85 results about "Absolute quantification" patented technology

The invention relates to a primer probe combination and a kit for detecting eDNA of Chinese sturgeons and application of the primer probe combination and the kit. Specific primers and TaqMan probes are designed for a D-loop region of Chinese sturgeon mitochondrial DNA, and efficient specific amplification and absolute quantification of Chinese sturgeon eDNA in an environmental sample are realized by optimizing a reaction system and amplification conditions. Compared with the prior art, the method is simple and convenient to operate, does not need to perform harmful sampling on Chinese sturgeon individuals, is suitable for resource monitoring and protection evaluation in a large-range and dynamic environment, and has high sensitivity, high accuracy and high practical value.

The invention relates to the field of antibodies, in particular to an anti-Der p 1 antibody and application thereof. The invention provides an anti-Der p 1 antibody, the anti-Der p 1 antibody comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises an amino acid sequence of a complementarity determining region, and the amino acid sequence of the complementarity determining region comprises CDR1 as shown in SEQ ID No.1, CDR2 as shown in SEQ ID No.2 and CDR3 as shown in SEQ ID No.3; or the amino acid sequence of the heavy chain variable region is as shown in SEQ ID No.8. The anti-Der p1 antibody provided by the invention is a monoclonal antibody with high affinity and high sensitivity, after the monoclonal antibody is subjected to humanized IgE transformation, the monoclonal antibody is applied to a Dermatophagoides pteronyssinus allergen component Derp1 specificity IgE magnetic particle chemiluminescence quantitative detection reagent, and a standard curve independently calibrated by the Dermatophagoides pteronyssinus allergen component Derp1 can be obtained; real, accurate and repeatable absolute quantification is realized, the Dermatophagoides pteronyssinus allergen component Derp 1 specificity IgE with the concentration of 0.1 IU / mL can be detected, and the method has clinical diagnosis significance in allergic reaction identification.

The invention relates to a library construction method for UMI and Poly-A tail analysis and application of the library construction method. According to the invention, a novel library construction process is designed, a UMI + Poly-A tail tandem library process is established, all sequences of the Poly-A tail can be completely obtained, the method can be used for simultaneous sequencing analysis of UMI and Poly-A tail, absolute quantification can be carried out on original transcripts, the sequencing efficiency and precision are improved, short PCR products are connected in series, long fragments are formed, and the sequencing time is shortened. The advantages of long sequencing length and long reading length of Pacbio can be fully utilized, the most original RNA molecules are accurately backtracked and counted, and a real gene expression profile is obtained.

The present application relates to the technical field of molecular biology detection, in particular to an absolute antibody Taq DNA polymerase activity determination method based on real-time fluorescence quantitative detection, comprising the following steps: firstly, establishing a standard curve of DNA content and fluorescence value by reacting different concentrations of double-stranded lambda DNA with fluorescent dyes; then, performing an extension reaction in a specific reaction system using M13 single-stranded DNA as a template, recording fluorescence values in real time, calculating net fluorescence values and establishing a linear relationship between the net fluorescence values and reaction time; converting the amount of newly generated double-stranded DNA at different time points by using the standard curve, further calculating the consumption amount of dNTPs, and finally obtaining the absolute activity of the antibody Taq DNA polymerase according to the definition of the activity of the antibody Taq DNA polymerase. The whole process combines fluorescence detection and a standard curve to realize accurate determination of enzyme activity.

Disclosed is a biological control composition comprising a known molar amount of bacilysin, or a known and high ratio of bacilysin to fengycin, uses of said composition, a method for purifying bacilysin and a method for absolute quantification of bacilysin.

The invention relates to the technical field of biology, and discloses a molecular beacon and a high-throughput sequencing library absolute quantification method thereof, and a fluorescent molecular beacon oligonucleotide (Oligo) sequence comprises a nucleotide chain (Loop chain) of a sequencing library recognition region, a first universal sequence region at the 5'upstream of the nucleotide chain (Loop chain) of the sequencing library recognition region, and a second universal sequence region at the 3 'downstream of the nucleotide chain (Loop chain) of the sequencing library recognition region; 5'of the first universal sequence region is modified into a fluorophore, and 3 'of the second universal sequence region is modified into a quenching group; and a nucleotide chain of the sequencing library recognition region is from an Illumina anmena sequencing platform or an MGI Huazai sequencing platform. The invention comprises a fluorescent molecular beacon for high-throughput sequencing library sequencing before-loading quantification, a sequence applied to a high-throughput sequencing platform and a detection method for library absolute quantification based on the molecular beacon, and overcomes the defects of a current gold standard detection method in technology and efficiency. The quantitative precision of the sequencing library is ensured; meanwhile, the economic and time cost of an actual application end is greatly reduced.

