Primer and method for carrying out specific detection and absolute quantification on tomato spotted wilt virus

A technology of tomato spotted wilt virus and spotted wilt virus, applied in biochemical equipment and methods, microbe measurement/testing, DNA/RNA fragments, etc., to achieve high sensitivity, prevent economic loss, and save time

Inactive Publication Date: 2014-10-29
INST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI
View PDF5 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, with the continuous improvement of detection requirements and standards, these conventional techniques are becoming more and more difficult to meet the requirements of research. For example, the traditional serological ELISA method usually takes 1 to 2 days to detect samples, and the traditional PCR takes 7 to 8 hours.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and method for carrying out specific detection and absolute quantification on tomato spotted wilt virus
  • Primer and method for carrying out specific detection and absolute quantification on tomato spotted wilt virus
  • Primer and method for carrying out specific detection and absolute quantification on tomato spotted wilt virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Embodiment 1, design and synthesis of primers

[0060] Step 1: Primer Design

[0061] According to the TSWV gene sequence reported in the GENBANK database, after downloading as many TSWV sequences as possible (such as JN601525.1), use DNAMAN software for sequence comparison analysis; find the virus-specific and conserved regions of different strains and design primers (Table 1 ), the primers were synthesized by Shanghai Sangon Co., Ltd.

[0062] The target fragment primers are:

[0063] TSWV-482F: 5'-TCTGGTAGCATTCAACTTCA-3',

[0064] TSWV-482R: 5'-CTTCTCTGGTGTCATACTTCT-3'.

[0065] The fluorescent quantitative primers are: TSWV-113F: CTTGCCATAATGCTGGGAGGTAG, TSWV-113R: TCCCGAGGTCTTTGTATTTTGC.

[0066] Table 1 Primers used in this experiment

[0067]

[0068] Step 2: Specificity verification of specific primers TSWV-482F / TSWV-482R:

[0069] Material:

[0070] Fresh datura leaves with TSWV,

[0071] Pepper leaves in the greenhouse of Institute of Vegetable and ...

Embodiment 2

[0081] Embodiment 2, the preparation of target fragment PCR amplification and plasmid standard

[0082] (1) Extraction of plant total RNA, synthesis of cDNA first strand and amplification of target fragments

[0083] Datura datura leaves with TSWV were used as the material, and the cDNA of Datura datura leaves with TSWV was prepared by the method in step 2 of Example 2, verified by PCR amplification, and the positive cDNA samples were quantified to 1ug / ul, and stored at -80°C for later use .

[0084] (2) Preparation of plasmid standard

[0085] The target fragment of the positive sample amplified in step (1) is recovered and purified, and cloned into pMD TM Place on 18-T carrier, place on ice for 30min, add 50ul transT1 competent cells, then add 500uL LB medium without ampicillin, culture with shaking at 37°C, recover for 1h, on solid LB agar containing X-Gal, IPTG and ampicillin Cultivate overnight on the plate; select white single colonies, add 3ml of LB liquid medium con...

Embodiment 3

[0086] Embodiment 3, the establishment of TSWV real-time fluorescent quantitative PCR method

[0087] (1) Gradient PCR to verify the specificity of fluorescent quantitative primers

[0088] The fluorescent quantitative primer (113bp) used in this experiment was designed in the region of the target gene fragment (482bp).

[0089] The extracted TSWV Datura leaf RNA was reverse-transcribed and RT-PCR amplified with fluorescent quantitative primers. Step is the same as step 2 of embodiment 1. The annealing temperature in the PCR program was set to 8 gradients: 65°C, 64.5°C, 63.5°C, 62°C, 60.2°C, 58.9°C, 57.8°C, 57.0°C.

[0090] Take 10uL of the amplification product and electrophoresis with 2% agarose gel in TBE buffer, the result is as follows figure 2 , PCR products at 8 annealing temperatures were all single bands of 113bp, indicating that the fluorescent quantitative primers had strong specificity. The PCR product was sent to Beijing Qingke Xinye Biotechnology Co., Ltd. f...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a primer and a method for carrying out specific detection and absolute quantification on a tomato spotted wilt virus and belongs to the field of plant virus detection. According to the primer and method disclosed by the invention, the tomato spotted wilt virus is taken as an object of study, a more rapid, simple, accurate and sensitive method for quantitatively detecting a plant virus is established, the method comprises the following steps of (1) establishing a standard curve according to the standard plasmid; (2) obtaining the cDNA of a sample to be detected; synthesizing cDNA by virtue of reverse transcription; and carrying out fluorescence quantitative PCR by virtue of using cDNA as a template and TSWV-113F / TSWV-113R as a primer to obtain the Ct value of the sample to be detected; and (3) calculating the copy number of the tomato spotted wilt virus in the sample to be detected by virtue of the standard curve. By virtue of the method, tomato spotted wilt virus within the sample can be accurately quantified in 4-5 hours, the time is saved and the experimental steps are simplified, the method is contributed to taking corresponding remedial measures before the onset of plant diseases to prevent huge economic losses brought by the widespread of the virus among crops.

Description

technical field [0001] The invention belongs to the field of plant virus detection, and in particular relates to a primer and a method for specific detection and absolute quantification of tomato spotted wilt virus. Background technique [0002] Tomato spotted wilt virus (Tomato spotted wilt virus, TSWV) is one of the representative members of the genus Tospovirus in the family Bunyaviridae. The membrane is 20-25nm, and the nucleocapsid diameter is 60nm. It has a membrane-coated tripartite single-stranded RNA (L RNA, M RNA, S RNA) genome, encoding four structural proteins, three fragments of 5' and 3 There are 8 conserved complementary bases at the end of ', which can form a pseudo-circular structure. The L RNA (~8.9 kb) contains an open reading frame (open reading frame, ORF) encoding the viral RNA-dependent polymerase protein (RdRp). M RNA (~4.8kb) and S RNA (~2.9kb) are ambisense RNAs, in which M RNA viral strand encodes non-structural protein NSm, complementary strand ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/70C12Q1/6851C12Q2531/113C12Q2545/114C12Q2563/107
Inventor吴青君赵巍巍张治军徐宝云谢文王少丽张友军
OwnerINST OF VEGETABLE & FLOWERS CHINESE ACAD OF AGRI SCI