Check patentability & draft patents in minutes with Patsnap Eureka AI!

A nucleic acid combination and application thereof for detection of pathogenic vibrio

A technology for pathogenic Vibrio and hemolytic Vibrio, which is applied in the direction of microbial-based methods, recombinant DNA technology, microbial determination/inspection, etc., can solve the problems of long detection time, easy false positives, high detection limit, etc. Achieve fast detection, high specificity and sensitivity, and reliable results

Active Publication Date: 2021-12-10
SICHUAN HUAHAN TRIO BIOTECH CO LTD
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

From the methods reported above, it can be seen that the existing multiple detection methods for pathogenic Vibrio can detect no more than 4 types of Vibrio, and the applied method is limited by the technology itself. false positives etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A nucleic acid combination and application thereof for detection of pathogenic vibrio
  • A nucleic acid combination and application thereof for detection of pathogenic vibrio
  • A nucleic acid combination and application thereof for detection of pathogenic vibrio

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0147] This embodiment describes a kit for detecting pathogenic Vibrio, which includes a nucleic acid combination and a membrane chip.

[0148] Wherein, the nucleic acid combination includes the following primer pairs, and the base sequences (5'-3') of the upstream primer and the downstream primer of each primer pair are as follows:

[0149] First primer pair for Vibrio cholerae toxR gene (toxR(V.c)):

[0150] Upstream primer: ATTGACGGCTACGCCATCGACA (SEQ ID NO.1), downstream primer: ACCGCAGCCCAGCCAATGTTG (SEQ ID NO.2);

[0151] Second primer pair for detection of Vibrio cholerae ctxAB gene:

[0152] Upstream primer: CATCTGGATGAGGACTGTATGC (SEQ ID NO.3), downstream primer: GCCAAGAGGACAGAGTGAGTA (SEQ ID NO.4);

[0153] The third primer pair for detecting Vibrio parahaemolyticus toxR gene (toxR(V.p)):

[0154] Upstream primer: GAAGGCAGCCAGATGTTGATT (SEQ ID NO.5), downstream primer: TCTCAGTTCCGTCAGATTGGT (SEQ ID NO.6);

[0155] The fourth primer pair used to detect the tlh gen...

Embodiment 2

[0206] The method for detecting pathogenic Vibrio in the sample to be tested by using the above kit is as follows:

[0207] 2.1 Use 3% sodium chloride alkaline peptone water to carry out mixed bacterial enrichment culture on the sample, and take the cultured mixed bacterial solution for DNA extraction; this step is carried out as needed.

[0208] 2.1 Extract the genomic DNA of the sample to be tested according to the CTAB method, and use an ultra-micro spectrophotometer to measure the mass concentration of the DNA solution for later use.

[0209] 2.2 Multiplex PCR system and conditions

[0210] The reaction system of PCR amplification:

[0211] 10×PCR Buffer (with Mg 2+ , containing UNG enzyme): 5 μL;

[0212] dNTP (2.5mM each): 5μL;

[0213] Taq DNA polymerase (5U / μL): 0.5 μL;

[0214] Biotin-labeled downstream primers (20 μM): 1.2 μL; upstream primers (20 μM): 1 μL; instructions: 11 primer pairs (provided in Example 1) were added, each primer pair had 1.2 μL of downstre...

Embodiment 3

[0249] According to the instructions of Tiangen Biochemical Technology (Beijing) Co., Ltd. Bacterial Genomic DNA Extraction Kit (Cat. No.: DP302), extract different pathogenic Vibrio standard strains (Vibrio cholerae (without virulence factor ctxAB), Vibrio cholerae O1 group) (with virulence factors ctxAB), Vibrio parahaemolyticus 1 (without virulence factors tdh or trh), Vibrio parahaemolyticus 2 (with virulence factors tdh and trh), Vibrio vulnificus, Vibrio mimicus, Vibrio riverines and Vibrio alginolyticus) genomic DNA. The concentration and quality of the extracted DNA were measured with an ultra-micro spectrophotometer (Thermo NanoDrop 2000) for later use.

[0250] With the kit of Example 1, detect according to the method of Example 2, according to the color development of the hybridization point with reference to figure 1 Interpret the results, the results are as follows figure 2 shown.

[0251] figure 2 Vibrio cholerae (non-V. cholerae O1 or V. cholerae O139 grou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a nucleic acid combination for detecting pathogenic vibrio and its application, and relates to the detection technology of pathogenic vibrio. The nucleic acid combination includes one or more of the following primer pairs: SEQ ID NO.1-2, SEQ ID NO.3-4, SEQ ID NO.5-6, SEQ ID NO.7-8, SEQ ID NO.7-8, SEQ ID NO. ID NO.9-10, SEQ ID NO.11-12, SEQ ID NO.13-14, SEQ ID NO.15-16, SEQ ID NO.17-18 and SEQ ID NO.19-20; the nucleic acid combination Through the PCR method, it can detect common pathogenic Vibrio such as Vibrio cholerae, Vibrio parahaemolyticus, Vibrio vulnificus, Vibrio mimicus, Vibrio riverine, Vibrio alginolyticus, etc., to avoid non-specific amplification, with Strong specificity and high sensitivity.

Description

technical field [0001] The invention relates to the technical field of detection of pathogenic Vibrio, in particular to a nucleic acid combination for detection of pathogenic Vibrio and its application. Background technique [0002] Food-borne diseases are one of the most widespread health problems in the world today, and the incidence rate ranks first among various human diseases. According to the data of the World Health Organization (WHO), food-borne and water-borne diarrheal diseases cause about 2.2 million deaths every year , most of whom are children; in industrialized countries, more than 30% of the population suffers from foodborne illness each year. [0003] Pathogenic Vibrio (Pathogenic Vibrio) is an important class of food-borne pathogens, which widely exist in the natural water environment, especially in seawater, and have a large degree of pollution to seafood. my country's coastal provinces have vast sea areas and abundant seafood. Residents love to eat seafoo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/04C12N15/11C12R1/63
CPCC12Q1/689Y02A50/30
Inventor 韩嘉钰陈浩东吴春云黄忱彭丽
Owner SICHUAN HUAHAN TRIO BIOTECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More