The invention belongs to the technical field of aquatic pathogen detection, and provides a primer and probe combination with strong specificity and high sensitivity, a kit and a cdPCR detection method in order to solve the problems of dependence of absolute quantification of an existing qPCR technology on a standard curve and low repeatability and stability caused by uncontrollable quality of a standard substance. The primer probe can generate specific amplification on LYCIV and has no cross reaction on other common aquatic pathogens (such as NNV, DIV1 and the like), so that the specificity of a detection result is fundamentally ensured, a false positive result caused by the cross reaction is effectively avoided, and the diagnosis accuracy is improved. The method has the characteristics of extremely high sensitivity and absolute quantification, the lower limit of detection reaches 6.2 copies / mu L, the method has more advantages in quantification of samples with extremely low concentration, early diagnosis and detection of extremely low virus load can be realized, viruses with extremely low content in fish bodies can be detected earlier, precious time is provided for disease early warning and early intervention, and the method is worthy of popularization and application. Disease outbreak is effectively prevented.

The invention discloses a multiplex fluorescent quantitative PCR (Polymerase Chain Reaction) kit and application thereof. According to the invention, a multiplex fluorescent quantitative PCR (Polymerase Chain Reaction) detection method for detecting serotype 4h listeria monocytogenes, other listeria monocytogenes and listeria ivanovii is established through the design of primers of specific plcB and i-inlE and a double-labeled probe. According to the multiplex fluorescent quantitative PCR detection method, 4h L of listeria monocytogenes, other listeria monocytogenes and listeria ivanovii infection of serum can be distinguished, and the pathogenic bacteria in food can be quantitatively detected. According to the method, the constructed specific recombinant plasmid is used as a positive quantitative standard substance, absolute quantification of target nucleic acid is achieved through a standard curve, and the method has the advantages of being convenient to operate, high in specificity, high in sensitivity, good in repeatability and the like; the method is suitable for rapid qualitative and quantitative detection of listeria monocytogenes and listeria ivanovii in clinical, food and environmental samples.

This invention discloses a method for constructing a multi-target amplicon abundance standard for microorganisms and its application, belonging to the fields of molecular biology detection and microbiome analysis. This standard material screens sequences of common human gut microbiota strains, designs and adds universal primers, and obtains 14 DNA fragments of different lengths through gene synthesis, cloning, and purification, which are then mixed according to a preset abundance. It retains natural characteristics such as primer binding sites and GC content, and can systematically correct technical deviations in amplicon sequencing, solving the problem of species abundance distortion. This standard material functions as both a non-homologous internal reference and a homologous external reference, and can be used for laboratory proficiency testing, reagent kit performance evaluation, and cross-platform data calibration, promoting the leap from relative qualitative to absolute quantitative research in microbiome studies and providing metrological support for the standardization and precision of detection results.

The application discloses a kind of absolute quantitative detection method of child respiratory tract multi-pathogen based on multi-target ladder microarray and exogenous internal reference correction.The method sets up independent micro-reaction unit to different pathogen, adds fixed amount of exogenous internal reference nucleic acid, and calculates template number by positive unit proportion combined with Poisson distribution model, then corrects the result by using the theoretical addition amount of exogenous internal reference, so as to realize parallel detection and absolute quantification of pathogen such as bocavirus, adenovirus, mycobacterium tuberculosis and mycoplasma pneumoniae without standard curve and special digital PCR equipment.The application has the advantages of high sensitivity, strong anti-interference ability, suitable for mixed infection sample analysis and clinical application, etc.

