60 results about "Absolute quantification" patented technology

The invention relates to the technical field of biology, and discloses a molecular beacon and a high-throughput sequencing library absolute quantification method thereof, and a fluorescent molecular beacon oligonucleotide (Oligo) sequence comprises a nucleotide chain (Loop chain) of a sequencing library recognition region, a first universal sequence region at the 5'upstream of the nucleotide chain (Loop chain) of the sequencing library recognition region, and a second universal sequence region at the 3 'downstream of the nucleotide chain (Loop chain) of the sequencing library recognition region; 5'of the first universal sequence region is modified into a fluorophore, and 3 'of the second universal sequence region is modified into a quenching group; and a nucleotide chain of the sequencing library recognition region is from an Illumina anmena sequencing platform or an MGI Huazai sequencing platform. The invention comprises a fluorescent molecular beacon for high-throughput sequencing library sequencing before-loading quantification, a sequence applied to a high-throughput sequencing platform and a detection method for library absolute quantification based on the molecular beacon, and overcomes the defects of a current gold standard detection method in technology and efficiency. The quantitative precision of the sequencing library is ensured; meanwhile, the economic and time cost of an actual application end is greatly reduced.

The invention belongs to the technical field of aquatic pathogen detection, and provides a primer and probe combination with strong specificity and high sensitivity, a kit and a cdPCR detection method in order to solve the problems of dependence of absolute quantification of an existing qPCR technology on a standard curve and low repeatability and stability caused by uncontrollable quality of a standard substance. The primer probe can generate specific amplification on LYCIV and has no cross reaction on other common aquatic pathogens (such as NNV, DIV1 and the like), so that the specificity of a detection result is fundamentally ensured, a false positive result caused by the cross reaction is effectively avoided, and the diagnosis accuracy is improved. The method has the characteristics of extremely high sensitivity and absolute quantification, the lower limit of detection reaches 6.2 copies / mu L, the method has more advantages in quantification of samples with extremely low concentration, early diagnosis and detection of extremely low virus load can be realized, viruses with extremely low content in fish bodies can be detected earlier, precious time is provided for disease early warning and early intervention, and the method is worthy of popularization and application. Disease outbreak is effectively prevented.

This invention discloses a method for constructing a multi-target amplicon abundance standard for microorganisms and its application, belonging to the fields of molecular biology detection and microbiome analysis. This standard material screens sequences of common human gut microbiota strains, designs and adds universal primers, and obtains 14 DNA fragments of different lengths through gene synthesis, cloning, and purification, which are then mixed according to a preset abundance. It retains natural characteristics such as primer binding sites and GC content, and can systematically correct technical deviations in amplicon sequencing, solving the problem of species abundance distortion. This standard material functions as both a non-homologous internal reference and a homologous external reference, and can be used for laboratory proficiency testing, reagent kit performance evaluation, and cross-platform data calibration, promoting the leap from relative qualitative to absolute quantitative research in microbiome studies and providing metrological support for the standardization and precision of detection results.

The application discloses a kind of absolute quantitative detection method of child respiratory tract multi-pathogen based on multi-target ladder microarray and exogenous internal reference correction.The method sets up independent micro-reaction unit to different pathogen, adds fixed amount of exogenous internal reference nucleic acid, and calculates template number by positive unit proportion combined with Poisson distribution model, then corrects the result by using the theoretical addition amount of exogenous internal reference, so as to realize parallel detection and absolute quantification of pathogen such as bocavirus, adenovirus, mycobacterium tuberculosis and mycoplasma pneumoniae without standard curve and special digital PCR equipment.The application has the advantages of high sensitivity, strong anti-interference ability, suitable for mixed infection sample analysis and clinical application, etc.

This invention discloses an absolute quantification method for pathogens and drug resistance genes in atmospheric bioaerosols and its application. Addressing the bottleneck of achieving absolute quantification of low-concentration samples while maintaining cell integrity and high-concentration nucleic acid extraction, this invention constructs a collection carrier by immobilizing a hydrophilic mixed cellulose ester microporous membrane on a technical agar plate. This is combined with a flow rate ≤30 L / min impactor sampler, ensuring structural integrity while capturing microorganisms, laying the foundation for flow cytometry quantification. This front-end collection system is deeply coupled with a dedicated cascade lysis and concentration process, enabling the acquisition of high-quality DNA suitable for metagenomic library construction and relative abundance analysis even under short-term, low-flow-rate collection. Simultaneously, the total microbial count is absolutely quantified using flow cytometry on the collected samples, and this result is fused with the relative abundance results. Through synergistic optimization of the entire chain, quantitative analysis of species-level pathogens and drug resistance genes in atmospheric bioaerosols is ultimately achieved.

