98 results about "Parahaemolyticus vibrio" patented technology

The invention discloses a loop-mediated isothermal amplification detection primer group, a detection method and a kit of vibrio parahaemolyticus. The detection primer group is as follows: an upstream outer primer F3: 5'-GCAAAGAAACGCTTGGCG-3', a downstream outer primer B3: 5'-TGCATAGCAATGTTGTCGCT-3', an upstream inner primer FIP: 5'-TCTCTCGGGTGGTGGATGGGTTTCGTTACACTCCGTTCGC-3'; a downstream inner primer BIP: 5'-ATGGTTTGCTACTCTCGCACCCTCGGCTGACAAATGGCTCTA-3'. The detection method disclosed by the invention has the advantages of high sensitivity, high specificity, good accuracy rate and short detection time, only 12 hours are taken from sample treatment to result report, no PCR instrument or electrophoresis instrument is needed, the operation process is simple, and compared with other PCR techniques, the loop-mediated isothermal amplification detection primer group is relatively high in specificity and is applicable to detection of primary testing organizations and food companies.

The invention relates to the technical field of microbes, and provides a novel vibrio parahaemolyticus phage as well as a composition, a preparation method and application thereof. The novel vibrio parahaemolyticus phage specifically refers to a vibrio parahaemolyticus phage VP46 of which the collection number is CCTCC NO:M2016290, a vibrio parahaemolyticus phage VP48 of which the collection number is CCTCC NO:M2016291 or a vibrio parahaemolyticus phage VP7 of which the collection number is CCTCC NO:M2016289. The phage is a strictly virulent phage, is highly toxic to host bacteria, has a widerhost range, and is highly toxic to the host bacteria at a low concentration; DNA (Deoxyribonucleic Acid) of the phage cannot encode proteins which may cause a potential health risk; the phage survives stably in a culture solution at room temperature, and survives for more than 12 months at a temperature of below 4 DEG C; the phage can be well proliferated on a non-pathogenic bacterial host; and large-scale industrial production can be realized.

The invention provides a method for detecting Vibrio parahaemolyticus. The sequence of the forward primer is SEQ ID NO:1, the sequence of the reverse primer is SEQ ID NO:2, and the sequence of the probe is SEQ ID NO:3. A real-time RPA (recombinase polymerase amplification) process is utilized to detect the food-borne pathogen Vibrio parahaemolyticus, thereby implementing safe, specific, quick, sensitive and simple field quick detection on the Vibrio parahaemolyticus, and further overcoming the defects in the existing traditional detection technique. The method is suitable for field detection, can effectively inhibit the epidemic situation caused by Vibrio parahaemolyticus food poisoning in time, and perfects the food safety control system.

PCT No. PCT / JP97 / 00991 Sec. 371 Date Jan. 6, 1999 Sec. 102(e) Date Jan. 6, 1999 PCT Filed Mar. 25, 1997 PCT Pub. No. WO97 / 35970 PCT Pub. Date Oct. 2, 1997An oligonucleotide is provided which has a nucleotide sequence derived from SEQ ID NO:1, characterized in that it contains at least one site capable of amplifying a nucleotide sequence characteristic of Vibrio parahaemolyticus. The oligonucleotide may have a nucleotide sequence not derived from SEQ ID NO:3, or incapable of amplifying nucleotide sequences originating in Vibrio alginolyticus and Vibrio harveyi, and may be represented by SEQ ID NO:5 or SEQ ID NO:6. A method of detecting Vibrio parahaemolyticus in a specimen is also provided which comprises preparing a primer set comprising two of the above oligonucleotides, selectively amplifying therewith a DNA gyrase subunit B gene sequence contained in the specimen as a target, and determining whether or not there is a gyrB unit specific for Vibrio parahaemolyticus in the specimen. Also provided is a primer which reacts specifically with a gyrB gene of Vibrio parahaemolyticus to thereby differentiate and identify the same among other Vibrios and strains other than the genus Vibrio. The Vibrio parahaemolyticus-specific primer serves to detect 285-bp gyrB gene fragments specific for this Vibrio by the PCR method without the necessity for DNA extraction or like operations from bacterial cells.

