97 results about "Parahaemolyticus vibrio" patented technology

The invention relates to the technical field of microbes, and provides a novel vibrio parahaemolyticus phage as well as a composition, a preparation method and application thereof. The novel vibrio parahaemolyticus phage specifically refers to a vibrio parahaemolyticus phage VP46 of which the collection number is CCTCC NO:M2016290, a vibrio parahaemolyticus phage VP48 of which the collection number is CCTCC NO:M2016291 or a vibrio parahaemolyticus phage VP7 of which the collection number is CCTCC NO:M2016289. The phage is a strictly virulent phage, is highly toxic to host bacteria, has a widerhost range, and is highly toxic to the host bacteria at a low concentration; DNA (Deoxyribonucleic Acid) of the phage cannot encode proteins which may cause a potential health risk; the phage survives stably in a culture solution at room temperature, and survives for more than 12 months at a temperature of below 4 DEG C; the phage can be well proliferated on a non-pathogenic bacterial host; and large-scale industrial production can be realized.

The invention belongs to the technical field of microorganism, and in particular relates to high cohesion pediococcus pentosaceus screened from fermented bean products and use thereof in purifying of vibrio parahaemolyticus in water body. The pediococcus pentosaceus F28-8 is preserved in China General Microbiological Culture Collection Center in 2014 November 13, and the preservation number is CGMCC No.9956. The pediococcus pentosaceus has high cohesion activity, can be used for bacteria-reducing and purifying treatment of vibrio parahaemolyticus in water body to avoid use of a chemical antibacterial agent and antibiotics for water bacteria-reducing and purifying treatment, provides new means for breeding and biological control of vibrio parahaemolyticus in temporary rearing water, and is conducive to the prevention of the spread of aquatic animal disease and food borne diseases caused by the vibrio parahaemolyticus.

The invention discloses fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and a detection method, and belongs to the field of molecular detection. Five groups of the fluorescent quantitative PCR primers and the probes are provided and can be used for detecting salmonella, listeria monocytogenes, vibrio parahaemolyticus, shigella flexneri and vibrio cholerae non-O1 respectively, wherein except the primers and the probes for listeria monocytogenes genes and the primers and the probes for vibrio parahaemolyticus genes cannot be used simultaneously, the pathogenic bacteria which can be detected by the corresponding primers and probes can be detected simultaneously by combining any other two groups or more than two groups of the primers and probes. The invention also discloses multiple fluorescent quantitative PCR amplification systems which are constructed by using the primers and the probes, so the primers and the probes can detect whether samples to be detected contain the corresponding pathogenic bacteria or not quickly and accurately, are convenient to operate and high in specificity, can be made into kits and the like and are applicable to the detection of the pathogenic bacteria of the subsidiary agricultural products, and a false positive result is avoided.

The invention discloses a primer, a probe, a kit and a method for detecting vibrio parahaemolyticus and integron in food. The sequence of the primer is: forward primer VPF: GCCACACTGGAACTGAGACA, and reverse primer VPR: GGAGTTAGCCGGTGCTTCTT; the sequence of the integron primer is: forward primer int1F: CATCGTCGTAGAGACGTCGG, and reverse primer Int1R: AGAACAAGCAGGCATCACGA. The primer, the probe and the other components in the kit provided by the invention are reasonable in coordination, convenient in use and quick and accurate in detection. The method provided by the invention has simple and quick operation and low cost. The detection result is accurate.

The invention discloses a salmonella source tracing typing method based on a gMLST (genome multilocus sequence typing) technology. The method comprises the steps as follows: (1) isolation and dentification of salmonella; (2) DNA extraction and content detection; (3) whole-genome sequencing and gMLST typing; (4) MLST typing; (5) drug resistance gene analysis and virulence gene analysis; and (6) cladogram analysis. The method establishes a salmonella gMLST technology for important food-borne pathogens such as salmonella, staphylococcus aureus or vibrio parahaemolyticus to be applied to epidemiological source tracing, so that the method is promoted to source tracing of food-borne pathogens.