This invention discloses a single-cell microarray-based kit and method for in situ quantitative detection of receptor-binding allergen-specific IgE. The kit includes: a single-cell microcavity array chip, an antigen barcode chip, a plastic clamp, IgE standards, fluorescently modified IgE detection antibodies, and auxiliary reagents. During detection, basophil single cells are loaded into the microcavity array chip, lysis buffer is added, and the cells are clamped together with the antigen barcode chip. Low-temperature incubation allows the allergen-specific IgE released from cell lysis to be captured in situ by the antigen on the chip. A sandwich immunoassay is then performed using a fluorescently labeled antibody, and absolute quantification is achieved using a standard curve. This invention is the first to achieve high-throughput, high-sensitivity, multi-component parallel in situ quantitative detection of basophil membrane receptor-binding sIgE at the single-cell level. It can directly reflect the functional sensitization state of effector cells and has advantages such as simple operation, low sample requirement, and no need for complex valve devices.

The invention relates to the field of allergen detection, in particular to an anti-Der p 2 antibody and application thereof. The invention provides an anti-Der p 2 antibody. A heavy chain variable region of the anti-Der p 2 antibody comprises an amino acid sequence of a complementarity determining region: CDR1 as shown in SEQ ID No.1, CDR2 as shown in SEQ ID No.2, and CDR3 as shown in SEQ ID No.3; or the amino acid sequence of the heavy chain variable region is as shown in SEQ ID No.8. According to the protein, a New Zealand rabbit is immunized by utilizing Der p 2 protein of a main allergen of Dermatophagoides pteronyssinus, and a group of monoclonal antibodies with high affinity and high sensitivity to Der p 2 are obtained through screening. The antibody is further subjected to humanized IgE modification and is applied to a magnetic particle chemiluminescence quantitative detection reagent of Der p 2 specific IgE. According to the reagent, a standard curve for Der p 2 independent calibration can be established, so that accurate and repeatable absolute quantitative analysis is realized, and the detection sensitivity can reach 0.1 IU / mL. The detection method formed on the basis of the anti-Der p 2 antibody provided by the invention has important value for clinical diagnosis of anaphylactic reaction.

The invention discloses a metagenome activity quantification method based on an exogenous artificially synthesized endogenous reference gene and application of the metagenome activity quantification method, and relates to the technical field of biology. According to the invention, an endogenous reference gene as shown in SEQ ID NO.1 is firstly designed, and the endogenous reference gene has no homology with an existing organism and can realize homology interference. On the basis, a metagenome activity quantitative method is further designed, and the core thought of the metagenome activity quantitative method comprises the following steps: providing an artificially synthesized vector containing an endogenous reference gene, setting the artificially synthesized vector as a standard system with gradient concentration, and adding the standard system into a sample to be detected; before addition, a to-be-detected sample is pretreated through light-sensitive DNA combined with dye so as to shield dead bacteria DNA interference, then nucleic acid extraction, library construction and sequencing are carried out, and metagenome activity quantification is obtained through bioinformatics analysis and calculation. According to the method, homology interference is eliminated from the source, absolute quantification of microbial activity is realized, the stability and standardization degree of an internal standard are improved, and the method is suitable for quantitative analysis of metagenomes in various scenes.

The application belongs to the field of gene sequencing, and discloses a microdroplet digital PCR absolute calibration method for mixed standard substances for high-throughput sequencer calibration and application thereof. The method comprises the following steps: providing N sets of primer probes for N targets in the standard substance; full background specificity verification: for the i th set of primer probes, it is necessary to prove that it can specifically detect the i th target, and prove that it has no specific detection signal in the mixed DNA sample composed of the remaining N-1 targets; only using all the primer probes verified in S2, performing parallel digital PCR detection on the standard substance sample; and calculating the absolute copy number concentration of each target according to the detection result. The method ensures the quantitative "purity" of each target in a complex mixed background, provides guarantee for high-confidence calibration results from the process design, and improves the throughput and efficiency of multi-target detection.

