Kit and detection method for detecting vibrio harveyi
A technology of Vibrio harveyi and a kit, which is applied in the field of bioengineering, can solve the problems of high quality requirements for operators, cumbersome steps, and complicated procedures, and achieve the effects of low cost, high sensitivity, and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0044] The present invention will be further described below by combining the sequence listing and the examples.
[0045] The reagents of the kit in this embodiment include the following three groups of reagents:
[0046] The first group of reagents is the reagents used to prepare the isothermal amplification reaction solution, which includes Themopol reaction buffer, dNTP solution, MgSO 4 Solution, upstream internal primer (Vh-FIP), downstream internal primer (Vh-BIP), upstream external primer (Vh-F3), downstream external primer (Vh-B3), betaine solution and sterile double distilled water;
[0047] The composition of described Themopol reaction buffer is the Tris-HCl solution of pH8.8, (NH 4 ) 2 SO 4 , KCl, MgSO 4 and Triton X-100;
[0048] The upstream internal primer (Vh-FIP) is TTCGCTTTCGCGAGCCATCTGGTTACCAATTGATCGCCCG, as shown in the sequence 3;
[0049] The downstream inner primer (Vh-BIP) is ACGCAGAATCAAGCAGTGTGCTCCGATTTATTCGCCACGACA, as shown in the sequence 4; ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com