This invention discloses an absolute quantification method for pathogens and drug resistance genes in atmospheric bioaerosols and its application. Addressing the bottleneck of achieving absolute quantification of low-concentration samples while maintaining cell integrity and high-concentration nucleic acid extraction, this invention constructs a collection carrier by immobilizing a hydrophilic mixed cellulose ester microporous membrane on a technical agar plate. This is combined with a flow rate ≤30 L / min impactor sampler, ensuring structural integrity while capturing microorganisms, laying the foundation for flow cytometry quantification. This front-end collection system is deeply coupled with a dedicated cascade lysis and concentration process, enabling the acquisition of high-quality DNA suitable for metagenomic library construction and relative abundance analysis even under short-term, low-flow-rate collection. Simultaneously, the total microbial count is absolutely quantified using flow cytometry on the collected samples, and this result is fused with the relative abundance results. Through synergistic optimization of the entire chain, quantitative analysis of species-level pathogens and drug resistance genes in atmospheric bioaerosols is ultimately achieved.

This invention discloses a single-cell microarray-based kit and method for in situ quantitative detection of receptor-binding allergen-specific IgE. The kit includes: a single-cell microcavity array chip, an antigen barcode chip, a plastic clamp, IgE standards, fluorescently modified IgE detection antibodies, and auxiliary reagents. During detection, basophil single cells are loaded into the microcavity array chip, lysis buffer is added, and the cells are clamped together with the antigen barcode chip. Low-temperature incubation allows the allergen-specific IgE released from cell lysis to be captured in situ by the antigen on the chip. A sandwich immunoassay is then performed using a fluorescently labeled antibody, and absolute quantification is achieved using a standard curve. This invention is the first to achieve high-throughput, high-sensitivity, multi-component parallel in situ quantitative detection of basophil membrane receptor-binding sIgE at the single-cell level. It can directly reflect the functional sensitization state of effector cells and has advantages such as simple operation, low sample requirement, and no need for complex valve devices.

The invention relates to the field of allergen detection, in particular to an anti-Der p 2 antibody and application thereof. The invention provides an anti-Der p 2 antibody. A heavy chain variable region of the anti-Der p 2 antibody comprises an amino acid sequence of a complementarity determining region: CDR1 as shown in SEQ ID No.1, CDR2 as shown in SEQ ID No.2, and CDR3 as shown in SEQ ID No.3; or the amino acid sequence of the heavy chain variable region is as shown in SEQ ID No.8. According to the protein, a New Zealand rabbit is immunized by utilizing Der p 2 protein of a main allergen of Dermatophagoides pteronyssinus, and a group of monoclonal antibodies with high affinity and high sensitivity to Der p 2 are obtained through screening. The antibody is further subjected to humanized IgE modification and is applied to a magnetic particle chemiluminescence quantitative detection reagent of Der p 2 specific IgE. According to the reagent, a standard curve for Der p 2 independent calibration can be established, so that accurate and repeatable absolute quantitative analysis is realized, and the detection sensitivity can reach 0.1 IU / mL. The detection method formed on the basis of the anti-Der p 2 antibody provided by the invention has important value for clinical diagnosis of anaphylactic reaction.

The invention discloses a metagenome activity quantification method based on an exogenous artificially synthesized endogenous reference gene and application of the metagenome activity quantification method, and relates to the technical field of biology. According to the invention, an endogenous reference gene as shown in SEQ ID NO.1 is firstly designed, and the endogenous reference gene has no homology with an existing organism and can realize homology interference. On the basis, a metagenome activity quantitative method is further designed, and the core thought of the metagenome activity quantitative method comprises the following steps: providing an artificially synthesized vector containing an endogenous reference gene, setting the artificially synthesized vector as a standard system with gradient concentration, and adding the standard system into a sample to be detected; before addition, a to-be-detected sample is pretreated through light-sensitive DNA combined with dye so as to shield dead bacteria DNA interference, then nucleic acid extraction, library construction and sequencing are carried out, and metagenome activity quantification is obtained through bioinformatics analysis and calculation. According to the method, homology interference is eliminated from the source, absolute quantification of microbial activity is realized, the stability and standardization degree of an internal standard are improved, and the method is suitable for quantitative analysis of metagenomes in various scenes.

