The application of a reagent for detecting a tsRNA molecular marker in intestinal mucosa tissue in the preparation of a Crohn's disease diagnostic kit

By using tRF-28-PW5SVP9N1503 real-time PCR in a Crohn's disease diagnostic kit to detect tsRNA molecular markers in intestinal mucosal tissue, the problem of insufficient sensitivity and specificity in the existing Crohn's disease diagnosis has been solved, enabling early, non-invasive, and accurate CD diagnosis.

CN121896348BActive Publication Date: 2026-06-26NINGBO FIRST HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202610365137.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-03-24
Publication Date
2026-06-26
Estimated Expiration
2046-03-24

AI Technical Summary

Technical Problem

Current technologies lack highly sensitive and specific diagnostic methods for Crohn's disease. Traditional serological markers are difficult to distinguish between CD and other inflammatory bowel diseases. Imaging examinations are costly and unsuitable for large-scale screening. Colonoscopy is highly invasive and lacks sufficient accuracy in assessment.

Method used

tRF-28-PW5SVP9N1503 was used to detect tsRNA molecular markers in intestinal mucosal tissue by real-time quantitative PCR. tRF-28-PW5SVP9N1503 was detected using specific real-time quantitative PCR primers, and its characteristic of significant downregulation in the intestinal mucosal tissue of CD patients was utilized for early diagnosis.

Benefits of technology

It enables early, non-invasive, and accurate diagnosis of Crohn's disease, with high accuracy in test results. It can effectively distinguish between healthy individuals and CD patients, improving the detection rate and facilitating early detection and timely treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121896348B_ABST
    Figure CN121896348B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of biological medicine, and specifically discloses application of a reagent for detecting a tsRNA molecular marker in intestinal mucosa tissue in preparation of a Crohn's disease diagnosis kit, characterized in that the tsRNA molecular marker is tRF-28-PW5SVP9N1503, and the sequence is GCCGTGATCGTATAGTGGTTAGTACTCT; the reagent for detecting the tsRNA molecular marker in intestinal mucosa tissue comprises tRF-28-PW5SVP9N1503 fluorescent quantitative PCR upper and lower stream primers, the upper stream primer is AATGCCGTGATCGTATAGTGGTT, and the lower stream primer is TATCCTTGTTGACGACTGGTTGAC; and the reagent has the advantages that absolute quantitative detection of the target molecule can be quickly and accurately completed only by using a small amount of sample, the reagent is used for early screening and identification of Crohn's disease, and has high sensitivity and strong specificity.
Need to check novelty before this filing date? Find Prior Art

Citation Information

Patent Citations

  • Relative quantitative detection method for stomach tissue tRF-28-ZJ47D112Z4DZ and application thereof

    CN114891884A

  • Tumor biomarker and cancer risk information generation method and device

    CN117594120A