The application discloses a nucleic acid absolute quantification method based on nucleic acid constant temperature amplification, which comprises the following specific steps: step one, sample pretreatment, blood samples and saliva samples are pretreated respectively; step two, reaction system configuration and assembly; step three, digital micro-reaction unit preparation and amplification; and step four, multiple signal analysis and absolute quantification. In the application, multiple primer design and a double-probe system are adopted, so that the mutation detection rate is improved, and the detection limit can be reduced to 0.1% variation through Cas12a-sgRNA auxiliary verification. The double-emulsification technology of the micro-fluidic chip is adopted, so that the droplet diameter variation coefficient is controlled within 5%, and the clogged micropore rate is reduced by real-time analysis of the micropore array image through the ImageJ software, automatic marking and exclusion of abnormal units.

The application belongs to the technical field of molecular diagnosis, and particularly relates to a digital PCR kit and method for accurately detecting the copy number of a CAR gene of a CAR-T cell and a lentivirus vector. The application first realizes the absolute quantification of CAR, Rev and an internal reference gene RNase P in a single tube simultaneously, and has strong universality. Based on the principle of digital PCR, the absolute copy number is directly obtained without a standard curve, and the result is accurate and highly repeatable. The detection lower limit reaches 0.01%, and extremely low abundance CAR-T residues or microresidual diseases can be detected. Primers and probes are designed for the conservative regions of CD3zeta, Rev and RNase P, and no cross reaction is verified, so that false positives are effectively avoided. The sample only needs gDNA, and there is no requirement for cell activity, and the sample is compatible with freezing and transportation. The kit is premixed and optimized, the process is automated, and 4-5 hours are needed. The kit is suitable for the whole chain of CAR-T drug research and development, production process quality control, clinical patient monitoring and safety evaluation.

The present application relates to a kind of based on peptide segment sensitization's high-precision scale absolute quantification method of proteome.It is using chemical derivatization technique to be modified on peptide segment, to change the physicochemical property of peptide segment, improve its mass spectrum signal response intensity.The derivatization sensitizer used generally includes positive charge or proton affinity group, it is helpful to improve the ionization efficiency of peptide segment.Due to the difference of the physicochemical property of peptide segment itself, after being labeled by the same derivatization sensitizer, usually low-abundance peptide segment signal response greatly improves, and high response peptide segment changes less, to cause the difference of the mass spectrum response signal between peptide segment to reduce, so that intensity information can more accurately reflect the content of peptide segment.The advantage of this method is: high accuracy of quantification, can realize large-scale proteome absolute quantification analysis.

The invention discloses a complete virus particle detection quantification system and method based on droplet microfluidics, and belongs to the field of micro-nano technology, the system comprises a single virus adsorption microsphere and two subsystems; the single virus adsorption microspheres are coupled with an antibody through a streptavidin chemical bond, and single viruses are adsorbed by virtue of antigen-antibody specific binding; the single virus nucleic acid detection subsystem wraps microsphere liquid drops with viruses, water-phase liquid containing microsphere-virus samples and a fluorescent probe reagent are subjected to RT-PCR amplification, single virus nucleic acid is detected in the liquid drops, and fluorescent probes are used for calibrating and comparing fluorescence intensity. And the high-throughput liquid drop screening subsystem analyzes the size of the liquid drop and the intensity of the fluorescence signal, identifies the liquid drop containing the single virus, and accurately counts the fluorescence liquid drops, so that quantitative analysis on the single virus level is realized. Complete virus particles are identified by adopting a method of combining nucleic acid detection and protein detection, and high-sensitivity detection and absolute quantitative analysis on a single virus level are realized by adopting a droplet microfluidic technology.