The invention discloses an absolute quantitative detection method for urine exfoliated podocyte, relates to the technical field of biomedical detection, and aims to solve the problem that the urine exfoliated podocyte cannot be accurately and absolutely quantified due to uncertain cell loss in a sample treatment process in the prior art. The method comprises the following steps: before carrying out any physical treatment on a urine sample, adding a known number of internal standard reference substances with physical characteristics similar to those of cells into the urine sample, carrying out co-enrichment treatment on a mixed sample containing target podocytes and the internal standard reference substances, and preparing a cell slide by adopting a standardized slide preparation technology; and carrying out podocyte specific immunofluorescence staining on the slide. Through the design of internal standard preposition and whole-course synchronous calibration, the cell loss error in the operation process is effectively overcome, the traditional semi-quantitative detection is improved into accurate and repeatable absolute quantification, and the reliability and clinical application value of a detection result are remarkably improved.

The application belongs to the field of gene sequencing, and discloses a microdroplet digital PCR absolute calibration method for mixed standard substances for high-throughput sequencer calibration and application thereof. The method comprises the following steps: providing N sets of primer probes for N targets in the standard substance; full background specificity verification: for the i th set of primer probes, it is necessary to prove that it can specifically detect the i th target, and prove that it has no specific detection signal in the mixed DNA sample composed of the remaining N-1 targets; only using all the primer probes verified in S2, performing parallel digital PCR detection on the standard substance sample; and calculating the absolute copy number concentration of each target according to the detection result. The method ensures the quantitative "purity" of each target in a complex mixed background, provides guarantee for high-confidence calibration results from the process design, and improves the throughput and efficiency of multi-target detection.

The application discloses a nucleic acid absolute quantification method based on nucleic acid constant temperature amplification, which comprises the following specific steps: step one, sample pretreatment, blood samples and saliva samples are pretreated respectively; step two, reaction system configuration and assembly; step three, digital micro-reaction unit preparation and amplification; and step four, multiple signal analysis and absolute quantification. In the application, multiple primer design and a double-probe system are adopted, so that the mutation detection rate is improved, and the detection limit can be reduced to 0.1% variation through Cas12a-sgRNA auxiliary verification. The double-emulsification technology of the micro-fluidic chip is adopted, so that the droplet diameter variation coefficient is controlled within 5%, and the clogged micropore rate is reduced by real-time analysis of the micropore array image through the ImageJ software, automatic marking and exclusion of abnormal units.

The application belongs to the technical field of molecular diagnosis, and particularly relates to a digital PCR kit and method for accurately detecting the copy number of a CAR gene of a CAR-T cell and a lentivirus vector. The application first realizes the absolute quantification of CAR, Rev and an internal reference gene RNase P in a single tube simultaneously, and has strong universality. Based on the principle of digital PCR, the absolute copy number is directly obtained without a standard curve, and the result is accurate and highly repeatable. The detection lower limit reaches 0.01%, and extremely low abundance CAR-T residues or microresidual diseases can be detected. Primers and probes are designed for the conservative regions of CD3zeta, Rev and RNase P, and no cross reaction is verified, so that false positives are effectively avoided. The sample only needs gDNA, and there is no requirement for cell activity, and the sample is compatible with freezing and transportation. The kit is premixed and optimized, the process is automated, and 4-5 hours are needed. The kit is suitable for the whole chain of CAR-T drug research and development, production process quality control, clinical patient monitoring and safety evaluation.

The present application relates to a kind of based on peptide segment sensitization's high-precision scale absolute quantification method of proteome.It is using chemical derivatization technique to be modified on peptide segment, to change the physicochemical property of peptide segment, improve its mass spectrum signal response intensity.The derivatization sensitizer used generally includes positive charge or proton affinity group, it is helpful to improve the ionization efficiency of peptide segment.Due to the difference of the physicochemical property of peptide segment itself, after being labeled by the same derivatization sensitizer, usually low-abundance peptide segment signal response greatly improves, and high response peptide segment changes less, to cause the difference of the mass spectrum response signal between peptide segment to reduce, so that intensity information can more accurately reflect the content of peptide segment.The advantage of this method is: high accuracy of quantification, can realize large-scale proteome absolute quantification analysis.

