Stichopus japonicas BPI gene, encoded protein, cloning method of stichopus japonicas BPI gene, and method for constructing recombinant stichopus japonicas BPI genetically engineered bacterium

A technology of genetic engineering bacteria and cloning method, which is applied in the field of coding protein and its cloning, sea cucumber BPI gene, and construction of recombinant sea cucumber BPI genetic engineering bacteria, and can solve problems such as antibiotic failure, sea cucumber stimulation, and bacterial resistance.

Active Publication Date: 2015-07-01
NINGBO UNIV
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, antibiotics and water disinfectants are mostly used for prevention and control in production, but the extensive use of antibiotics induces drug resistance of bacteria, leading to antibiotic failure, and water disinfectants often have a greater stimulating effect on sea cucumbers

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Stichopus japonicas BPI gene, encoded protein, cloning method of stichopus japonicas BPI gene, and method for constructing recombinant stichopus japonicas BPI genetically engineered bacterium
  • Stichopus japonicas BPI gene, encoded protein, cloning method of stichopus japonicas BPI gene, and method for constructing recombinant stichopus japonicas BPI genetically engineered bacterium
  • Stichopus japonicas BPI gene, encoded protein, cloning method of stichopus japonicas BPI gene, and method for constructing recombinant stichopus japonicas BPI genetically engineered bacterium

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment 1

[0051] BPI gene cloning and sequence analysis

[0052](1) Through high-throughput transcriptome sequencing and expression profiling analysis of coelomocytes of sea cucumbers with rot skin syndrome and healthy sea cucumbers, multiple EST sequences encoding BPI genes were found (Pengjuan Zhang, Chenghua Li, Lin Zhu, Xiurong Su, Ye Li, Chunhua Jin, Taiwu Li. De Novo assembly of the sea cucumber Apostichopus japonicus hemocytes transcriptome to identify miRNA targets associated with skin ulceration syndrome. Plos ONE 2013. 8(9):e73506.), select EST clones encoding partial fragments of A. japonicus BPI;

[0053] (2) RACE primer design: Design nested primers for RACE based on EST clones encoding partial fragments of A. japonicus: 3' upstream specific primer 1: TTCAAAGCAAAAACAACCCGTC, 3' upstream specific primer 2: TGGGTGTCATCTTTTGAAGGTGT; 5' downstream specific primer 1: GCACTGTTGATGAGGTAGTCGCT, 5' downstream specific primer 2: GTGTCCGCAGTAAGGAGTAATCT, amplified 3' adapter pri...

specific Embodiment 2

[0061] Construction Method of Recombinant Apostichopus japonicus BPI Genetic Engineering Bacteria

[0062] 1. Cloning of N-terminal domain of BPI protein and construction and expression of recombinant protein

[0063] a. Extraction of total RNA: Take 1.0 mL of body cavity fluid of sea cucumber, centrifuge at 800 g for 5 min, collect blood cells, add 1.0 mL of Trizol reagent (purchased from Takara Company), vortex and mix well, leave at room temperature for 5 min, then add 0.2 mL of chloroform, Shake and mix well, let stand at room temperature for 10 minutes, centrifuge at 12,000 g for 15 minutes at 4°C, pipette the supernatant into a centrifuge tube, add an equal volume of isopropanol to the supernatant, mix well, let stand at room temperature for 5 minutes, 4°C , 12,000 rpm, centrifuge for 10 min, remove the supernatant, add 1 mL of ethanol with a mass percentage concentration of 75% to the pellet, centrifuge at 4°C, 12,000 rpm for 5 min, remove the supernatant, and let t...

specific Embodiment 3

[0081] Antibacterial activity analysis of recombinant protein of Apostichopus japonicus

[0082] (1) Four test-negative bacteria Vibrio parahaemolyticus ( Vibrio parahaemolyticus ), Vibrio harveii ( Vibrio Harvey ), Vibrio splendidus ( Vibrio splendidus ), Vibrio alginolyticus (Vibrio alginolyticus) were inoculated in 2216E liquid medium (tryptone 5g / L, yeast extract 1 g / L, pH=7.6) at 28 ℃, 150 r / min and cultivated to OD 600 =1.0, take 100 ul of bacterial solution and smear the plate (agar 12 g / mL);

[0083] (2) The tested positive bacteria Micrococcus luteus ( Micrococcus luteus ) inoculated in nutrient agar liquid medium (tryptone 10 g / L, beef extract 3 g / L, NaCl 5g / L, pH=7.3±0.1) and cultivated at 35 °C and 150 r / min. Solid medium (agar 15 g / L) was mixed and poured on the plate, the concentration of bacteria was 1×10 7 cfu / mL;

[0084] (3) Use the modified agar plate diffusion method (Oxford cup) to measure the antibacterial activity of the recombinant bactericida...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a stichopus japonicas BPI gene, an encoded protein, a cloning method of the stichopus japonicas BPI gene, and a method for constructing a recombinant stichopus japonicas BPI genetically engineered bacterium. The stichopus japonicas BPI gene is characterized in that a stichopus japonicas BPI gene sequence is as shown in SEQ ID NO.1; the cloning method comprises the step of designing a nested primer of RACE according to an expressed sequence tag EST sequence which is homologous to the BPI gene; a full-length gene is expanded by employing an RACE technique; a stichopus japonicas BPI protein sequence is as shown in SEQ ID NO.2; an N-terminal protein structure domain sequence is as shown in SEQ ID NO.3; an N-terminal structure domain of the stichopus japonicas BPI protein is amplified by employing primers which respectively comprise BamH I sites and Not I sites; the cloned target gene is inserted into a vector to obtain recombinant plasmids; and the recombinant plasmids are subjected to induced expression, and purification and renaturation, so as to obtain the genetically engineered bacterium. The stichopus japonicas BPI gene has the advantage of having obvious sterilization effect on vibrio parahaemolyticus, vibrio harveyi and micrococcus luteus.

Description

technical field [0001] The invention belongs to the fields of molecular biology and genetic engineering, and in particular relates to a japonicus japonicus BPI gene, a coded protein and a cloning method thereof, and a method for constructing a japonicus japonicus BPI genetic engineering bacterium. Background technique [0002] Bactericidal / permeability-increasing protein (BPI) is a cationic antibacterial glycoprotein secreted by neutrophils (Polymorphonuclear neutrophils, PMNs), which can selectively kill gram-negative bacteria (gram-negative bacteria, G - ) and neutralize endotoxin and other functions. BPI, as a product of the body's own antibacterial system, is so far the only antibacterial substance that is considered to have both functions of sterilizing bacteria and neutralizing endotoxin. Studies have found that the N-terminal fragment of BPI has the same function as BPI. The N-terminus of BPI is rich in cations, which can specifically bind to the lipid A region of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C12N15/10C07K14/435C12N15/70A61K38/17A61P31/04
Inventor李成华邵铱娜张卫卫车钟杰张鹏娟金春华李晔欧昌荣
OwnerNINGBO UNIV