The invention relates to a multiplex amplification internal standard PCR (polymerase chain reaction) kit capable of simultaneously detecting Vibrio parahaemolyticus, Escherichia coli O157:H7, Salmonella and Shigella. The kit comprises a PCR reaction premix solution and a reference substance. The detection method comprises the following steps: acquiring a sample, carrying out amplification culture, extracting DNA (deoxyribonucleic acid), preparing a PCR reaction tube, putting the PCR reaction tube on a PCR instrument, carrying out PCR amplification, and carrying out detection result judgment on the PCR amplification product. The kit can simultaneously and quickly detect the four bacteria by one reaction, and can avoid the misjudgment caused by the false negative result due to the inhibiting factor for the DNA polymerase in the sample treatment process. Compared with the existing detection methods, the method provided by the invention is convenient to use, has the advantages of high reliability, short detection period, high sensitivity, high specificity, low cost and simple operation steps, is suitable for high-flux operation and standard operation, and is beneficial to enhancing the food safety detection level and preventing and controlling the foodborne diseases.

The invention provides vibrio parahaemolyticus bacteriophage lyase PCNP-lys, and the amino acid sequence of the PCNP-lys is shown in SEQ ID NO:1. The invention further provides an antibacterial agentwhich comprises main active components of the vibrio parahaemolyticus bacteriophage lyase PCNP-lys, a carrier with a PCNP-lys expression element, an expression cassette with the PCNP-lys expression element or at least one of host cells with the PCNP-lys expression element. The invention further provides a preparation method of the vibrio parahaemolyticus bacteriophage lyase PCNP-lys. The vibrio parahaemolyticus bacteriophage lyase PCNP-lys provided by the invention is capable of splitting multiple pathogenic vibrios, and makes a basis for substitution therapies of drug-resistant vibrio parahemolyticus.

The invention provides a seafood product detection kit and a preparation method thereof, and belongs to the field of microbiological detection. The seafood product detection kit comprises anti-vibrioparahaemolyticus immunomagnetic beads and CdSe/ZnS-carboxylated polystyrene immunofluorescent microspheres. The magnetic beads provided by the invention are relatively high in surface carboxyl modification amount, the coupling rate of antibodies can be increased, and the capture rate of vibrio parahaemolyticus can be increased. According to the preparation method of the CdSe/ZnS-carboxylated polystyrene immunofluorescent microspheres, the cross-linking polymerization of the fluorescent microspheres is reduced, the dispersity is improved, the coupling rate of an antibody is improved, and the fluorescence intensity value is increased. The seafood product detection kit provided by the invention is used for detecting the vibrio parahaemolyticus and has relatively high sensitivity, accuracy andreliability.

The invention discloses a novel specific molecular target for vibrio parahaemolyticus and a rapid detection method thereof. The method provided by the invention provides 20 novel specific molecular detection targets for identifying the vibrio parahaemolyticus; a corresponding primer group can be designed according to target molecules; and whether the vibrio parahaemolyticus exists or not can be obtained by carrying out PCR on a to-be-detected object and analyzing an electrophoresis result of a PCR product. Compared with the prior art, the rapid detection method provided by the invention can beused for detecting certain strains insensitive to biochemical reaction and making up the defect of biochemical identification; meanwhile, more specific molecular targets of the vibrio parahaemolyticus are provided; the defect of insufficient detection discrimination of common virulence gene targets is made up; and the method is more practical. The rapid detection method provided by the inventionalso has the advantages of simple operation, good detection result specificity and simple result determination, and is of great significance to the identification of vibrio parahaemolyticus in food.

The invention provides an application of antibacterial peptide Cm-CATH2 in the inhibition of vibrio parahaemolyticus in marine products. The antibacterial peptide Cm-CATH2 is applied to bacteriostasisof vibrio parahaemolyticus. The invention relates to a use of the antibacterial peptide Cm-CATH2 in the inhibition of vibrio parahaemolyticus in the marine products. The antibacterial peptide Cm-CATH2 is used in a vibrio parahaemolyticus bacteriostatic process. The bacteriostatic property of the antibacterial peptide Cm-CATH2 on vibrio parahaemolyticus makes the bacteriostatic effect reach up to85%, the test repeatability is good, the specificity is high, the operation is simple, the stability and safety are relatively high, the safety of marine product raw materials can be effectively ensured and the pollution by vibrio parahaemolyticus is avoided, the food poisoning event caused by vibrio parahaemolyticus is avoided, the problem of drug resistance of vibrio parahaemolyticus is solved,the eating safety of the marine products is ensured, and therefore the theoretical basis and technical guidance are provided for researching and developing a novel bacteriostatic packaging material ora sterilizing agent to ensure the eating safety of the marine products.