The invention belongs to the technical field of biosynthesis, and particularly relates to a method for biosynthesizing a < 15 > N-labeled amino acid isotope standard substance by using yeast and application of the < 15 > N-labeled amino acid isotope standard substance. The full-spectrum 15N labeled amino acid can be efficiently and economically produced. The obtained labeled amino acid extract is used as a mixed internal standard, and high-precision and high-accuracy absolute quantification of multiple amino acids in a biological sample can be realized by combining an isotope dilution mass spectrometry. The method is simple in preparation process, low in cost, high in labeling efficiency and good in product biocompatibility, perfectly solves the problems that chemical synthesis isotope internal labels are high in price and limited in variety and possibly have biological interference, and provides a powerful tool for metabonomics research, disease marker discovery and clinical diagnosis.

The application belongs to the technical field of biological medicine, and specifically discloses application of a reagent for detecting a tsRNA molecular marker in intestinal mucosa tissue in preparation of a Crohn's disease diagnosis kit, characterized in that the tsRNA molecular marker is tRF-28-PW5SVP9N1503, and the sequence is GCCGTGATCGTATAGTGGTTAGTACTCT; the reagent for detecting the tsRNA molecular marker in intestinal mucosa tissue comprises tRF-28-PW5SVP9N1503 fluorescent quantitative PCR upper and lower stream primers, the upper stream primer is AATGCCGTGATCGTATAGTGGTT, and the lower stream primer is TATCCTTGTTGACGACTGGTTGAC; and the reagent has the advantages that absolute quantitative detection of the target molecule can be quickly and accurately completed only by using a small amount of sample, the reagent is used for early screening and identification of Crohn's disease, and has high sensitivity and strong specificity.

A system and method for using new biomarkers to assess individual diseases is provided. In one embodiment of the present invention, absolute quantification of annotated metabolites by mass spectrometry is used to identify certain biomarkers and derivatives thereof (i.e., signatures), which are then used to screen for, diagnose, predict, prognose, and treat various diseases, including, but not limited to, breast cancer, ovarian cancer, colorectal cancer, pancreatic cancer, and acute graft-versus-host disease.

The purpose of this invention is to establish a single-particle inductively coupled plasma mass spectrometry (ICP-MS) method for analyzing single magnetic microspheres, which can effectively avoid signal fluctuations caused by errors during absolute quantification, achieving stable and accurate quantification of two prostate cancer biomarkers. The principle of this invention is: using... + Fe 58 The frequency signals of isotopes are used to unify the number of magnetic microspheres, and the results are obtained by evaluating the frequency signals of individual magnetic microspheres. + Au 197 and + Pt 194 The intensity distribution, calculated through average intensity or fitted intensity, yields stable analytical results unaffected by changes in the number of magnetic microspheres detected. This is achieved using the intensity distribution on a single magnetic microsphere. + Au 197 and + Pt 194 The linear relationship between intensity and tPSA and fPSA demonstrates that this analytical method enables the simultaneous detection of two prostate cancer biomarkers and can be applied to the simultaneous analysis of the concentrations of the two biomarkers in the serum of patients with prostate disease.

The application provides a reagent combination, a kit and a method for detecting organic sulfur cycle metabolism related genes, and belongs to the field of organic sulfur cycle metabolism related gene detection. The reagent combination comprises a primer pair combination for specifically amplifying organic sulfur cycle metabolism related genes. The reagent combination, the gene chip and the kit of the application have very high sensitivity, specificity and coverage for detecting organic sulfur cycle metabolism related genes. The method of the application is based on HT-qPCR, can simultaneously quantitatively detect multiple environmental samples, can well distinguish different organic sulfur cycle metabolism genes in different environments, and can absolutely quantitatively and relatively quantitatively detect the abundance, provides a high-throughput molecular tool for related research of organic sulfur cycle, effectively supplements the defects of low qPCR detection throughput and inability of absolute quantification of metagenome sequencing, and provides strong technical support for ecological research.

This invention relates to the field of chromatographic detection and agricultural product quality and safety analysis technology, specifically to a system for detecting and analyzing the content of agricultural toxins based on chromatographic separation. It includes: a communication module, a signal acquisition module, a benchmark modeling module, a phase shift calculation module, a kinetic decoupling module, a quantitative analysis module, and a hardware feedback module. By synchronously acquiring spectral intensity, retention time, pump pressure transient pressure, and column oven heat flux gradient signals, a multidimensional physical space tensor is generated to establish a benchmark kinetic manifold for the pure analyte. The phase shift vector of the actual observed trajectory relative to the benchmark kinetic manifold is calculated, separating the global phase shift component from the local high-frequency response component. This invention achieves absolute quantification of the target analyte and matrix inhibition assessment, and inversely drives injection volume adjustment or knowledge base storage.