The invention discloses a complete virus particle detection quantification system and method based on droplet microfluidics, and belongs to the field of micro-nano technology, the system comprises a single virus adsorption microsphere and two subsystems; the single virus adsorption microspheres are coupled with an antibody through a streptavidin chemical bond, and single viruses are adsorbed by virtue of antigen-antibody specific binding; the single virus nucleic acid detection subsystem wraps microsphere liquid drops with viruses, water-phase liquid containing microsphere-virus samples and a fluorescent probe reagent are subjected to RT-PCR amplification, single virus nucleic acid is detected in the liquid drops, and fluorescent probes are used for calibrating and comparing fluorescence intensity. And the high-throughput liquid drop screening subsystem analyzes the size of the liquid drop and the intensity of the fluorescence signal, identifies the liquid drop containing the single virus, and accurately counts the fluorescence liquid drops, so that quantitative analysis on the single virus level is realized. Complete virus particles are identified by adopting a method of combining nucleic acid detection and protein detection, and high-sensitivity detection and absolute quantitative analysis on a single virus level are realized by adopting a droplet microfluidic technology.

The invention belongs to the technical field of biosynthesis, and particularly relates to a method for biosynthesizing a < 15 > N-labeled amino acid isotope standard substance by using yeast and application of the < 15 > N-labeled amino acid isotope standard substance. The full-spectrum 15N labeled amino acid can be efficiently and economically produced. The obtained labeled amino acid extract is used as a mixed internal standard, and high-precision and high-accuracy absolute quantification of multiple amino acids in a biological sample can be realized by combining an isotope dilution mass spectrometry. The method is simple in preparation process, low in cost, high in labeling efficiency and good in product biocompatibility, perfectly solves the problems that chemical synthesis isotope internal labels are high in price and limited in variety and possibly have biological interference, and provides a powerful tool for metabonomics research, disease marker discovery and clinical diagnosis.

The application belongs to the technical field of biological medicine, and specifically discloses application of a reagent for detecting a tsRNA molecular marker in intestinal mucosa tissue in preparation of a Crohn's disease diagnosis kit, characterized in that the tsRNA molecular marker is tRF-28-PW5SVP9N1503, and the sequence is GCCGTGATCGTATAGTGGTTAGTACTCT; the reagent for detecting the tsRNA molecular marker in intestinal mucosa tissue comprises tRF-28-PW5SVP9N1503 fluorescent quantitative PCR upper and lower stream primers, the upper stream primer is AATGCCGTGATCGTATAGTGGTT, and the lower stream primer is TATCCTTGTTGACGACTGGTTGAC; and the reagent has the advantages that absolute quantitative detection of the target molecule can be quickly and accurately completed only by using a small amount of sample, the reagent is used for early screening and identification of Crohn's disease, and has high sensitivity and strong specificity.

A system and method for using new biomarkers to assess individual diseases is provided. In one embodiment of the present invention, absolute quantification of annotated metabolites by mass spectrometry is used to identify certain biomarkers and derivatives thereof (i.e., signatures), which are then used to screen for, diagnose, predict, prognose, and treat various diseases, including, but not limited to, breast cancer, ovarian cancer, colorectal cancer, pancreatic cancer, and acute graft-versus-host disease.

The application provides a full-length lncRNA absolute quantitative transcriptome library construction and sequencing method based on TSO-UMI marking and composite internal standard correction, and the library construction method steps comprise the following steps: S1, total RNA of a sample is extracted and rRNA is removed; S2, a composite internal standard is added; S3, a reverse transcription adapter primer is used to connect a product; S4, a TSO-UMI fusion primer is added, and full-length cDNA is synthesized through template switching; S5, cDNA is used as a template to perform PCR amplification; and S6, the amplified library is purified; the nucleotide sequence of the TSO-UMI fusion primer is shown in SEQ ID NO. 1 or SEQ ID NO. 2. Through TSO-UMI fusion primer sequence reconstruction, SIRV / ERCC specific composite internal standard ratio, full-process coupling experimental design, and supporting UMI+internal standard joint correction integrated bioinformatics algorithm, the problems such as PCR deviation, relative quantification, batch difference, isomer recognition, and polyA-free quantification are successfully solved, and reliable technical guidance is provided for lncRNA basic research, disease marker screening, and clinical efficacy monitoring.