The invention discloses a Vibrio parahaemolyticus chromogenic medium and a rapid detection card for the same. The chromogenic medium contains peptone, yeast powder, sodium chloride, cane sugar, beta-glucoside, sodium thiosulfate and biological buffer; and the rapid detection card is a steady microorganism culture device comprising a base plate, a water-absorbing gel layer, a medium layer and a cover film, wherein the chromogenic medium is absorbed on the medium layer. In the Vibrio parahaemolyticus chromogenic medium, the beta-glucoside is used as the color development reagent, and the biological buffer is added, so that detection accuracy is improved greatly, qualitative and quantitative analysis can be carried out for the Vibrio parahaemolyticus chromogenic medium, and positive result color development is obvious and convenient to observe. The rapid detection card provided by the invention has the advantages of short detection cycle, simple and convenient operation, high sensitivity, low cost and the like, and is suitable for processing high-flux samples.

The invention discloses a vibrio parahaemolyticus constant-temperature detection primer set, detection kit and detection method. The primer kit comprises a detection primer set and an internal standard primer set. The detection primer set is designed according to the vibrio parahaemolyticus VPtlh gene, and the sequences are disclosed as SEQ ID NO.1-6. The internal standard primer set is designed according to the vibrio parahaemolyticus VPgrB gene, and the sequences are disclosed as SEQ ID NO.7-12. Besides the primer set, the Vibrio parahaemolyticus constant-temperature detection kit also comprises a DNA (deoxyribonucleic acid) polymerase, an LAMP (loop-mediated isothermal amplification) reaction / internal standard target piece, a positive control and a negative control. The detection primers, kit and detection method have the advantages of high speed, high efficiency, high specificity, high sensitivity and the like, is simple to operate and suitable for field detection, can effectively prevent false negative from generation, and is suitable for popularization and application.

The invention belongs to the technical field of microorganism, and in particular relates to high cohesion pediococcus pentosaceus screened from fermented bean products and use thereof in purifying of vibrio parahaemolyticus in water body. The pediococcus pentosaceus F28-8 is preserved in China General Microbiological Culture Collection Center in 2014 November 13, and the preservation number is CGMCC No.9956. The pediococcus pentosaceus has high cohesion activity, can be used for bacteria-reducing and purifying treatment of vibrio parahaemolyticus in water body to avoid use of a chemical antibacterial agent and antibiotics for water bacteria-reducing and purifying treatment, provides new means for breeding and biological control of vibrio parahaemolyticus in temporary rearing water, and is conducive to the prevention of the spread of aquatic animal disease and food borne diseases caused by the vibrio parahaemolyticus.

The invention discloses fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and a detection method, and belongs to the field of molecular detection. Five groups of the fluorescent quantitative PCR primers and the probes are provided and can be used for detecting salmonella, listeria monocytogenes, vibrio parahaemolyticus, shigella flexneri and vibrio cholerae non-O1 respectively, wherein except the primers and the probes for listeria monocytogenes genes and the primers and the probes for vibrio parahaemolyticus genes cannot be used simultaneously, the pathogenic bacteria which can be detected by the corresponding primers and probes can be detected simultaneously by combining any other two groups or more than two groups of the primers and probes. The invention also discloses multiple fluorescent quantitative PCR amplification systems which are constructed by using the primers and the probes, so the primers and the probes can detect whether samples to be detected contain the corresponding pathogenic bacteria or not quickly and accurately, are convenient to operate and high in specificity, can be made into kits and the like and are applicable to the detection of the pathogenic bacteria of the subsidiary agricultural products, and a false positive result is avoided.

The invention is suitable for the technical field of vibrio parahaemolyticus detection, and provides a primer and probe for rapidly detecting vibrio parahaemolyticus at room and isothermal temperature. A reagent and method which include the primer and probe and can rapidly detect the vibrio parahaemolyticus are also provided. Thus, rapid, real-time and specific detection can be performed on the vibrio parahaemolyticus under room and isothermal temperature conditions. Through the combined action of the specific primer, the specific fluorescent probe, four engineering enzymes and other chemicalcomponents, the rapid detection of nucleic acid targets can be realized in an instrument having fluorescence detection functions; closed tube detection can be guaranteed through strict experimental operation steps, so that aerosol pollution can be effectively prevented; and the detection method is suitable for the detection of various fluorescence detection equipment.

