Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit and detection method for detecting vibrio harveyi

A technology of Vibrio harveyi and a kit, which is applied in the field of bioengineering, can solve the problems of high quality requirements for operators, cumbersome steps, and complicated procedures, and achieve the effects of low cost, high sensitivity, and easy operation

Inactive Publication Date: 2011-06-29
陈吉刚
View PDF8 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the most probable number method (Most probable number, MPN) based on bacterial isolation and culture is widely used, this method is time-consuming (4-6 days); although the nucleic acid probe hybridization technology is specific and sensitive, the steps are cumbersome; Although polymerase chain reaction (PCR) and real-time fluorescent quantitative PCR (real-time PCR) technologies are sensitive and fast, the two methods require laboratories to have PCR instruments or fluorescent quantitative PCR equipment, and require high quality operators, and It is also a complicated problem to obtain the results through the electrophoresis step after PCR amplification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and detection method for detecting vibrio harveyi
  • Kit and detection method for detecting vibrio harveyi
  • Kit and detection method for detecting vibrio harveyi

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0044] The present invention will be further described below by combining the sequence listing and the examples.

[0045] The reagents of the kit in this embodiment include the following three groups of reagents:

[0046] The first group of reagents is the reagents used to prepare the isothermal amplification reaction solution, which includes Themopol reaction buffer, dNTP solution, MgSO 4 Solution, upstream internal primer (Vh-FIP), downstream internal primer (Vh-BIP), upstream external primer (Vh-F3), downstream external primer (Vh-B3), betaine solution and sterile double distilled water;

[0047] The composition of described Themopol reaction buffer is the Tris-HCl solution of pH8.8, (NH 4 ) 2 SO 4 , KCl, MgSO 4 and Triton X-100;

[0048] The upstream internal primer (Vh-FIP) is TTCGCTTTCGCGAGCCATCTGGTTACCAATTGATCGCCCG, as shown in the sequence 3;

[0049] The downstream inner primer (Vh-BIP) is ACGCAGAATCAAGCAGTGTGCTCCGATTTATTCGCCACGACA, as shown in the sequence 4; ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a kit and detection method for detecting vibrio harveyi by using the loop-mediated isothermal amplification technique. The kit comprises a loop-mediated isothermal amplification reaction solution, a Bst DNA (deoxyribonucleic acid) polymerase and a color-developing agent, wherein the reaction solution contains a reaction buffering solution Thernopol, dNTP (deoxyribonucleotide triphosphate), MgSO4, a forward inter primer (Vh-FIP) TTCGCTTTCGCGAGCCATCTGGTTACCAATTGATCGCCCG, a reverse inter primer (Vh-BIP) ACGCAGAATCAAGCAGTGTGCCGATTTATTCGCCACGACA, a forward outer primer (Vh-F3) CAAAACGGTTCCGAAACGC, a reverse outer primer (Vh-B3) TCGATTCCCCAAGTTTGGAG, a betaine, and sterile distilled water. The detection method comprises the following steps: extracting bacterium DNAs, carrying out loop-mediated isothermal amplification, carrying out color-developing detection and the like. By designing the primers according to the vibrio harveyi toxR gene conservation area and detecting by using the LAMP (loop-mediated isothermal amplification) technique, the invention achieves high specificity and high sensitivity; the kit has the advantages of high detection speed, high accuracy, excellent sensitivity, convenient on-site application and the like; and the defects of long cycle, low sensitivity, high cost, difficult on-site application and the like in the prior art are solved.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a kit for rapidly detecting Vibrio harveyi in aquatic animals by adopting a loop-mediated isothermal amplification technology, and a method for detecting Vibrio harveyi using the kit. Background technique [0002] Vibrio harveyi is a Gram-negative halophilic bacterium widely distributed in the marine environment. Vibrio harveyi is an important pathogenic bacterium of aquaculture animals that has only been recognized in the last ten years. It is not only an important pathogenic bacteria of shrimp and shellfish cultured in countries and regions such as Indonesia, Thailand, India, Australia, Ecuador and China (including Taiwan), but also a pathogen of many cultured fish, which has caused huge economic losses to the mariculture industry. loss. [0003] Sensitive, rapid and specific pathogen detection technology is of great significance to the prevention and contr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 陈吉刚毛芝娟杨季芳
Owner 陈吉刚
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More