The purpose of this invention is to establish a single-particle inductively coupled plasma mass spectrometry (ICP-MS) method for analyzing single magnetic microspheres, which can effectively avoid signal fluctuations caused by errors during absolute quantification, achieving stable and accurate quantification of two prostate cancer biomarkers. The principle of this invention is: using... + Fe 58 The frequency signals of isotopes are used to unify the number of magnetic microspheres, and the results are obtained by evaluating the frequency signals of individual magnetic microspheres. + Au 197 and + Pt 194 The intensity distribution, calculated through average intensity or fitted intensity, yields stable analytical results unaffected by changes in the number of magnetic microspheres detected. This is achieved using the intensity distribution on a single magnetic microsphere. + Au 197 and + Pt 194 The linear relationship between intensity and tPSA and fPSA demonstrates that this analytical method enables the simultaneous detection of two prostate cancer biomarkers and can be applied to the simultaneous analysis of the concentrations of the two biomarkers in the serum of patients with prostate disease.

The application provides a reagent combination, a kit and a method for detecting organic sulfur cycle metabolism related genes, and belongs to the field of organic sulfur cycle metabolism related gene detection. The reagent combination comprises a primer pair combination for specifically amplifying organic sulfur cycle metabolism related genes. The reagent combination, the gene chip and the kit of the application have very high sensitivity, specificity and coverage for detecting organic sulfur cycle metabolism related genes. The method of the application is based on HT-qPCR, can simultaneously quantitatively detect multiple environmental samples, can well distinguish different organic sulfur cycle metabolism genes in different environments, and can absolutely quantitatively and relatively quantitatively detect the abundance, provides a high-throughput molecular tool for related research of organic sulfur cycle, effectively supplements the defects of low qPCR detection throughput and inability of absolute quantification of metagenome sequencing, and provides strong technical support for ecological research.

This invention relates to the field of chromatographic detection and agricultural product quality and safety analysis technology, specifically to a system for detecting and analyzing the content of agricultural toxins based on chromatographic separation. It includes: a communication module, a signal acquisition module, a benchmark modeling module, a phase shift calculation module, a kinetic decoupling module, a quantitative analysis module, and a hardware feedback module. By synchronously acquiring spectral intensity, retention time, pump pressure transient pressure, and column oven heat flux gradient signals, a multidimensional physical space tensor is generated to establish a benchmark kinetic manifold for the pure analyte. The phase shift vector of the actual observed trajectory relative to the benchmark kinetic manifold is calculated, separating the global phase shift component from the local high-frequency response component. This invention achieves absolute quantification of the target analyte and matrix inhibition assessment, and inversely drives injection volume adjustment or knowledge base storage.

Along with wide planting of transgenic crops, many countries start to carry out quantitative identification on transgenic products, but the prior art still faces huge challenges in the aspect of absolute quantitative detection, so that the invention provides a vortex-driven droplet digital CRISPR / Cas (VTD-CRISPR) detection method, and belongs to the field of nucleic acid detection. According to the invention, experimental parameters of the VTD-CRISPR technology are systematically optimized, so that the reliability and the accuracy of a detection result are ensured to the greatest extent; next, the detection specificity and sensitivity of the VTD-CRISPR are further verified by comparison with the commercially used qPCR and ddPCR technologies. In addition, the invention also explores the possibility that manual operation replaces vortex to generate liquid drops and is combined with a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) technology. In conclusion, the VTD-CRISPR technology has an excellent qualitative function and an absolute quantitative function, and compared with other technologies, the VTD-CRISPR technology has the advantages of shorter detection time and lower cost, so that the VTD-CRISPR technology has great potential in practical application of quantitative detection of transgenic organisms.

The invention relates to an archaea amoA gene absolute quantitative detection method, primers and a kit, and by using the primers with the sequences of amoAF: GCAGGCGACTATCTCTAC and amoAR: CATATACGTTGCCGTTCCT, the advantages of single amplification product, reasonable CT value interval and large archaea amoA gene amplification quantity are achieved.

The application belongs to the technical field of sewage detection, and provides a norovirus GI and GII double genotype synchronous quantitative detection method, which realizes synchronous detection and absolute quantification of norovirus GI and GII in the same reaction tube, does not need to rely on a standard curve, and avoids errors caused by batch differences of standard products; in terms of primer and probe design, the constructed detection system shows high specificity, and even under the coexistence condition of other viruses with close genetic relationship, no non-specific amplification occurs; through gradient dilution experiment verification, the digital PCR method shows good linear response in a wide dynamic range, excellent linear correlation, low repeat variation coefficient, and shows excellent detection consistency and stability; the droplet generation performance is stable, the effective droplet number is always maintained at more than 19500, and the reliability of the quantitative result is ensured.