The invention discloses a specific primer combination, a kit and a method for simultaneously detecting vibrio parahaemolyticus and vibrio cholerae on the basis of a dual RAA-LFD technology, and belongs to the field of rapid detection of food-borne pathogenic bacteria. The primer is high in specificity, the vibrio parahaemolyticus and the vibrio cholerae can be accurately detected from other vibrios and other pathogenic bacteria, sensitivity is high, genome sensitivity reaches 1fg, and the sensitivity of pure bacterial liquid is 10<4> CFU/mL and 10<3> CFU/mL respectively, and the influence of dimer is reduced. Detection can be completed by reacting for 15 minutes at a relatively low reaction temperature (37 DEG C) and detecting for 5 minutes through a test strip, so that the problems that the detection period of the vibrio parahaemolyticus and the vibrio cholerae is long, dependence on instruments and equipment is high, difficulty for simultaneously detecting the vibrio parahaemolyticus and the vibrio cholerae is high and the like are solved. The invention has low requirements on equipment, and has good application prospects in field detection, aquaculture point detection and other on-site detection.

The invention provides a carrier for separating bacteriophage. The carrier for separating the bacteriophage comprises a ceramic carrier body, and vibrio parahaemolyticus which is loaded on the ceramic carrier body. With the adoption of the carrier, bacteriophage of vibrio parahaemolyticus in seawater, fresh water and wastewater can be quickly separated, and the separating efficiency reaches 80%; the identifying result shows that the separated bacteriophage is vibrio parahaemolyticus bacteriophage.

The invention relates to an N-acetylglucosamine compound, and a preparation method and application thereof, and belongs to the technical field of bacteriostatic agents and microbial medicines. The preparation method comprises the following steps of: fermenting and culturing marine fungus Aspergillus versicolor M-7-SW9 in a PDB fungus culture medium to obtain a fermentation product; and extracting and separating the fermentation product to obtain a new N-acetylglucosamine compound. According to the N-acetylglucosamine compound, and the preparation method and the application thereof disclosed by the invention, a bacteriostatic activity experiment shows that the minimum inhibitory concentration of the compound for aquatic disease bacteria, namely edwardsiella tarda and vibrio harveyi is 1.0 microgram/milliliter; and meanwhile, the compound also has bacteriostatic activity for the aquatic disease bacteria, namely, micrococcus luteus and vibrio parahaemolyticus, and can be used for preparing drugs for resisting the aquatic disease bacteria.

The invention provides a kit for rapidly detecting vibrio parahaemolyticus TDH toxin in food and application thereof. The kit comprises an elisa plate of a captured antibody, TDH standard diluent, rabbit anti-vibrio parahaemolyticus negative serum, rabbit anti-vibrio parahaemolyticus polyclone antibody serum, a phosphate buffer solution of goat rabbit anti IgG-HRP, a phosphate buffer solution containing tween-20, a substrate solution and a 2 mol/L stop solution of H2SO4. According to the kit for rapidly detecting the vibrio parahaemolyticus TDH toxin in the food and the application thereof, the kit for detecting the vibrio parahaemolyticus TDH toxin in the food serves as a study object, an anti-TDH polyclone antibody is prepared through the prepared TDH toxin protein immune BALB/C mice, meanwhile, a thalli of pathogenic vibrio parahaemolyticus serves as an immunogen to immune New Zealand white rabbits to prepare the rabbit anti-vibrio parahaemolyticus polyclone antibody, the anti-TDH polyclone antibody serves as a capture antibody, an antibiotic body polyclone antibody serves as a detection antibody, the double-antibody sandwich ELISA detection method is built, the detection method is used for detecting the vibrio parahaemolyticus TDH toxin in the food, and the kit for rapidly detecting the vibrio parahaemolyticus TDH toxin ELISA in the food is developed.