The invention discloses a primer, a probe, a kit and a method for detecting vibrio parahaemolyticus and integron in food. The sequence of the primer is: forward primer VPF: GCCACACTGGAACTGAGACA, and reverse primer VPR: GGAGTTAGCCGGTGCTTCTT; the sequence of the integron primer is: forward primer int1F: CATCGTCGTAGAGACGTCGG, and reverse primer Int1R: AGAACAAGCAGGCATCACGA. The primer, the probe and the other components in the kit provided by the invention are reasonable in coordination, convenient in use and quick and accurate in detection. The method provided by the invention has simple and quick operation and low cost. The detection result is accurate.

The invention relates to a vibrio parahaemolyticus detection primer set comprising the primers of: F3 primer: GACGTACCATGTACTAGATC; B3 primer: GCCATCACTAGCCATAGCG; FIP primer: CGATCGCCAGCATGCGCGGCATGTCTATTGGTGAGAGGTCTTG; and BIP primer: CATGATTTCAATGACGTCCCATTCTGAACCCAAAATCCGGGC. The invention also provides a method for detecting vibrio parahaemolyticus by using the primer set. The detection method provided by the invention is rapid and reliable, and is advantaged in high specificity and good repeatability. With the method, a highly effective means is provided for vibrio parahaemolyticus detections.

The invention discloses a salmonella source tracing typing method based on a gMLST (genome multilocus sequence typing) technology. The method comprises the steps as follows: (1) isolation and dentification of salmonella; (2) DNA extraction and content detection; (3) whole-genome sequencing and gMLST typing; (4) MLST typing; (5) drug resistance gene analysis and virulence gene analysis; and (6) cladogram analysis. The method establishes a salmonella gMLST technology for important food-borne pathogens such as salmonella, staphylococcus aureus or vibrio parahaemolyticus to be applied to epidemiological source tracing, so that the method is promoted to source tracing of food-borne pathogens.

The invention relates to a multiplex amplification internal standard PCR (polymerase chain reaction) kit capable of simultaneously detecting Vibrio parahaemolyticus, Escherichia coli O157:H7, Salmonella and Shigella. The kit comprises a PCR reaction premix solution and a reference substance. The detection method comprises the following steps: acquiring a sample, carrying out amplification culture, extracting DNA (deoxyribonucleic acid), preparing a PCR reaction tube, putting the PCR reaction tube on a PCR instrument, carrying out PCR amplification, and carrying out detection result judgment on the PCR amplification product. The kit can simultaneously and quickly detect the four bacteria by one reaction, and can avoid the misjudgment caused by the false negative result due to the inhibiting factor for the DNA polymerase in the sample treatment process. Compared with the existing detection methods, the method provided by the invention is convenient to use, has the advantages of high reliability, short detection period, high sensitivity, high specificity, low cost and simple operation steps, is suitable for high-flux operation and standard operation, and is beneficial to enhancing the food safety detection level and preventing and controlling the foodborne diseases.

The invention relates to the field of biomedicines and in particular relates to a recombinant polypeptide, a construction method and application thereof. More specifically, the invention provides a recombinant OmpK multi-epitope polypeptide and encoded nucleotide, carriers, cells and vaccines thereof, and application of the recombinant OmpK multi-epitope polypeptide to products of preventing vibrio infections. An experiment proves that the recombinant OmpK multi-epitope polypeptide or derivatives and vaccines thereof have the characteristics of safety and high efficiency and have very high immunogenicity on vibrio parahaemolyticus; animals immunized by the multi-epitope polypeptide contain a lot of specific antibodies and the effective protection rate on the immunized animals reach 90 percent or more; the recombinant OmpK multi-epitope polypeptide has the effect of improving the resistance capability of the animals immunized by the multi-epitope polypeptide on the vibrio parahaemolyticus; the recombinant OmpK multi-epitope polypeptide has a good immune protection effect and has great significance in the aspect of preventing and controlling infectious diseases of aquatic animals.

