Supercharge Your Innovation With Domain-Expert AI Agents!

Kit and method for detecting V.mimicus using loop-mediated equal-temperature amplification technology

A ring-mediated isothermal, mimetic vibrio technology, applied in biochemical equipment and methods, microbial determination/inspection, color/spectral property measurement, etc. , to achieve high sensitivity and specificity

Inactive Publication Date: 2007-08-01
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In the past, there were mainly two ways to detect Vibrio mimicus: 1. biochemical identification method, which was time-consuming and complicated to operate, and could not meet the needs of disease control; 2. polymerase chain reaction method (PCR method), which was fast, sensitive and but requires an expensive PCR machine
There are no reports on kits and methods for detection of Vibrio mimicus by loop-mediated isothermal amplification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0032] The following examples are further illustrations of the present invention and should not be regarded as limiting the present invention.

[0033] Make the loop-mediated isothermal amplification detection kit for Vibrio mimicus according to the following formula:

[0034] (1) LAMP reaction solution A:

[0035] 2.5uL 10×Thermopol reaction buffer, 1.0uL 10mM dNTP (mixture of four deoxynucleotides), 1.0uL 20uM upstream internal primer (mim-FIP), 1.0uL 20uM downstream internal primer (mim-BIP), 0.25uL 20uM upstream outer primer (mim-F3), 0.25uL 20uM downstream outer primer (mim-B3), 0.5uL 100mM MgSO 4 , 12.5uL 2M betaine and 4uL ddH 2 O (sterilized double distilled water).

[0036] (2) Bst DNA polymerase B: the concentration is 8 U / uL.

[0037] (3) Developer C: 10% SYBR GREEN I.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a kit checking Vibrio mimicus with mediated isothermal amplification technology and the method. Said kit comprises LAMP reacting liquid A, Bst DNA polymerase B and coloured solution; and the upstream inner primer in LAMP reacting liquid A is gcggtcgtgggttacatttccattttaaggccaacaaagacgct; downstream inner primer is cagcatactgagtggttgccgcttttgcgatggtactaactgcgt; upstream outer primer is tcggataatgtggcgaaagc; downstream outer primer is tcacccatgtctgggtgtt. The checking method comprises extracting bacteria DNA, mediated isothermal amplification for Vibrio mimicus, and coloring detection. The invention is characterized by fast speed, strong specificity, high sensitivity and low cost.

Description

technical field [0001] The invention relates to a kit for detecting vibrio mimicus by using a loop-mediated isothermal amplification method, and further relates to a method for rapidly detecting vibrio mimicus using the kit. Background technique [0002] Vibrio mimicus (Vibrio mimicus) is a Gram-negative bacterium similar in biochemical characteristics to non-01-Vibrio cholerae, widely distributed in natural waters and aquatic animals. The bacteria can cause severe ascites disease in aquatic animals such as fish and crustaceans by producing a variety of virulence factors, and can also infect humans through aquatic animals or aquatic products, causing fever, diarrhea, vomiting, abdominal cramps and other diseases in humans. It poses a serious threat to human health and the aquaculture industry and is an important causative agent of human foodborne and aquaculture animal diseases. [0003] In the past, there were mainly two ways to detect Vibrio mimicus: 1. biochemical identi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04G01N21/25
Inventor 任春华胡超群罗鹏王青柏
Owner SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More