Vibrio harveyi secretory type vaccine and structure and application thereof
A technology of Vibrio harveta and secretory type, which is applied in the fields of molecular biology and immunology, can solve the problems of limited use, the application of secretory vaccines has not been reported yet, and the harm of antibiotics, etc., and achieves high protection rate, low cost, and immune effect. strong effect
Examples
Embodiment 1
[0024] The vibrio harveyi secreted vaccine is shown in the base sequence of SEQ ID No.1 in the sequence table. Sequence listing SEQ ID No1
[0025] ATGTTAAAAGAAACTACTAAGTTGTTGTATCACCTCGGCACTCTGTTTCCATTCTTCTCTCGCTTTTTCGCAATCGACAGA
[0026] ACTCCCAAATGATGCGGATTTAGCGCAGACACCTGCGTCACTGATGCTTGCGCCTGAAGACGTCGCCATCGCTGATCGTT
[0027] ATATCGTTGTATTTCATCAACTCAAATGATGATGAATAATTCACTTGAATTACAGCAGTTCACACAACAATCTGTGGAC
[0028] CGAATGTCTGGTTTGTACTCAATAGAAGTGGAATCAGTATTCGACAATTCGATCAGCGGTTTCGTTGCGACGTTAGCTCC
[0029] TGAACAGCTGAAAGCGTTACGTGCTGATCCACGTGTTGAATACATCGAGCAAGACAGAATTCTTACACTAGACCCAATAG
[0030] TCTCGGCAGAAGTAAACCAAAGTAATGCAATTTGGGGGCTAGACCGAATTGATCAACGTAGTCTGCCTCTCAATAACAAT
[0031] TACAGCGCCAACTTTGATGGAACGGGCGTCACGGCTTACGTTATCGATACGGGTGTGAACAACTCGCACGTTGAATTTGC
[0032] CGGACGCTCCATTTCGGGATATGACTTTGTCGACAATGATGCGGATGCCAGTGACTGTAATGGACACGGCACACACGTAG
[0033] CGGGCACGATCGGCGGATCTTTGTATGGCGTGGCAAAGAACGTGAGCATTGTTGGTGTCAGAGTGCTTAGCTGTTCTGGC
[0034] TCAGGTTCAACGTCCGGCGTTATTGC...
Embodiment 2
[0061] Vaccine bacterial suspension: culture the Vibrio harveyi secretory vaccine strain DH5α / pTVP1M containing the nucleotide sequence in the sequence table SEQ ID No.1 obtained above in LB liquid medium containing 50ug / ml Ap overnight; Add 0.1ml of the overnight culture solution into 10ml of fresh LB liquid medium containing Ap (50ug / ml), and culture at 28°C with shaking at 160rpm until OD 600 0.8-1, then the bacterial culture solution was centrifuged (5000g, 4°C, 10min), and the bacterial cells were collected and suspended in PBS to a final concentration of 4×10 8 cfu / ml is the vaccine preparation solution.
[0062] Vaccine control solution: The plasmid pBT3 was transformed into DH5α by the Hanahan method to obtain the transformant DH5α / pBT3. Cultivate DH5α / pBT3 overnight in LB liquid medium containing 50ug / ml Ap; take 0.1ml of overnight culture solution, add it to 10ml of fresh LB liquid medium containing Ap (50ug / ml), at 28 Shake culture at 160rpm at ℃ to OD 600 0.8-1,...
Embodiment 3
[0065] Immunization injection of the above-mentioned vaccine bacteria suspension: 80 flounder (each weighing about 10 g) were randomly divided into 2 groups, 40 in each group. These two groups are named A and B respectively. Each fish in Group A was injected intraperitoneally with 100ul of the vaccine bacteria suspension, and each fish in Group B was injected intraperitoneally with 100ul vaccine control solution. After 20 days, each fish in group A was injected intraperitoneally with 100ul of the vaccine bacteria suspension again, and each fish in group B was injected with 100ul vaccine control solution intraperitoneally.
[0066] Preparation of Vibrio harveyi suspension: culture Vibrio harveyi from T4 to OD in LB medium 600 0.6, and then centrifuged (5000g, 4°C, 10min). Collect the cells and suspend them in PBS to a final concentration of 8×10 7 cfu / ml is Vibrio harveyi suspension.
PUM
Login to View More Abstract
Description
Claims
Application Information
- IPC
- A61K39/108; A61P31/04; C12N15/31; C12N1/21
- Inventors
- 孙黎; 程爽