The present invention is a preparation method of Vibrio parahaemolyticus toxoid vaccine, which is characterized in that: first amplifying the target gene tdh; then cloning the target gene fragment tdh into the vector pET-28 to construct the expression vector pET-28-TDH, The pET-28-TDH plasmid was transferred into the expression strain BL21; after culturing and induced expression, the cloned expression product was obtained; the cloned expression product was detected by dot blot reaction, and the Vibrio parahaemolyticus toxoid was obtained; the Vibrio parahaemolyticus toxoid was mixed with An equal volume of complete Freund's adjuvant was mixed evenly to obtain the Vibrio parahaemolyticus toxoid vaccine. The vibrio parahaemolyticus toxoid vaccine prepared by the method of the invention can be used as an immune drug for marine fishes attacked by the vibrio parahaemolyticus, and the immune protection rate can reach about 50%.

The invention provides vibrio parahaemolyticus bacteriophage lyase PCNP-lys, and the amino acid sequence of the PCNP-lys is shown in SEQ ID NO:1. The invention further provides an antibacterial agentwhich comprises main active components of the vibrio parahaemolyticus bacteriophage lyase PCNP-lys, a carrier with a PCNP-lys expression element, an expression cassette with the PCNP-lys expression element or at least one of host cells with the PCNP-lys expression element. The invention further provides a preparation method of the vibrio parahaemolyticus bacteriophage lyase PCNP-lys. The vibrio parahaemolyticus bacteriophage lyase PCNP-lys provided by the invention is capable of splitting multiple pathogenic vibrios, and makes a basis for substitution therapies of drug-resistant vibrio parahemolyticus.

The invention discloses Bacillus amyloliquefaciens SCAU-070 and application thereof. The Bacillus amyloliquefaciens SCAU-070 is obtained by separating and screening, the strain is deposited in the Guangdong Microbial Culture Collection Center on July 1, 2020, and the collection number is GDMCC No: 61074. The strain can significantly promote the growth of aquatic animals, inhibit the growth of aquatic animal pathogenic bacteria such as streptococcus agalactiae, streptococcus iniae, micrococcus luteus and vibrio parahaemolyticus in aquatic animal breeding water environment, improve the antioxidant ability of aquatic animal tissues, and regulate the content of cytokines in aquatic animal tissues; and therefore, the strain is of great significance in reducing the use of antibiotics and prohibited drugs, and has good application prospects and market value in the preparation of aquatic animal feed additives, microecological preparations for regulating the aquatic animal breeding water environment and medicines for improving the body immunity of aquatic animals.

The invention provides a seafood product detection kit and a preparation method thereof, and belongs to the field of microbiological detection. The seafood product detection kit comprises anti-vibrioparahaemolyticus immunomagnetic beads and CdSe / ZnS-carboxylated polystyrene immunofluorescent microspheres. The magnetic beads provided by the invention are relatively high in surface carboxyl modification amount, the coupling rate of antibodies can be increased, and the capture rate of vibrio parahaemolyticus can be increased. According to the preparation method of the CdSe / ZnS-carboxylated polystyrene immunofluorescent microspheres, the cross-linking polymerization of the fluorescent microspheres is reduced, the dispersity is improved, the coupling rate of an antibody is improved, and the fluorescence intensity value is increased. The seafood product detection kit provided by the invention is used for detecting the vibrio parahaemolyticus and has relatively high sensitivity, accuracy andreliability.

The invention discloses a novel specific molecular target for vibrio parahaemolyticus and a rapid detection method thereof. The method provided by the invention provides 20 novel specific molecular detection targets for identifying the vibrio parahaemolyticus; a corresponding primer group can be designed according to target molecules; and whether the vibrio parahaemolyticus exists or not can be obtained by carrying out PCR on a to-be-detected object and analyzing an electrophoresis result of a PCR product. Compared with the prior art, the rapid detection method provided by the invention can beused for detecting certain strains insensitive to biochemical reaction and making up the defect of biochemical identification; meanwhile, more specific molecular targets of the vibrio parahaemolyticus are provided; the defect of insufficient detection discrimination of common virulence gene targets is made up; and the method is more practical. The rapid detection method provided by the inventionalso has the advantages of simple operation, good detection result specificity and simple result determination, and is of great significance to the identification of vibrio parahaemolyticus in food.