The invention relates to an archaea amoA gene absolute quantitative detection method, primers and a kit, and by using the primers with the sequences of amoAF: GCAGGCGACTATCTCTAC and amoAR: CATATACGTTGCCGTTCCT, the advantages of single amplification product, reasonable CT value interval and large archaea amoA gene amplification quantity are achieved.

The application belongs to the technical field of sewage detection, and provides a norovirus GI and GII double genotype synchronous quantitative detection method, which realizes synchronous detection and absolute quantification of norovirus GI and GII in the same reaction tube, does not need to rely on a standard curve, and avoids errors caused by batch differences of standard products; in terms of primer and probe design, the constructed detection system shows high specificity, and even under the coexistence condition of other viruses with close genetic relationship, no non-specific amplification occurs; through gradient dilution experiment verification, the digital PCR method shows good linear response in a wide dynamic range, excellent linear correlation, low repeat variation coefficient, and shows excellent detection consistency and stability; the droplet generation performance is stable, the effective droplet number is always maintained at more than 19500, and the reliability of the quantitative result is ensured.

The invention relates to an absolute quantitative detection method, primers and a kit for a nitrosospirillum amoA gene, and the primers with the sequences of NimoAF: AACATGAGCATGGAGACGAA and NimoAR: TGACTACATCGGCTTCCTG are used, so that the advantages of single amplification product, reasonable CT (Computed Tomography) value interval and large amplification quantity of the nitrosospirillum amoA gene can be achieved by using the primers with the sequences of NimoAF: AACATGAGCATGGAGACGAA and NimoAR: TGACTACATCGGCTTCCTG.

The invention discloses a nucleic acid absolute quantification method based on capillary electrophoresis, and relates to the field of nucleic acid quantitation.The method comprises the steps that a purified nucleic acid calibration product with the same nucleotide sequence and length as each target nucleic acid target is prepared for the target nucleic acid target, and the calibration product is subjected to series dilution to obtain calibration working solutions with multiple concentration gradients; aiming at each target nucleic acid target, establishing a quantitative calibration curve based on the normalized electrophoresis signal obtained by each calibration working solution corresponding to the target nucleic acid target under the target cycle number and the initial concentration, and substituting the normalized electrophoresis signal obtained by the sample to be detected under the target cycle number into the corresponding quantitative calibration curve; therefore, accurate backstepping of the initial concentration of the target nucleic acid target in the to-be-detected sample is realized, and the problem that an existing fragment analysis technology cannot trace to an absolute copy number due to nonlinearity of PCR amplification is solved.

The invention belongs to the technical field of in-vitro molecular detection of pathogenic microorganisms, and particularly relates to a primer probe group and a kit for multiple fluorescent PCR (Polymerase Chain Reaction) and / or multiple quantitative digital PCR detection of rhizopus, mucor, rhizomucor, trachycarpus and cunningham fungi. The primer probe group disclosed by the invention can be used for realizing'single-tube quintuplet 'qualitative detection by adopting a multiple fluorescent PCR method, can also be used for realizing'five-target synchronous absolute quantification' by adopting a multiple quantitative digital PCR method, and can also be used for combining the'single-tube quintuplet 'qualitative detection of the multiple fluorescent PCR method with the'five-target synchronous absolute quantification' of the multiple quantitative digital PCR method. The primer probe group and the kit provided by the invention have the characteristics of high specificity, high sensitivity, short detection period, high tolerance to a complex sample matrix and the like, and an integrated molecular detection solution is provided for early and accurate diagnosis of clinical invasive hair mold.

The invention provides an absolute quantitative analysis method for digital immunodetection. Specifically, the invention provides a digital immunodetection analysis method for absolute quantification of protein, and the method explains a process of capturing to-be-detected protein by magnetic beads loaded with a capture antibody or a first antibody in a digital immunodetection process as a Poisson distribution process, and realizes accurate quantification of the to-be-detected protein based on the Poisson distribution process.

