aids, in particular to a breast cancer pathological demonstration teaching aid, which comprises a base and two models rotating on the base, the two models are symmetrically designed, the two models are folded to form a chest model, and the two models can be installed and adjusted with internal tissue devices when unfolded; a functional inner cavity is formed in the inside of the model, an assembly plate is installed in the functional inner cavity, a capsule is installed on the assembly plate, the capsule is a semi-elliptical shell, the capsule is hollow, and a reaction medium capable of hardening or softening is designed in the capsule; a variable assembly, the reaction medium can be driven to be solid or liquid by the variable assembly to simulate malignant or benign tumors, and the present application can simulate palpation of the activity, adhesion, hardness and size of the lump.