The invention provides an application of antibacterial peptide Cm-CATH2 in the inhibition of vibrio parahaemolyticus in marine products. The antibacterial peptide Cm-CATH2 is applied to bacteriostasisof vibrio parahaemolyticus. The invention relates to a use of the antibacterial peptide Cm-CATH2 in the inhibition of vibrio parahaemolyticus in the marine products. The antibacterial peptide Cm-CATH2 is used in a vibrio parahaemolyticus bacteriostatic process. The bacteriostatic property of the antibacterial peptide Cm-CATH2 on vibrio parahaemolyticus makes the bacteriostatic effect reach up to85%, the test repeatability is good, the specificity is high, the operation is simple, the stability and safety are relatively high, the safety of marine product raw materials can be effectively ensured and the pollution by vibrio parahaemolyticus is avoided, the food poisoning event caused by vibrio parahaemolyticus is avoided, the problem of drug resistance of vibrio parahaemolyticus is solved,the eating safety of the marine products is ensured, and therefore the theoretical basis and technical guidance are provided for researching and developing a novel bacteriostatic packaging material ora sterilizing agent to ensure the eating safety of the marine products.

The invention discloses a multiplex PCR primer set and detecting method and kit for simultaneous detection of four pathogenic Vibrio. A detection primer set comprises primer pairs for detecting Vibrioparahaemolyticus, Vibrio vulnificus, Vibrio harveyi and Vibrio mimicus. The invention further provides a multiplex PCR detecting method and kit for the simultaneous detection of the four pathogenic Vibrio, by means of the primer set obtained by designing, multiplex PCR reaction is conducted on genome DNA of bacteria extracted from to-be-detected samples in the same reaction system, and whether ornot the pathogenic Vibrio is contained in the samples is determined according to the electrophoretic analysis on reaction products. The multiplex PCR primer set and detecting method and kit have theadvantages of being rapid and accurate, low in cost and high in specificity and sensitivity.

The invention discloses a specific primer combination, a kit and a method for simultaneously detecting vibrio parahaemolyticus and vibrio cholerae on the basis of a dual RAA-LFD technology, and belongs to the field of rapid detection of food-borne pathogenic bacteria. The primer is high in specificity, the vibrio parahaemolyticus and the vibrio cholerae can be accurately detected from other vibrios and other pathogenic bacteria, sensitivity is high, genome sensitivity reaches 1fg, and the sensitivity of pure bacterial liquid is 10<4> CFU / mL and 10<3> CFU / mL respectively, and the influence of dimer is reduced. Detection can be completed by reacting for 15 minutes at a relatively low reaction temperature (37 DEG C) and detecting for 5 minutes through a test strip, so that the problems that the detection period of the vibrio parahaemolyticus and the vibrio cholerae is long, dependence on instruments and equipment is high, difficulty for simultaneously detecting the vibrio parahaemolyticus and the vibrio cholerae is high and the like are solved. The invention has low requirements on equipment, and has good application prospects in field detection, aquaculture point detection and other on-site detection.

The invention provides a carrier for separating bacteriophage. The carrier for separating the bacteriophage comprises a ceramic carrier body, and vibrio parahaemolyticus which is loaded on the ceramic carrier body. With the adoption of the carrier, bacteriophage of vibrio parahaemolyticus in seawater, fresh water and wastewater can be quickly separated, and the separating efficiency reaches 80%; the identifying result shows that the separated bacteriophage is vibrio parahaemolyticus bacteriophage.

The invention provides a nano antibody for specifically recognizing vibrio parahaemolyticus, which comprises a coding gene of the nano antibody, and also provides a vector and a host cell containing a nucleotide sequence for coding the nano antibody. The amino acid sequence of the nano antibody is shown as SEQ ID NO: 1, and the nano antibody has good specificity and binding capacity to vibrio parahaemolyticus. The nano antibody for specifically recognizing the vibrio parahaemolyticus, provided by the invention, is good in specificity, strong in stability and high in expression yield, is not combined with other non-vibrio parahaemolyticus, and can specifically recognize the vibrio parahaemolyticus.