This invention relates to the fields of microfluidic chip technology and molecular diagnostic technology, and discloses a self-driven digital microfluidic chip and its application in digital recombinase polymerase amplification. The chip comprises two layers: an upper PDMS sheet and a lower glass plate. The lower surface of the upper PDMS sheet is etched with a microfluidic channel structure, including a sample loading port, a droplet reactor array, microchannels, and a pump chamber. The upper and lower layers are thermally bonded to form a sealed flow channel. Based on the gas permeability of PDMS material, this invention achieves self-driven sample introduction and digital dispensing by pre-degassing to create negative pressure, eliminating the need for any external equipment. The chip structure of this invention is rationally designed, with a simple preparation process, low cost, and convenient operation. It can automatically complete sample digitization within 5-10 minutes, supports multi-channel parallel detection, is highly compatible with RPA reaction systems, and can achieve absolute quantitative analysis of target nucleic acids. It has advantages such as high detection sensitivity, accurate quantification, and good repeatability, and has broad application prospects in the field of molecular diagnostics.

The invention relates to the technical field of biological analysis, in particular to a nephropathy and staging probability distribution vector extraction method based on real-time endogenous fluorescence imaging data of urine protein gel electrophoresis. Comprising the following steps: acquiring gray value data of each molecular weight zone of urine protein; converting the gray value data into absolute quantitative concentration data of the urine protein component based on a pre-established concentration-gray value standard curve; integrating all concentration data to generate a digital map representing the overall distribution mode of the urine protein, and analyzing the injured part of the kidney glomerulus or / and the kidney tubule according to the digital map; inputting the digital atlas into a pre-trained convolutional neural network model, and extracting a high-dimensional feature vector through forward propagation; probability distribution vectors associated with different nephropathy stages are obtained through calculation of the classifier and serve as prediction information of the stages. Compared with the prior art, through fusion imaging and deep learning, automatic and precise prediction of urine protein whole spectrum analysis and nephropathy and stages thereof is realized.

The application relates to a foodborne pathogenic bacteria multiplex digital PCR detection reagent, a detection device and a detection method thereof. The application provides a super-multiplex foodborne pathogenic bacteria digital PCR detection system based on a multi-color coding technology. The system breaks through the physical limitation of a fluorescence channel through an innovative probe coding strategy and a signal decoding algorithm, realizes absolute quantitative detection of 7 or more foodborne pathogenic bacteria in a single reaction tube at the same time, and ensures high specificity, high accuracy, a wide linear range and good repeatability in a complex matrix.

The present invention discloses a metrology system and method for transcriptome absolute quantification, the system comprising: a set of RNA calibrator compositions comprising a first composition and a second composition, both the first composition and the second composition comprising a plurality of RNA calibrators; a data processing module configured to perform the following operations: receiving a sequencing reading generated by a sample co-processed with the calibrator; generating a calibration model of the sequencing based on the authentication absolute amount of the calibrator and the corresponding actual measurement reading; and converting the sequencing reading of the endogenous transcript in the sample into an absolute copy number traceable to an SI unit by applying the calibration model. According to the system, cross-laboratory, cross-platform and cross-gene complete transcriptome absolute quantification and direct comparison are realized for the first time, and a fundamental metrology solution is provided for solving data non-repeatability crisis and interoperability crisis in the genomics field.

The invention belongs to the technical field of biological medicine, and particularly discloses application of a reagent for detecting a tsRNA molecular marker in intestinal mucosa tissue to preparation of a Crohn disease diagnostic kit, the reagent is characterized in that the tsRNA molecular marker is tRF-28-PW5SVP9N1503, the sequence of the tsRNA molecular marker is GCCGTGATAGTGGTTAGTACTCT, the reagent for detecting the tsRNA molecular marker in the intestinal mucosa tissue comprises tRF-28-PW5SVP9N1503 fluorescent quantitative PCR upstream and downstream primers, and the primer sequence of the tsRNA molecular marker in the intestinal mucosa tissue is shown in the description. The upstream primer is AATG CCGTGATCGTATAGTGGTT, and the downstream primer is TATCCTTGTTGACGACTGGTTGAC, and the downstream primer is The method has the advantages that absolute quantitative detection of target molecules can be rapidly and accurately completed only with a small amount of samples, and the method is used for early screening and identification of Crohn's disease and is high in sensitivity and specificity.