Kit and detection method for detecting vibrio harveyi
A technology of Vibrio harveyi and a kit, which is applied in the field of bioengineering, can solve the problems of high quality requirements for operators, cumbersome steps, and complicated procedures, and achieve the effects of low cost, high sensitivity, and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0044] The present invention will be further described below by combining the sequence listing and the examples.
[0045] The reagents of the kit in this embodiment include the following three groups of reagents:
[0046] The first group of reagents is the reagents used to prepare the isothermal amplification reaction solution, which includes Themopol reaction buffer, dNTP solution, MgSO 4 Solution, upstream internal primer (Vh-FIP), downstream internal primer (Vh-BIP), upstream external primer (Vh-F3), downstream external primer (Vh-B3), betaine solution and sterile double distilled water;
[0047] The composition of described Themopol reaction buffer is the Tris-HCl solution of pH8.8, (NH 4 ) 2 SO 4 , KCl, MgSO 4 and Triton X-100;
[0048] The upstream internal primer (Vh-FIP) is TTCGCTTTCGCGAGCCATCTGGTTACCAATTGATCGCCCG, as shown in the sequence 3;
[0049] The downstream inner primer (Vh-BIP) is ACGCAGAATCAAGCAGTGTGCTCCGATTTATTCGCCACGACA, as shown in the sequence 4; ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 