The invention relates to an N-acetylglucosamine compound, and a preparation method and application thereof, and belongs to the technical field of bacteriostatic agents and microbial medicines. The preparation method comprises the following steps of: fermenting and culturing marine fungus Aspergillus versicolor M-7-SW9 in a PDB fungus culture medium to obtain a fermentation product; and extracting and separating the fermentation product to obtain a new N-acetylglucosamine compound. According to the N-acetylglucosamine compound, and the preparation method and the application thereof disclosed by the invention, a bacteriostatic activity experiment shows that the minimum inhibitory concentration of the compound for aquatic disease bacteria, namely edwardsiella tarda and vibrio harveyi is 1.0 microgram / milliliter; and meanwhile, the compound also has bacteriostatic activity for the aquatic disease bacteria, namely, micrococcus luteus and vibrio parahaemolyticus, and can be used for preparing drugs for resisting the aquatic disease bacteria.

The invention provides a kit for rapidly detecting vibrio parahaemolyticus TDH toxin in food and application thereof. The kit comprises an elisa plate of a captured antibody, TDH standard diluent, rabbit anti-vibrio parahaemolyticus negative serum, rabbit anti-vibrio parahaemolyticus polyclone antibody serum, a phosphate buffer solution of goat rabbit anti IgG-HRP, a phosphate buffer solution containing tween-20, a substrate solution and a 2 mol / L stop solution of H2SO4. According to the kit for rapidly detecting the vibrio parahaemolyticus TDH toxin in the food and the application thereof, the kit for detecting the vibrio parahaemolyticus TDH toxin in the food serves as a study object, an anti-TDH polyclone antibody is prepared through the prepared TDH toxin protein immune BALB / C mice, meanwhile, a thalli of pathogenic vibrio parahaemolyticus serves as an immunogen to immune New Zealand white rabbits to prepare the rabbit anti-vibrio parahaemolyticus polyclone antibody, the anti-TDH polyclone antibody serves as a capture antibody, an antibiotic body polyclone antibody serves as a detection antibody, the double-antibody sandwich ELISA detection method is built, the detection method is used for detecting the vibrio parahaemolyticus TDH toxin in the food, and the kit for rapidly detecting the vibrio parahaemolyticus TDH toxin ELISA in the food is developed.

The invention provides a PMA-qPCR (Polymethyl Acrylate-Quantitative Polymerase Chain Reaction) detection method of vibrio parahaemolyticus. According to the detection method, PMA is adopted to pretreat bacterial liquid, so that PMA is crosslinked with thallus DNA; then thallus DNA is extracted to serve as a template for qPCR amplification; and whether a sample contains vibrio parahaemolyticus or not is judged according to a collected fluorescence signal Ct value. The method is high in detection sensitivity, high in specificity and short in consumed time, interference of dead bacterium DNA canbe effectively eliminated, and the effect of specific detection of living bacteria is achieved; and the method can be used for rapid detection of vibrio parahaemolyticus in food.

The invention provides a specific target for detecting vibrio parahaemolyticus, a primer pair, a detection method and application. According to the method, specific gene sequences capable of being used for detection in vibrio parahaemolyticus are mined according to a primary screening result of a local database and a secondary screening result of online comparison, the mined specific target gene is combined with a traditional target gene to construct a dual real-time fluorescence PCR method, and PCR primer pairs are designed according to a self-screening target gene VPA1585 and a traditional target gene tlh. In order to ensure high specificity and sensitivity of the detection method, a dual real-time fluorescent PCR method is adopted, a PCR reaction system is reasonably optimized, and a third-generation saturated fluorescent dye SYTO Green 9 is innovatively used for replacing an unsaturated fluorescent dye SYBR Green in a traditional real-time fluorescent PCR system, so the vibrio parahaemolyticus can be rapidly and accurately identified.